Genomic Characterisation of an Isolate of Brassica Yellows Virus Associated with Brassica Weed in Tasmania
Abstract
:1. Introduction
2. Results
2.1. NGS Analysis
2.2. Validation of NGS Results and Amplification of Missing Genome Sequence
2.3. Multiple Sequence Alignment and Phylogenetic Analysis
Isolate | Accession No. | Host | Country | References |
---|---|---|---|---|
BrYV-Tas | OM469309 | Raphanus raphanistrum | Australia, Hobart | This study |
BrYV-ABJ | HQ388348 | Brassica napusvar.napobrassica | China: Beijing | [2] |
BrYV-BBJ | HQ388349 | B. napusvar.napobrassica | China: Beijing | [2] |
BrYV-AJS | HQ388350 | B. campestris L. | China: Jiangsu | [2] |
BrYV-BJS | HQ388351 | B. campestris L. | China: Jiangsu | [2] |
BrYV-CR | JN015068 | R. raphanistrum | China: Haidian | [6] |
BrYV-CC | KF015269 | B. rapa pekinensis | China: Beijing | [6] |
BrYV-CS | KF923236 | B.rapa | South Korea: Cheongsong | [3] |
BrYV-China | KY310572 | B. napus | China | Direct submission |
BrYV-CC1 | LC428358 | B. rapa subsp. pekinensis | Japan: Hokkaido | [4] |
BrYV-WN1 | LC428359 | Sinapis alba | Japan: Hokkaido | [4] |
BrYV-TO3 | LC428360 | B. rapa subsp. Rapa | Japan: Okayama | [4] |
BrYV-NAP | LC428361 | B. napus | Japan: Okayama | [4] |
BrYV-CD9 | LC428362 | B. oleraceavar.capitata | Japan: Hokkaido | [4] |
BrYV-R3b | LC428363 | R. sativus | Japan: Okayama | [4] |
BrYV-RT8 | LC428364 | R. sativus | Japan: Hokkaido | [4] |
BrYV-R40 | LC428365 | R. sativus | Japan: Okayama | [4] |
BrYV-Anhui | MF314820 | Nicotiana tabacum | China | Direct submission |
BrYV-NtabQJ | MK057527 | N. tabacum | China: Yunnan | [17] |
BrYV-ABJ | NC_016038 | B. napusvar.napobrassica | China: Beijing | [2] |
TuYV-FL1 | NC_003743 | Lactuca sativa | France: Avignon | [20] |
2.4. Recombination Analysis
2.5. Nucleotide Diversity and Haplotype Variability Indices
2.6. Detection of Positive and Negative Selection Sites
3. Discussion
4. Materials and Methods
4.1. Sample Collection and Nucleic Acid Extraction
4.2. Next-Generation Sequencing (NGS) and Sequence Reads Analysis
4.3. Validation of NGS Results and Amplification of BrYV Genome
4.4. Multiple Sequence Alignment and Phylogenetic Analysis
4.5. Recombination Analysis
4.6. Nucleotide Diversity and Haplotype Variability Indices
4.7. Detection of Positive and Negative Selection Sites
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Garcia-Ruiz, H.; Holste, N.M.; LaTourrette, K. Poleroviruses (Luteoviridae). In Encyclopedia of Virology, 4th ed.; Bamford, D.H., Zuckerman, M., Eds.; Academic Press: Oxford, UK, 2021; pp. 594–602. [Google Scholar]
- Xiang, H.-Y.; Dong, S.-W.; Shang, Q.-X.; Zhou, C.-J.; Li, D.-W.; Yu, J.-L.; Han, C.-G. Molecular characterization of two genotypes of a new polerovirus infecting brassicas in China. Arch. Virol. 2011, 156, 2251–2255. [Google Scholar] [CrossRef] [PubMed]
- Lim, S.; Yoo, R.H.; Igori, D.; Zhao, F.; Kim, K.H.; Moon, J.S. Genome sequence of a recombinant brassica yellows virus infecting Chinese cabbage. Arch. Virol. 2015, 160, 597–600. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, N.; Tamada, T. Host range and molecular analysis of Beet leaf yellowing virus, Beet western yellows virus-JP and Brassica yellows virus in Japan. Plant Pathol. 2019, 68, 1045–1058. [Google Scholar] [CrossRef]
- Filardo, F.; Nancarrow, N.; Kehoe, M.; McTaggart, A.R.; Congdon, B.; Kumari, S.; Aftab, M.; Trębicki, P.; Rodoni, B.; Thomas, J.; et al. Genetic diversity and recombination between turnip yellows virus strains in Australia. Arch. Virol. 2021, 166, 813–829. [Google Scholar] [CrossRef]
- Zhang, X.Y.; Xiang, H.Y.; Zhou, C.J.; Li, D.W.; Yu, J.L.; Han, C.G. Complete genome sequence analysis identifies a new genotype of brassica yellows virus that infects cabbage and radish in China. Arch. Virol. 2014, 159, 2177–2180. [Google Scholar] [CrossRef]
- Peter, K.A.; Gildow, F.; Palukaitis, P.; Gray, S.M. The C terminus of the polerovirus p5 readthrough domain limits virus infection to the phloem. J. Virol. 2009, 83, 5419–5429. [Google Scholar] [CrossRef] [Green Version]
- Simon-Loriere, E.; Holmes, E.C. Why do RNA viruses recombine? Nat. Rev. Microbiol. 2011, 9, 617–626. [Google Scholar] [CrossRef]
- Sztuba-Solińska, J.; Urbanowicz, A.; Figlerowicz, M.; Bujarski, J.J. RNA-RNA recombination in plant virus replication and evolution. Annu. Rev. Phytopathol. 2011, 49, 415–443. [Google Scholar] [CrossRef]
- Walker, P.J.; Siddell, S.G.; Lefkowitz, E.J.; Mushegian, A.R.; Adriaenssens, E.M.; Alfenas-Zerbini, P.; Davison, A.J.; Dempsey, D.M.; Dutilh, B.E.; García, M.L. Changes to virus taxonomy and to the International Code of Virus Classification and Nomenclature ratified by the International Committee on Taxonomy of Viruses. Arch. Virol. 2021, 166, 2633–2648. [Google Scholar] [CrossRef]
- Beuve, M.; Stevens, M.; Liu, H.-Y.; Wintermantel, W.M.; Hauser, S.; Lemaire, O. Biological and Molecular Characterization of an American Sugar Beet-Infecting Beet western yellows virus Isolate. Plant Dis. 2008, 92, 51–60. [Google Scholar] [CrossRef] [Green Version]
- Moonan, F.; Molina, J.; Mirkov, T.E. Sugarcane yellow leaf virus: An emerging virus that has evolved by recombination between luteoviral and poleroviral ancestors. Virology 2000, 269, 156–171. [Google Scholar] [CrossRef] [PubMed]
- Stuart, G.W.; Moffett, P.K.; Bozarth, R.F. A comprehensive open reading frame phylogenetic analysis of isometric positive strand ssRNA plant viruses. Arch. Virol. 2006, 151, 1159–1177. [Google Scholar] [CrossRef] [PubMed]
- Fox, A.; Mumford, R.A. Plant viruses and viroids in the United Kingdom: An analysis of first detections and novel discoveries from 1980 to 2014. Virus Res. 2017, 241, 10–18. [Google Scholar] [CrossRef] [PubMed]
- Kehoe, M.A.; Coutts, B.A.; Buirchell, B.J.; Jones, R.A. Plant virology and next generation sequencing: Experiences with a Potyvirus. PLoS ONE 2014, 9, e104580. [Google Scholar] [CrossRef] [Green Version]
- Roossinck, M.J.; Martin, D.P.; Roumagnac, P. Plant Virus Metagenomics: Advances in Virus Discovery. Phytopathology 2015, 105, 716–727. [Google Scholar] [CrossRef] [Green Version]
- Wang, Q.; Xu, F.Z.; An, L.L.; Xiang, H.Y.; Zhang, W.H.; Liu, G.S.; Liu, H.B. Molecular characterization of a new recombinant brassica yellows virus infecting tobacco in China. Virus Genes 2019, 55, 253–256. [Google Scholar] [CrossRef]
- Schubert, J.; Rabenstein, F.; Graichen, K.; Richter, K. Comparison of the 5’ end nucleotide sequences of luteoviruses from oilseed rape and sugar beet. Arch. Phytopathol. Plant Prot. 1998, 31, 519–530. [Google Scholar] [CrossRef]
- Zhang, X.; Peng, Y.; Wang, Y.; Zhang, Z.; Li, D.; Yu, J.; Han, C. Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction. Virol. J. 2016, 13, 189. [Google Scholar] [CrossRef] [Green Version]
- Veidt, I.; Lot, H.; Leiser, M.; Scheidecker, D.; Guilley, H.; Richards, K.; Jonard, G. Nucleotide sequence of beet western yellows virus RNA. Nucleic Acids Res. 1988, 16, 9917–9932. [Google Scholar] [CrossRef] [Green Version]
- Kamitani, M.; Nagano, A.J.; Honjo, M.N.; Kudoh, H. RNA-Seq reveals virus–virus and virus–plant interactions in nature. FEMS Microbiol. Ecol. 2016, 92, fiw176. [Google Scholar] [CrossRef] [Green Version]
- Kuhn, J.H.; Wolf, Y.I.; Krupovic, M.; Zhang, Y.-Z.; Maes, P.; Dolja, V.V.; Koonin, E.V. Classify viruses—The gain is worth the pain. Nature 2019, 566, 318–320. [Google Scholar] [CrossRef] [PubMed]
- Fiallo-Olivé, E.; Navas-Hermosilla, E.; Ferro, C.G.; Zerbini, F.M.; Navas-Castillo, J. Evidence for a complex of emergent poleroviruses affecting pepper worldwide. Arch. Virol. 2018, 163, 1171–1178. [Google Scholar] [CrossRef] [PubMed]
- Mayo, M.; d’Arcy, C. Family Luteoviridae: A reclassification of luteoviruses. In The Luteoviridae; Smith, H.G., Barke, R.H., Eds.; CABI Publishing: Wallingford, UK, 1999; pp. 15–22. [Google Scholar]
- King, A.M.; Lefkowitz, E.; Adams, M.J.; Carstens, E.B. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses; Elsevier: Amsterdam, The Netherlands, 2011; Volume 9. [Google Scholar]
- Stevens, M.; Freeman, B.; LIU, H.Y.; Herrbach, E.; Lemaire, O. Beet poleroviruses: Close friends or distant relatives? Mol. Plant Pathol. 2005, 6, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Costa, T.M.; Blawid, R.; Aranda, M.A.; Freitas, D.M.S.; Andrade, G.P.; Inoue-Nagata, A.K.; Nagata, T. Cucurbit aphid-borne yellows virus from melon plants in Brazil is an interspecific recombinant. Arch. Virol. 2019, 164, 249–254. [Google Scholar] [CrossRef]
- Garcia-Ruiz, H.; Diaz, A.; Ahlquist, P. Intermolecular RNA recombination occurs at different frequencies in alternate forms of brome mosaic virus RNA replication compartments. Viruses 2018, 10, 131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagy, P.D. Recombination in plant RNA viruses. In Plant Virus Evolution; Springer: Berlin/Heidelberg, Germany, 2008; pp. 133–156. [Google Scholar]
- Filardo, F.F.; Thomas, J.E.; Webb, M.; Sharman, M. Faba bean polerovirus 1 (FBPV-1); a new polerovirus infecting legume crops in Australia. Arch. Virol. 2019, 164, 1915–1921. [Google Scholar] [CrossRef] [PubMed]
- Knierim, D.; Deng, T.C.; Tsai, W.S.; Green, S.K.; Kenyon, L. Molecular identification of three distinct Polerovirus species and a recombinant Cucurbit aphid-borne yellows virus strain infecting cucurbit crops in Taiwan. Plant Pathol. 2010, 59, 991–1002. [Google Scholar] [CrossRef]
- Moonan, F.; Mirkov, T.E. Analyses of genotypic diversity among North, South, and Central American isolates of sugarcane yellow leaf virus: Evidence for Colombian origins and for intraspecific spatial phylogenetic variation. J. Virol. 2002, 76, 1339–1348. [Google Scholar] [CrossRef] [Green Version]
- Silva, T.F.; Corrêa, R.L.; Castilho, Y.; Silvie, P.; Bélot, J.L.; Vaslin, M.F. Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease. Virol. J. 2008, 5, 123. [Google Scholar] [CrossRef] [Green Version]
- Newbert, M.J. The Genetic Diversity of Turnip Yellows Virus in Oilseed Rape (Brassica Napus) in Europe, Pathogenic Determinants, New Sources of Resistance and Host Range. Ph.D. Thesis, University of Warwick, Coventry, UK, 2016. [Google Scholar]
- Bushnell, B. BBTools: A Suite of Bioinformatic Tools Used for DNA and RNA Sequence Data Analysis. 2016. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Martin, D.; Rybicki, E. RDP: Detection of recombination amongst aligned sequences. Bioinformatics 2000, 16, 562–563. [Google Scholar] [CrossRef] [PubMed]
- Sawyer, S. GENECONV: A Computer Package for the Statistical Detection of Gene Conversion. 1999. Available online: http://www.math.wustl.edu/~sawyer (accessed on 29 October 2021).
- Salminen, M.O.; Carr, J.K.; Burke, D.S.; McCutchan, F.E. Identification of breakpoints in intergenotypic recombinants of HIV type 1 by bootscanning. AIDS Res. Hum. Retrovir. 1995, 11, 1423–1425. [Google Scholar] [CrossRef] [PubMed]
- Smith, J.M. Analyzing the mosaic structure of genes. J. Mol. Evol. 1992, 34, 126–129. [Google Scholar] [CrossRef] [PubMed]
- Posada, D.; Crandall, K.A. Evaluation of methods for detecting recombination from DNA sequences: Computer simulations. Proc. Natl. Acad. Sci. USA 2001, 98, 13757–13762. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gibbs, M.J.; Armstrong, J.S.; Gibbs, A.J. Sister-Scanning: A Monte Carlo procedure for assessing signals in recombinant sequences. Bioinformatics 2000, 16, 573–582. [Google Scholar] [CrossRef] [PubMed]
- Boni, M.F.; Posada, D.; Feldman, M.W. An exact nonparametric method for inferring mosaic structure in sequence triplets. Genetics 2007, 176, 1035–1047. [Google Scholar] [CrossRef] [Green Version]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef] [Green Version]
- Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef] [Green Version]
- Scheffler, K.; Martin, D.P.; Seoighe, C. Robust inference of positive selection from recombining coding sequences. Bioinformatics 2006, 22, 2493–2499. [Google Scholar] [CrossRef] [Green Version]
- Pond, S.L.K.; Frost, S.D.W. Datamonkey: Rapid detection of selective pressure on individual sites of codon alignments. Bioinformatics 2005, 21, 2531–2533. [Google Scholar] [CrossRef]
- Kosakovsky Pond, S.L.; Posada, D.; Gravenor, M.B.; Woelk, C.H.; Frost, S.D.W. GARD: A genetic algorithm for recombination detection. Bioinformatics 2006, 22, 3096–3098. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primer Name | Sequence 5′ to 3′ | Target | Position | Product Size (bp) | PCR Conditions | References |
---|---|---|---|---|---|---|
BrY-Ntab001F (+) | ACAAAAGAAACCAGGAGGRAA | BrYV ORF0 | 1 | 780 | 1 × 95 °C (15 min), 35 × [94 °C (30 s), 55 °C (30 s), 72 °C (1 min)], 1 × 72 °C (10 min) | [17,18] |
TuYVOrf0R | TCATACAAACATTTCGGTGTAGAC | 781 | ||||
BrY-Ntab724F (+) | TCTCACTCCTGAAGAAATCC | BrYV ORF1-ORF2 | 724 | 1349 | 1 × 95 °C (15 min), 35 × [94 °C (30 s), 55 °C (30 s), 72 °C (1 min)], 1 × 72 °C (10 min) | [17] |
BrY-Ntab2064R (−) | TGAATCACACGCTCCCTCTCAG | 2073 | ||||
BrYA484F | TACTTGGACTAGAGATGCTGAAAG | BrYV-ORF0 (Genotype A) | 484 | 277 | 1 × 95 °C (10 min), 32 × [94 °C (30 s), 62 °C (60 s), 72°C (1 min)], 1 × 72 °C (10 min) | [19] |
BrYB88F | CCTCCACCCAAAACAAGTAT | BrYV-ORF0 (Genotype B) | 88 | 673 | ||
BrYC257F | CGAGTTTCCGTACTTGTTG | BrYV-ORF0 (Genotype C) | 257 | 504 | ||
BrY761R | AGACCGAAGAGCTGAAAAGG | BrYV-ORF0 (Reverse) | 761 | - |
Dataset | Number of Sequences | Total Number of Sites | S | Eta | H | Hd | π | θw | Tajima’s D |
---|---|---|---|---|---|---|---|---|---|
BrYV | 20 | 5827 | 1477 | 1684 | 19 | 0.995 | 0.06883 | 0.07683 | −0.89807 |
P0 | 20 | 751 | 159 | 171 | 19 | 0.995 | 0.06490 | 0.05976 | 0.04076 |
P1 | 20 | 1835 | 451 | 528 | 19 | 0.995 | 0.08736 | 0.07039 | 0.25116 |
P1-P2 | 20 | 3119 | 652 | 747 | 17 | 0.993 | 0.07001 | 0.06137 | −0.01833 |
P3 | 20 | 609 | 87 | 94 | 18 | 0.989 | 0.03297 | 0.04027 | −0.99362 |
P3-P5 | 20 | 2137 | 688 | 780 | 19 | 0.995 | 0.06144 | 0.10058 | −1.93078 |
P4 | 20 | 528 | 72 | 78 | 14 | 0.932 | 0.03147 | 0.03844 | −0.99753 |
P5 | 20 | 1342 | 506 | 578 | 19 | 0.995 | 0.07522 | 0.13073 | −2.07541 |
ORF | Avg. dN/dS Ratio | Positive Selection | Negative Selection | ||||||
---|---|---|---|---|---|---|---|---|---|
Total Sites | Avg. | Min. | Max. | Total Sites | Avg. | Min. | Max. | ||
BrYV | 0.902 | 501 | 1.341 | 1.051 | 3.613 | 1167 | 0.699 | 0.051 | 0.949 |
P0 | 0.376 | 9 | 2.040 | 1.050 | 4.54 | 201 | 0.286 | 0.054 | 0.935 |
P1 | 0.414 | 22 | 1.548 | 1.063 | 4.401 | 282 | 0.319 | 0.050 | 0.942 |
P1-P2 | 0.369 | 42 | 1.534 | 1.051 | 5.829 | 679 | 0.289 | 0.050 | 0.937 |
P3 | 0.409 | 11 | 1.777 | 1.084 | 3.660 | 122 | 0.265 | 0.050 | 0.918 |
P3-P5 | 0.409 | 42 | 1.775 | 1.060 | 4.462 | 576 | 0.294 | 0.050 | 0.942 |
P4 | 0.402 | 11 | 1.487 | 1.098 | 2.026 | 127 | 0.280 | 0.052 | 0.932 |
P5 | 0.371 | 25 | 1.459 | 1.058 | 2.778 | 353 | 0.288 | 0.050 | 0.949 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Umar, M.; Farooq, T.; Tegg, R.S.; Thangavel, T.; Wilson, C.R. Genomic Characterisation of an Isolate of Brassica Yellows Virus Associated with Brassica Weed in Tasmania. Plants 2022, 11, 884. https://doi.org/10.3390/plants11070884
Umar M, Farooq T, Tegg RS, Thangavel T, Wilson CR. Genomic Characterisation of an Isolate of Brassica Yellows Virus Associated with Brassica Weed in Tasmania. Plants. 2022; 11(7):884. https://doi.org/10.3390/plants11070884
Chicago/Turabian StyleUmar, Muhammad, Tahir Farooq, Robert S. Tegg, Tamilarasan Thangavel, and Calum R. Wilson. 2022. "Genomic Characterisation of an Isolate of Brassica Yellows Virus Associated with Brassica Weed in Tasmania" Plants 11, no. 7: 884. https://doi.org/10.3390/plants11070884