Potential Value of Wood Tar as a Natural Fungicide against Valsa mali
Abstract
:1. Introduction
2. Results
2.1. Sensitivity to Wood Tar
2.2. Effect of Wood Tar on Mycelial Morphology
2.3. Effect of Wood Tar on the Permeability of Cells
2.4. Effect of Wood Tar on Pectinase Activity and Oxalic Acid Content
2.5. The Expression of Pectinase Genes
2.6. Activity of PAL and POD in Apple Leaves
2.7. Protective and Therapeutic Activity of Wood Tar on V. mali
2.8. Field Test of Wood Tar on Valsa Canker
3. Discussion
4. Materials and Methods
4.1. Fungicides, Medium, and Strains
4.2. Sensitivity of V. mali to Wood Tar
4.3. Effect of Wood Tar on Mycelial Morphology
4.4. The Effect of Tar on the Cell Membrane Permeability
4.5. Pectinases Activity and Oxalic Acid Content
4.6. Effect of Wood Tar on the Expression of Genes Involved in Pectinase
4.7. Effect of Wood Tar on the Activity of POD and PAL
4.8. Protective and Therapeutic Activity of Wood Tar against V. mali
4.9. Field Test of Wood Tar against V. mali
4.10. Data Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Wang, L.; Gao, Z.; Huang, L.l.; Wei, J.; Zang, R.; Kang, Z.S. Screening fungicide for pathogen inhibition and disease control of apple tree Valsa canker. Acta Phytopathol. Sin. 2009, 39, 549–554. [Google Scholar]
- Byrde, R.; Crowdy, S.H.; Roach, F.A.; Byrde, R.; Crowdy, S.H.; Roach, F.A. Observations on apple canker: V. eradicant spraying and canker control. Ann. Appl. Biol. 1952, 39, 581–587. [Google Scholar] [CrossRef]
- Tamura, O.; Saito, I. Histopathological changes of apple bark infected by Valsa ceratosperma (tode ex fr.) maire during dormant and growing periods. Jpn. J. Phytopathol. 1982, 48, 490–498. [Google Scholar] [CrossRef]
- Cao, K.Q.; Guo, L.Y.; Li, B.H.; Sun, G.Y.; Chen, H.J. Investigations on the occurrence and control of apple canker in China. Plant Prot. 2009, 35, 114–117. [Google Scholar]
- Mazela, B. Fungicidal value of wood tar from pyrolysis of treated wood. Waste Manag. 2007, 27, 461–465. [Google Scholar] [CrossRef]
- Li, Y.X.; Lin, H.W. Gas chromatographic analysis of organic components in hardwood bark wood vinegar and wood tar. Chin. J. Anal. Sci. 2012, 28, 58–62. [Google Scholar]
- Yin, Z.Y.; Liu, H.Q.; Li, Z.P.; Ke, X.W.; Dou, D.L.; Gao, X.N.; Song, N.; Dai, Q.Q.; Wu, Y.X.; Xu, J.R.; et al. Genome sequence of Valsa canker pathogens uncovers a potential adaptation of colonization of woody bark. New Phytol. 2015, 208, 1202–1216. [Google Scholar] [CrossRef]
- Tripathi, P.; Dubey, N.K. Exploitation of natural products as an alternative strategy to control postharvest fungal rotting of fruit and vegetables. Postharvest Biol. Technol. 2004, 32, 235–245. [Google Scholar] [CrossRef]
- Liao, M.; Ren, X.X.; Gao, Q.; Liu, N.N.; Tang, F.; Wang, G.; Cao, H.Q. Anti-fungal activity of moso bamboo (Phyllostachys pubescens) leaf extract and its development into a botanical fungicide to control pepper phytophthora blight. Sci. Rep. 2021, 11, 4146. [Google Scholar] [CrossRef]
- Marino, G.; Gaggia, F.; Saiano, F.; Biavati, B.; Marangoni, B. Elimination of in vitro bacterial contaminants in shoot cultures of ‘MRS 2/5’ plum hybrid by the use of Melia azedarach extracts. Eur. J. Plant Pathol. 2009, 123, 195–205. [Google Scholar] [CrossRef]
- Pereira, F.; Sancha, S.; Feliciano, D.; Luo, X.; Mulhovo, S.; Duarte, A.; Madureira, A.M.; Ferreira, M. Evaluation of the antibacterial activity of some African medicinal plants. Planta Med. 2015, 81, 108. [Google Scholar] [CrossRef]
- Mangalagiri, N.P.; Panditi, S.K.; Jeevigunta, N. Antimicrobial activity of essential plant oils and their major components. Heliyon 2021, 7, e06835. [Google Scholar] [CrossRef] [PubMed]
- Punja, Z.K.; Huang, J.S.; Jenkins, S.F. Relationship of mycelial growth and production of oxalic acid and cell wall degrading enzymes to virulence in Sclerotium rolfsii. Can. J. Plant Pathol. 1985, 7, 109–117. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar]
- Wen, P.F.; Chen, J.Y.; Kong, W.F.; Pan, Q.H.; Wan, S.B.; Huang, W.D. Salicylic acid induced the expression of phenylalanine ammonia-lyase gene in grape berry. Plant Sci. 2005, 169, 928–934. [Google Scholar] [CrossRef]
- Leyva, A. Low temperature induces the accumulation of Phenylalanine Ammonia-Lyase and Chalcone Synthase mRNAs of Arabidopsis thaliana in a light-dependent manner. Plant Physiol. 1995, 108, 39–46. [Google Scholar] [CrossRef]
- Subramaniam, R.; Reinold, S.; Molitor, E.K.; Douglas, C.J. Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa × Populus deltoides) phenylalanine ammonia-lyase genes. Plant Physiol. 1993, 102, 71–83. [Google Scholar] [CrossRef] [Green Version]
- Yin, Z.Y.; Ke, X.W.; Huang, D.X.; Gao, X.N.; Voegele, R.T.; Kang, Z.S.; Huang, L.L. Validation of reference genes for gene expression analysis in Valsa mali var. mali using real-time quantitative PCR. World J. Microb. Biot. 2013, 29, 1563–1571. [Google Scholar] [CrossRef]
- Wang, Y.; Sun, Y.; Han, L.R.; Zhang, X.; Feng, J.T. Potential use of cuminic acid as a botanical fungicide against Valsa mali. Microb. Pthhogenesis 2017, 106, 9–15. [Google Scholar] [CrossRef]
- Lira, R.H.; Hernandez, M.; Pineda, G. Bactericidal and fungicidal activity of plant extracts from endemic plants of the Chihuahuan Desert of northern Mexico. Planta Med. 2006, 72, 213. [Google Scholar] [CrossRef]
- Wang, Y.; Sun, Y.; Zhang, Y.; Zhang, X.; Feng, J.T. Antifungal activity and biochemical response of cuminic acid against Phytophthora apsica leonian. Molecules 2016, 21, 756. [Google Scholar] [CrossRef] [Green Version]
- Jiao, H.; Fan, Y.Y.; Gao, X.N.; Huang, L.L.; Wang, X.B.; Wang, L. Control Efficacy of Eight Fungicides on Apple Valsa Canker. J. Henan Agric. Sci. 2015, 44, 95–99. [Google Scholar]
- Wang, Y.; Jiang, L.; Wang, M.M.; Feng, J.T. Baseline sensitivity and action mechanism of the sterol demethylation inhibitor flusilazole to Valsa Mali. Pestic. Biochem. Physiol. 2020, 171, 104722. [Google Scholar] [CrossRef]
- Duan, Y.B.; Ge, C.Y.; Liu, S.M.; Chen, C.J.; Zhou, M.G. Effect of phenylpyrrole fungicide fludioxonil on morphological and physiological characteristics of Sclerotinia sclerotiorum. Pestic. Biochem. Phys. 2013, 106, 61–67. [Google Scholar] [CrossRef]
- Wang, X.L.; Zang, R.; Yin, Z.Y.; Kang, Z.S.; Huang, L.L. Delimiting cryptic pathogen species causing apple Valsa canker with multilocus data. Ecol. Evol. 2014, 4, 1369–1380. [Google Scholar] [CrossRef]
- Fukasawa-Akada, T.; Kung, S.D.; Watson, J.C. Phenylalanine ammonia-lyase gene structure, expression, and evolution in Nicotiana. Plant Mol. Biol. 1996, 30, 711–722. [Google Scholar] [CrossRef]
- Kiselev, K.V.; Dubrovina, A.S.; Bulgakov, P.V. Phenylalanine ammonia-lyase and stilbene synthase gene expression in rolB transgenic cell cultures of Vitis amurensis. Appl. Microbiol. Biotechnol. 2009, 82, 647–655. [Google Scholar] [CrossRef] [PubMed]
- Bessho, H.; Tsuchiya, S.; Soejima, J. Screening methods of apple trees for resistance to Valsa canker. Euphytica 1994, 77, 15–18. [Google Scholar] [CrossRef]
- Chen, C.; Liang, W.X.; Li, B.X.; Wang, C.X.; Dong, X.L. Effects of Temperature, Humidity, and Wound Age on Valsa mali Infection of Apple Shoot Pruning Wounds. Plant Dis. 2016, 100, 2394–2401. [Google Scholar] [CrossRef] [Green Version]
- Wei, J.L.; Huang, L.L.; Gao, Z.P.; Ke, X.W.; Kang, Z.S. Laboratory evaluation methods of apple Valsa canker disease caused by Valsa ceratosperma sensu Kobayashi. Acta Phytopathol. Sin. 2010, 40, 14–20. [Google Scholar]
- Ma, Y.Q.; Li, J.P.; Wang, L.; Li, J.J.; Hui, N.N.; Zhou, T.W. Inhibitory effects of five fungicides on apple tree valsa canker. Gansu Agric. Sci. Technol. 2012, 6, 20–22. [Google Scholar]
- O’Neill, T.M.; PYE, D.; Locke, T. The effect of fungicides, irrigation and plant density on the development of Peronospora sparsa, the cause of downy mildew in rose and blackberry. Ann. Appl. Biol. 2002, 140, 207–214. [Google Scholar] [CrossRef]
- Sistani, F.; Ramezanpour, S.S.; Nasrollanejad, S. Field evaluation of different fungicides application to control olive leaf spot. Aust. J. Basic Appl. Sci. 2009, 3, 3341–3345. [Google Scholar]
- Large, E.C.; Beer, W.J. Field trials of copper fungicides for the control of potato blight iii. Low-copper fungicides. Ann. Appl. Biol. 2010, 33, 406–413. [Google Scholar] [CrossRef]
- Okada, K.; Furukawa, M. Occurrence and countermeasure of fungicide-resistant pathogens in vegetable field of Osaka prefecture. J. Pestic. Sci. 2008, 33, 326–329. [Google Scholar] [CrossRef] [Green Version]
- Nazanin, Z.N.; Jessica, K. Effects of host plant resistance and fungicide application on phoma stem canker, growth parameters and yield of winter oilseed rape. Crop. Prot. 2018, 112, 313–321. [Google Scholar]
Strains | EC50 (μg/mL) for | |
---|---|---|
Wood Tar | Carbendazim | |
PF-15 | 76.73 bc a | 0.15 b |
PF-18 | 83.45 b | 0.13 bc |
PF-24 | 85.20 b | 0.19 c |
PF-28 | 92.81 a | 0.21 c |
PF-32 | 69.54 c | 0.08 a |
PF-35 | 79.22 b | 0.15 b |
Sample | Protective Activity | Curative Activity | ||
---|---|---|---|---|
Lesion Area (cm2) | Control Efficacy (%) | Lesion Area (cm2) | Control Efficacy b (%) | |
Wood Tar (2000 μg/mL) | 1.17 a a | 77.35 a | 1.813 a | 67.89 b |
Wood Tar (1000 μg/mL) | 2.055 b | 60.22 b | 2.968 b | 47.43 c |
Carbendazime (400 μg/mL) | 1.33 a | 74.25 a | 1.426 a | 74.74 a |
Control | 5.166 c | - | 5.646 c | - |
Primer | Sequence (5′–3′) | Use |
---|---|---|
P1 | CTCGCCCATGTACTATGTCTTC | The qRT-PCR primer was |
P2 | GTATCCCAGCCATCCGTATTC | for the VM1 G_05725 gene |
P3 | CCCGCACTACTTCTTCTTTGA | The qRT-PCR primer was |
P4 | ACGTCGCTTCCTTGGATTT | for the VM1 G_03030 gene |
P5 | GTGACCATCTCTAACAGCCATATC | The qRT-PCR primer was |
P6 | CTGGTCATCAGATCCCGTAAAG | for the VM1 G_06261 gene |
P7 | GGAGGGAATAAGGTGAGGATCTA | The qRT-PCR primer was |
P8 | CAGGCCTCAAGTACGCATTAT | for the VM1 G_04322 gene |
P9 | CCAAAGTTCTTCAAGGCCAATC | The qRT-PCR primer was |
P10 | GCAGGTTGTTGATGTAGTTGATG | for the VM1 G_10448 gene |
P11 | TCAGAACAAGTTCGAGGGCGACAA | The qRT-PCR primer was |
P12 | TGAGGGCAATAGAGGGCTTGTTCA | for the reference gene (G6 PDH gene) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; Lv, M.; Zhou, J.; Huang, K.; Sun, Y.; Feng, J. Potential Value of Wood Tar as a Natural Fungicide against Valsa mali. Molecules 2022, 27, 1531. https://doi.org/10.3390/molecules27051531
Chen Y, Lv M, Zhou J, Huang K, Sun Y, Feng J. Potential Value of Wood Tar as a Natural Fungicide against Valsa mali. Molecules. 2022; 27(5):1531. https://doi.org/10.3390/molecules27051531
Chicago/Turabian StyleChen, Yue, Mengjing Lv, Juan Zhou, Ke Huang, Yubo Sun, and Juntao Feng. 2022. "Potential Value of Wood Tar as a Natural Fungicide against Valsa mali" Molecules 27, no. 5: 1531. https://doi.org/10.3390/molecules27051531