Next Article in Journal
Inhibition of the Activating Transcription Factor 6 Branch of Endoplasmic Reticulum Stress Ameliorates Brain Injury after Deep Hypothermic Circulatory Arrest
Next Article in Special Issue
Anatomic Peculiarities Associated with Axial Elongation of the Myopic Eye
Previous Article in Journal
Evolving Role of [18F]Flurocholine PET/CT in Assessing Primary Hyperparathyroidism: Can It Be Considered the First-Line Functional Imaging Approach?
Previous Article in Special Issue
Changes in the Choroidal Thickness of Children Wearing MiSight to Control Myopia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JCM
Volume 12
Issue 3
10.3390/jcm12030813
jcm-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Differential Expression of Circular RNAs and the Role of circAFF1 in Lens Epithelial Cells of High-Myopic Cataract

by
Shiyu Ma
1,2,3,4,
Xiangjia Zhu
1,2,3,4,
Dan Li
1,2,3,4,
Fan Yang
1,2,3,4,
Jiaqi Meng
1,2,3,4,
Yongxiang Jiang
1,2,3,4,
Jing Ma
5,* and
Yi Lu
1,2,3,4,*
1
Department of Ophthalmology, Eye and ENT Hospital, Shanghai Medical College, Fudan University, Shanghai 200031, China
2
Eye Institute, Eye and ENT Hospital, Shanghai Medical College, Fudan University, Shanghai 200031, China
3
Key Laboratory of Myopia, Ministry of Health PR China, Shanghai 200031, China
4
Shanghai Key Laboratory of Visual Impairment and Restoration, Shanghai Medical College, Fudan University, Shanghai 200031, China
5
Department of Facial Plastic and Reconstructive Surgery, ENT Institute, Eye and ENT Hospital, Shanghai Medical College, Fudan University, Shanghai 200031, China
*
Authors to whom correspondence should be addressed.
J. Clin. Med. 2023, 12(3), 813; https://doi.org/10.3390/jcm12030813
Submission received: 23 November 2022 / Revised: 2 January 2023 / Accepted: 18 January 2023 / Published: 19 January 2023
(This article belongs to the Special Issue Advances in High Myopia and Glaucoma)
Browse Figures
Review Reports Versions Notes

Abstract

:
High-myopic cataract (HMC) is a complex cataract with earlier onset and more rapid progress than age-related cataract (ARC). Circular RNAs (circRNAs) have been implicated in many diseases. However, their involvement in HMC remain largely unexplored. To investigate the role of dysregulated circRNAs in HMC, lens epithelium samples from 24 HMC and 24 ARC patients were used for whole transcriptome sequencing. Compared with ARC, HMC had 3687 uniquely expressed circRNAs and 1163 significantly differentially expressed circRNAs (DEcRs) (|log2FC| > 1, p < 0.05). A putative circRNA-miRNA-mRNA network was constructed based on correlation analysis. We validated the differential expression of 3 DEcRs by quantitative polymerase chain reaction (qPCR) using different sets of samples. We further investigated the role of circAFF1 in cultured lens epithelial cells (LECs) and found that the overexpression of circAFF1 promoted cell proliferation, migration and inhibited apoptosis. We also showed that circAFF1 upregulated Tropomyosin 1 (TPM1) expression by sponging miR-760, which was consistent with the network prediction. Collectively, our study suggested the involvement of circRNAs in the pathogenesis of HMC and provide a resource for further study on this topic.

1. Introduction

High-myopic cataract (HMC) refers to a kind of cataract complicated by high myopia (HM) [1,2]. Compared to the most common age-related cataract (ARC), the typical characteristics of HMC included long eye axial length, high incidence of nuclear cataract, earlier onset and more rapid progression of the condition [3]. The population with HMC is becoming larger and younger with the increasing incidence of HM among adolescents [4]. Because HMC is associated with special pathological changes such as posterior scleral staphyloma and zonular weakness, the surgery for HMC is often more difficult than that for ARC, and the postoperative complications such as rupture of the zonules from lens-iris diaphragm retropulsion syndrome (LIDRS), retinal detachment and progressed myopic traction maculopathy are more likely to occur [5,6].
It has been generally accepted that the pathogenesis of HMC involves the interaction between genetic and environmental factors [7]. Variations in sequence or an abnormal expression of several genes have been reported in HMC. The homozygous mutations of Leprecan Like 1 (LEPREL1) were identified in families with HM and early-onset cataract [8,9]. The crystallin alpha A protein level was found decreased in the lens epithelium of HMC compared to ARC [10], which might be associated with HMC by weakening the interaction with unfolded proteins and aggravating protein aggregation [11]. Compared to ARC, HMC showed higher levels of transforming growth factor-β2 (TGF-β2) [12], interleukin-1 receptor antagonist (IL-1ra) [13], angiopoietin-1 (ANG-1) [14], matrix metalloproteinase (MMPs), tissue inhibitor of metalloproteinases (TIMPs) [15], and lower level of monocyte chemoattractant protein-1 (MCP-1) in the aqueous humor [13]. These differences suggested that HMC is also associated with changes in the microenvironment of the eye. However, the etiology and pathogenesis of HMC is still unclear.
Circular RNA (circRNA) is a type of non-coding RNA with a stable closed circular structure without 3′-poly(A) tail or 5′-cap [16]. As one of the hot research topics in epigenetics, circRNAs have been implicated in the development and progression of many ocular diseases such as diabetic retinopathy [17,18], neovascular age-related macular degeneration [19,20], glaucoma [21] and ARC [22,23]. However, the role of circRNAs in HMC has not been explored.
In the present study, we performed whole transcriptome sequencing on lens epithelium samples obtained from HMC and ARC patients and found that a large amount of circRNAs were differentially expressed in HMC. A competing endogenous RNA (ceRNA) network were constructed based on differentially expressed circRNAs (DEcRs), miRNAs (DEmRs) and mRNAs (DEGs). We further demonstrated that circAFF1 increased lens epithelial cells (LECs) viability and migration capacity, inhibited cell apoptosis, and stimulated the expression of Tropomyosin 1 (TPM1) by sponging miR-760. Collectively, our study suggested the involvement of circRNA in the development of HMC.

2. Materials and Methods

2.1. Patients and Samples

This study protocol was approved by the Ethics Committee of the Eye and ENT Hospital of Fudan University (approval number: 2014055) and adhered to the tenets of the Declaration of Helsinki. All patients underwent phacoemulsification surgery. We collected the would-be-discarded lens epithelium tissue from 54 HMC and 54 ARC patients after continuous curvilinear capsulorhexis in cataract surgery at our hospital during the period of November 2020 to September 2021. The type and the severity of cataract were classified according to the Lens Opacities Classification System III (LOCS III) [24]. ARC was defined as typical cortical cataract in eyes with axial length between 21.0–24.5 mm (LOCSIII C 3–5), whereas HMC was defined as typical nuclear cataract with axial length longer than 26 mm (LOCSIII NC 3–5). Patients with other eye conditions, current or previous ocular trauma and positive ocular surgery history were excluded. The basic information of patients involved in the study were shown in Table 1.
Samples were kept in RNA stabilization reagent (Solarbio, Beijing, China) at −80 °C until further use. Twenty-four samples from HMC and ARC each were used for whole transcriptome sequencing, and the rest 30 samples from each group were used for quantitative polymerase chain reaction (qPCR) analysis.

2.2. RNA Extraction and Whole Transcriptome Sequencing

In order to obtain enough RNA for whole transcriptome sequencing, eight samples in each group were mixed and counted as one biological replicate. RNA was extracted using TRIzol reagent (Invitrogen, CA, USA). The quality and quantity of total RNA was determined by Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) and NanoDrop (Thermo Fisher Scientific, Wilmington, DE, USA). One microgram of ribosomal-depleted RNA with RNA integrity number (RIN) value above 7 was obtained using Ribo-Zero rRNA removal Kit (Illumina, San Diego, CA, USA) for library construction with NEBNext® Ultra™ Directional RNA Library Prep Kit (Illumina). For small RNAs, 2 µg of total RNA with RIN value above 7.5 was used for library preparation using NEBNext® Multiplex Small RNA library Prep Set (Illumina). Libraries with different indices were multiplexed and loaded on HiSeq instrument (Illumina). The whole transcriptome sequencing was conducted by Medical Laboratory of Nantong Zhongke (Nantong, China).

2.3. Sequencing Data Analysis

Raw data of fastq format were processed by Trimmomatic (v0.30, Bolger A M, MPlof Molecular Plant Physiology, Berlin, Germany) to filter redundant and low-quality data. For mRNAs, sequences were aligned to reference genome via hisat2 (v2.0.1, Daehwan Kim, Dallas, TX, USA), and gene and isoform expression levels were estimated by Stringtie (v1.3.5, Sam Kovaka, Baltimore, USA). CircRNAs were identified by CIRI (v2.0, Yuan Gao, Beijing, China) and their expressions were calculated according to the junction reads at the back-splicing loci. Spliced reads per billion mapping (SRPBM) was used to normalize the circRNA reads. MiRDeep2 (v0.0.8, Sebastian Mackowiak, Berlin, Germany) was used to identify miRNA and evaluate their expressions. Differential expression analysis was performed with the DEGSeq Bioconductor package (v1.42.0, Likun Wang, Beijing, China). After using Storey’s way for controlling the false discovery rate, corrected p-values were denoted as q-values. Criteria for differential expression was set uniformly for mRNAs, miRNAs and circRNAs as follows: q-value < 0.05 and |log2fold change (FC)| > 1.
Hierarchical clustering analysis for DEcRs and DEGs was performed using Cluster (v2.1.1, Michiel J. L. De Hoon, Tokyo, Japan). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis was performed using clusterProfiler (v3.16.1, Guangchuang Yu, Southern Medical University, Guangzhou City, China) with the following parameters: minGSSize = 10, maxGSSize = 500, p-value < 0.05.

2.4. CeRNA Network Construction

CeRNA regulatory network among DEcRs, DEmRs and DEGs was constructed according to the following procedures: Firstly, target mRNAs and circRNAs of miRNA were identified using miRanda (v3.3a, ChenLiang, Macau S.A.R., China) with thresholds: SCORE ≥ 150 and ENERGY ≤ −20. Pearson correlation coefficient (PCC) of miRNA-circRNA and miRNA-mRNA interactions were calculated. The miRNA-circRNA and miRNA-mRNA pairs with PCC < −0.8 and p-value < 0.05 were selected, and the co-expressed mRNAs and circRNAs that were regulated by the same miRNAs were identified with the criteria of PCC > 0.8 and p-value < 0.05. Finally, Cytoscape (v3.6.1, Otasek, La Jolla, CA, USA) software was utilized to visualize the ceRNA network.

2.5. qPCR Assay

Total RNA was extracted from lens epithelium samples or LECs with TRIzol reagent (Invitrogen) and reverse transcribed to cDNA using the Prime Script RT Reagent Kit with gDNA Eraser (Yisheng Biotech, Shanghai, China). qPCR was performed with SYBR Premix Ex Taq™ (Takara, Shiga, Japan) on a StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as internal control. The relative expression levels of validated circRNAs were calculated by 2−ΔΔCt method. The sequence of all primers used were listed in Table 2.

2.6. Cell Culture

Human embryonic kidney 293T (HEK293T) cells and human LEC line (SRA01/04) were cultured in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum (Biological Industries, Kibbutz, Beit Haemek, Israel) and 1% penicillin/streptomycin (NCM Biotech, Suzhou, China) at 37 °C with 5% CO2.

2.7. Plasmid Construction and Dual-Luciferase Reporter Assay

The following plasmids were constructed for the transfection in HEK293T cells: psiCHECK containing wildtype circAFF1 (predicted binding sequence fragment: 5′-gcCCCAGGAGCACAGAGCCc-3′, 293TWTcAFF1) and mutated circAFF1 (mutant sequence: 5′-gcTAAGGGAGCATGCGTATc-3′, 293TMUTcAFF1). The plasmids were then used to transfect HEK293T cells, with the co-transfection of miR-760 mimics or control mimics using Lipofectamine 2000 (Invitrogen). Cells were lysed 48 h (hrs) later. Both firefly and Renilla luciferase activities were measured using a dual-luciferase reporter assay system (Promega, Madison, WI, USA), and the Renilla luciferase activities were normalized to firefly luciferase activities.

2.8. RNA Fluorescence In Situ Hybridization (FISH) Assay

LECs were seeded in a 4-chanmber slide for 24 h, fixed with 4% paraformaldehyde (PFA), permeabilized with TritonX-100 and incubated with RNA probes at 42 °C in the dark overnight. The slides were washed with 2× saline sodium citrate (SSC) buffer, then the nuclei were counterstained with 4′-6-diamidino-2-phenylindole (DAPI, Cell Signaling Technology, Boston, MA, USA). An EVOSTM Microscope M5000 Imaging System (Invitrogen) was used for visualization. The U6 and 18S ribosome probes were used as nuclei and cytoplasm controls, respectively. The circAFF1 probe and control probe were designed and synthesized by RiboBio Co., Ltd. (Guangzhou, China).

2.9. Construction of Stably Transfected Cell Lines by Lentivirus Transfection

The plasmids carrying circAFF1 (pLC5-ciR-circAFF1) and control (pLC5-ciR) were generated by Geneseed (Guangzhou, China) and the sequences were validated. These plasmids were used to transfect HEK293T cells with L-PEI (Yisheng Biotech) for 48 h to obtain lentivirus. The lentivirus was purified and used to infect LECs. The stably transfected cells were obtained after puromycin screening for 3 days and then used for subsequent analysis as indicated.

2.10. Cell Proliferation Assay

Cell proliferation was analyzed by Cell Counting Kit 8 (NCM Biotech) according to the manufacturer’s instructions. Cells were seeded in 96-well plates at a final density of 5 × 103/well. Ten microliters of CCK-8 solution was added to each well 2 h before the termination of incubation. The optical density (OD) values at 450 nm were measured by a microplate reader (Biotek, Winooski, VT, USA) at 0, 24, 48, 72 and 96 h. The cell proliferation rate was calculated relative to the value of OD450nm at 0 h.

2.11. 5-Ethynyl-2′-deoxyuridine (EdU) Assay

The EdU assay was used to quantitate proliferating cells following the manufacturer’s instruction (RiboBio Co.). Cells in 96-well plates were incubated with 50 µM EdU for 2 h and fixed with 4% PFA. After Apollo and Hoechst staining, cells were visualized and photographed by EVOSTM Microscope M5000 Imaging System.

2.12. Transwell Cell Migration Assay

Cells were seeded in the upper chamber of Transwell inserts with 200 µL medium without FBS. One milliliter medium with 20% FBS was added to the lowed chamber. After 48 h at 37 °C, cells were fixed with 4% PFA and stained with 2% crystal violet staining solution. The migrated cells were captured under microscope and counted by ImageJ.

2.13. Wound Healing Assay

Cells in 6-well plate were incubated with 5% CO2 at 37 °C until near 100% confluency. A cell scratcher was used to create a wound in the middle of the well. Images were captured immediately after the wounding under microscope (0 h) and the width of the wound was measured. They were then cultured with serum-free medium for 36 h and photographed again. The relative migration rate was calculated as follows: (the average width of the wound at 0 h—the width at 36 h)/the width at 0 h × 100%.

2.14. Cell Apoptosis Assay

Cell apoptosis was analyzed using the Annexin V-FITC/propidium iodide (PI) detection kit (Signalway Antibody, College Park, MD, America) according to manufacturer’s instruction and quantitated using flow cytometer (Beckman BD Celesta, San Francisco, CA, USA).

2.15. Statistical Analysis

All experiments were repeated at least three times. Statistical analysis was performed using un-paired two-tailed Student’s t-tests via GraphPad Software (v9.3.1, La Jolla, CA, USA). Data were presented as mean ± standard deviation (SD). Statistical significance was accepted at p-value < 0.05.

3. Results

3.1. DEcRs in Lens Epithelium between HMC and ARC

A total of 9192 circRNA were detected by whole transcriptome sequencing across all lens epithelium samples, consisting of 7091 circRNAs in the HMC group and 5505 circRNAs in the ARC group (Figure 1A,B). Among them, 84.0% of circRNAs were derived from the exons, 8.8% were intronic and 7.2% were intergenic circRNAs (Figure 1C). The length of most circRNAs was less than 800 nucleotides (NTs) (Figure 1D) and they were mainly distributed on chromosomes 1, 2 and 3 (Figure 1E).
We found 2101 (22.9%) circRNAs uniquely expressed in ARC and 3687 (40.1%) circRNAs uniquely expressed in HMC. Within 3404 (37.0%) circRNAs that were expressed by both samples, 1163 were significantly differentially expressed between these two groups (510 upregulated and 653 downregulated). The heatmap showed the top 20 upregulated and downregulated circRNAs in HMC (Figure 1F). The data of whole transcriptome sequencing has been uploaded to Gene Expression Omnibus (GEO accession number PRJNA785074).

3.2. Potential Functions of DEcRs and DEGs in HMC

GO analysis showed that the DEcRs of HMC are mainly enriched in biological processes (BP) related to chromatin and protein modification, such as covalent chromatin modification, histone modification and protein polyubiquitination (Figure 2A), whereas DEGs of HMC were enriched in protein targeting and RNA catabolic process (Figure 2B). KEGG analysis showed that the enriched pathways of DEcRs (Figure 2C) and DEGs (Figure 2D) of HMC included the TGF-β [25], Wnt [26] and mTOR [27] signaling pathways, which have been reported to play important roles in the initiation and progression of cataract.
Based on the correlation analysis among DEcRs, DEmRs and DEGs of HMC, we constructed a ceRNA network including 120 circRNAs, 47 miRNAs and 102 mRNAs (Figure 2E). There were 289 ceRNA pairs in the network. Some DEcRs were predicted to interact with multiple miRNAs and corresponding mRNAs. For example, hsa_circ_0070386 (circAFF1), hsa_circ_0073171 (circMSH3), hsa_circ_0048747 (circSAFB2), hsa_circ_0089972 (circREPS2) and hsa_circ_0000798 (circBPTF) were predicted to interact with miR-760, and miR-760 may interact with 7 mRNAs including Chromosome 7 Open Reading Frame 50 (C7orf50), Golgi SNAP Receptor Complex Member 2 (GOSR2), KxDL Motif Containing 1 (KXD1), Metastasis Associated 1 Family Member 3 (MTA3), Pleckstrin And Sec7 Domain Containing 3 (PSD3), Tensin 2 (TNS2) and TPM1.

3.3. Validation of Differential circRNAs Expression in HMC by qPCR

To validate the sequencing data above, we picked four circRNAs for further qPCR analysis: circSLC15A4, which was expressed only in HMC; circDENND5B, which was expressed only in ARC; circAFF1, which was expressed in both HMC and ARC but was significantly upregulated in the former; circTRPM7, which was also expressed in both HMC and ARC but was significantly downregulated in the former. qPCR analysis was performed using a separate set of lens epithelium samples as described in the Methods (Table 3). The results showed a 3.34 ± 0.97 fold increase (p = 0.003) of circAFF1 expression and a 2.39 ± 0.87 fold increase (p = 0.016) of circSLC15A4 expression in HMC group compared to ARC. The expression of circDENND5B showed a 80.33 ± 9.27% decrease (p = 0.003) in HMC compared with ARC (Figure 3).

3.4. Overexpression of circAFF1 Promoted Cell Proliferation and Migration and Inhibited Cell Apoptosis in LECs

To further illustrate the role of circRNA, we chose circAFF1 to study its function in LECs. RNA-FISH revealed that circAFF1 was distributed in the cytoplasm of LECs (Figure 4A). We generated stable transfected LECs with overexpression of circAFF1 (LECcAFF1) and used vector (LECvector) as control. qPCR analysis showed 31.89 ± 2.55 (mean ± SD) times increased expression of circAFF1 in LECcAFF1 compared to LECvector (n = 3, p < 0.0001, unpaired t-test, Figure 4B). Next, we compared proliferation of LECcAFF1 and LECvector. LECcAFF1 showed a small yet significant higher proliferation rate than controls starting at 24 h (18.22 ± 4.69% higher than control, average ± SD, n = 3, p = 0.005, unpaired t-test) and lasted until the end of the experiment, which as 96 h later (29.68 ± 1.44% higher than control, average ± SD, n = 3, p < 0.0001, unpaired t-test, Figure 4C). Consistently, EdU incorporation analysis showed that the percentage of proliferating LECcAFF1 cells (42.44 ± 1.59%) was 1.41 ± 0.12 times of the LECvector (30.24 ± 1.81%) (n = 3, p = 0.002, unpaired t-test, Figure 4D).
Next, we analyzed the motility of LECcAFF1. The Transwell assay showed 1.35 ± 0.09 times increase of migrated LECcAFF1 cells (374.67 ± 31.35) compared to LECvector (277.33 ± 8.73) (n = 3, p = 0.013, unpaired t-test, Figure 4E). Consistently, wound healing assay also showed that LECcAFF1 cell migration was increased to 247.87 ± 7.8% of the control cells (n = 3, p = 0.0076, unpaired t-test, Figure 4F).
Finally, we compared the number of apoptotic cells by flow cytometry analysis. In LEC blank control, we counted 4.82 ± 1.86% apoptotic cells. On the other hand, apoptotic cells were 12.11 ± 0.26% in LECvector, and 7.22 ± 0.43% in LECcAFF1. Therefore, LECcAFF1 showed 40.44 ± 2.3% decreased cell apoptosis compared to LECvector (n = 3, p < 0.001, unpaired t-test, Figure 4G).

3.5. CircAFF1 Regulate TPM1 Expression by Sponging miR-760

The ceRNA network presented above predicted that circAFF1 may interact with miR-760 through the potential binding sites to regulate TPM1 expression. To validate the prediction, we transfected HEK293T cells with a plasmid containing circAFF1 and miR-760 mimics and examined the luciferase activity. Compared to cells with the control miRNA mimics, we observed 65.43 ± 4.79% decrease in luciferase activity (n = 3, p = 0.003, unpaired t-test). However, when circAFF1 with mutated binding sequence was introduced to HEK293T cells, we observed no significant change in luciferase activity (Figure 5A). The results suggested the interaction between circAFF1 and miR-760 via the predicted binding sequences.
Next, we examined the expression of miR-760 and TPM1 in LECs by qPCR. The expression of miR-760 decreased 35.21 ± 5.07% while the expression of TPM1 increased 198.28 ± 27.96% when circAFF1 was successfully overexpressed in LECs. Meanwhile, the overexpression of miR-760 in LECcAFF1 downregulated the expression of TPM1 by 81.86 ± 1.19% (Figure 5B). The results suggested that circAFF1 regulated TPM1 expression through the inhibition of miR-760.

4. Discussion

More and more evidence suggested the involvement of circRNAs in the occurrence and development of cataract [28]. For example, CircMRE11A was involved in ARC by interacting with UBXN1 to promote cell cycle arrest and aging of LECs [29]. CircZNF292 [30], circHIPK3 [23], circEBP41 [31], circ0122396 [32], circKMT2E [33] and circPAG1 [34,35] regulate cell proliferation, apoptosis, autophagy or oxidative stress response by targeting different miRNAs, and thus promote the progression of ARC and diabetic cataract (DC). Moreover, the reduced m6A abundance of circRNAs in the lens epithelium of ARC patients could affect the stability, localization, cleavage, and translation of circRNAs [36]. However, the HMC related circRNA expression profile had not been reported.
In this study, we obtained circRNA profile of HMC and found that HMC was accompanied by significant changes in circRNA expression when compared to ARC. These circRNAs were enriched in biological processes which controls chromatin and protein modification and enriched in many cataract-related KEGG pathways. A network of circRNA-miRNA-mRNA was predicted. Our results provided a useful resource for future studies on the roles of circRNA in the pathogenesis of HMC. The different expression of circRNAs may contribute to the pathogenic processes of HMC depending on their localization and interactions with DNA, RNA and proteins [37]. For example, circRNA may regulate the HMC related gene expression such as CRYAA [10] by modulating transcription [38], sponging miRNA [30] or interact with mRNA directly [39]. Besides, circRNA could also be the sponges for proteins [40]. CircRNAs may bind proteins and act as scaffolding molecules that regulate protein-protein interactions [41], which may influence the function of proteins such as α crystallin [10].
We further demonstrated the role of circAFF1 in regulating the activity of LECs. The excessive proliferation and migration of LECs could potentially lead to the aggregation and differentiation of LECs at the lens equator, which would accelerate the compaction and hardening of the lens nucleus [42]. We found overexpression of circAFF1 in LECs cell line SRA01/04 significantly promote the proliferation and migration and inhibit cell apoptosis, which suggested that the upregulation of circAFF1 in HMC lens capsule may accelerate the occurrence and development of HMC.
We further provided evidence to show that circAFF1 interacts with miR-760 and regulates the expression of TPM1. We found that circAFF1 was mainly distributed in cytoplasm of LECs, where most circRNAs function as miRNA sponges. The miR-760 was predicted to bind to circAFF1, which was downregulated in HMC lens epithelium samples and circAFF1 overexpressed LECs. The interaction was testified by dual luciferase experiments. TPM1 was the downstream gene of miR-760 [43], which was upregulated in lens epithelium samples of HMC according to the analysis of whole transcriptome sequencing. Previous studies found that TPM1 was upregulated in LECs isolated from cataractous lenses of Shumiya Cataract Rats (SCRs), compared with non-cataractous lenses [44]. TPM1 is a member of the tropomyosin family involved in regulating and stabilizing cell cytoskeleton actin filaments [45]. It was found to be induced by TGFβ-2 during epithelial-mesenchymal transition (EMT) in LECs, which has been proposed as a major cause of posterior capsule opacification (PCO) [46]. But the role of TPM1 in the pathogenesis of HMC needs to be further studied.

5. Conclusions

In conclusion, our study mapped the circRNAs in lens epithelium samples of HMC, and provided evidence to show that circAFF1 upregulated the expression TPM1 via miRNA-760 and participated in the regulation of LECs proliferation, apoptosis and migration. Further investigations on HMC-specific circRNAs may provide useful insights on the pathogenesis of HMC.

Author Contributions

Conceptualization, S.M., J.M. (Jing Ma) and Y.L.; data curation, S.M., F.Y. and J.M. (Jiaqi Meng); funding acquisition, X.Z. and Y.L.; investigation, S.M., F.Y. and J.M. (Jiaqi Meng); methodology, X.Z., J.M. (Jing Ma) and Y.L.; project administration, S.M. and Y.L.; resources, Y.J. and Y.L.; software, X.Z. and D.L.; supervision, X.Z., J.M. (Jing Ma) and Y.L.; validation, J.M. (Jing Ma) and D.L.; visualization, S.M., F.Y. and J.M. (Jiaqi Meng); writing—original draft, S.M.; writing—review and editing, X.Z., D.L., J.M. (Jing Ma) and Y.L. All authors have read and agreed to the published version of the manuscript.

Funding

Publication of this article was supported by research grants from the National Natural Science Foundation of China (Nos. 82122017, 81870642, 81970780 and 81670835), Shanghai Municipal Key Clinical Specialty Program (shslczdzk01901).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Ethics Committee of the Eye and ENT Hospital of Fudan University (approval number: 2014055, date of approval: 27 November 2014).

Informed Consent Statement

Our research didn’t need patient consent because the collected tissues were discarded lens epithelium tissue in the cataract surgery.

Data Availability Statement

The data of whole transcriptome sequencing presented in this study are openly available in Gene Expression Omnibus. GEO accession number: PRJNA785074.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Younan, C.; Mitchell, P.; Cumming, R.G.; Rochtchina, E.; Wang, J.J. Myopia and incident cataract and cataract surgery: The blue mountains eye study. Invest. Ophthalmol. Vis. Sci. 2002, 43, 3625–3632. [Google Scholar] [PubMed]
  2. Wong, T.Y.; Klein, B.E.; Klein, R.; Tomany, S.C.; Lee, K.E. Refractive errors and incident cataracts: The beaver dam eye study. Invest. Ophthalmol. Vis. Sci. 2001, 42, 1449–1454. [Google Scholar] [PubMed]
  3. Kanthan, G.L.; Mitchell, P.; Rochtchina, E.; Cumming, R.G.; Wang, J.J. Myopia and the long-term incidence of cataract and cataract surgery: The blue mountains eye study. Clin. Exp. Ophthalmol. 2014, 42, 347–353. [Google Scholar] [CrossRef] [PubMed]
  4. Holden, B.A.; Fricke, T.R.; Wilson, D.A.; Jong, M.; Naidoo, K.S.; Sankaridurg, P.; Wong, T.Y.; Naduvilath, T.J.; Resnikoff, S. Global prevalence of myopia and high myopia and temporal trends from 2000 through 2050. Ophthalmology 2016, 123, 1036–1042. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Chong, E.W.; Mehta, J.S. High myopia and cataract surgery. Curr. Opin. Ophthalmol. 2016, 27, 45–50. [Google Scholar] [CrossRef] [PubMed]
  6. Yao, Y.; Lu, Q.; Wei, L.; Cheng, K.; Lu, Y.; Zhu, X. Efficacy and complications of cataract surgery in high myopia. J. Cataract. Refract. Surg. 2021, 47, 1473–1480. [Google Scholar] [CrossRef]
  7. Ikuno, Y. Overview of the complications of high myopia. Retin.-J. Retin. Vitr. Dis. 2017, 37, 2347–2351. [Google Scholar] [CrossRef]
  8. Mordechai, S.; Gradstein, L.; Pasanen, A.; Ofir, R.; El, A.K.; Levy, J.; Belfair, N.; Lifshitz, T.; Joshua, S.; Narkis, G.; et al. High myopia caused by a mutation in leprel1, encoding prolyl 3-hydroxylase 2. Am. J. Hum. Genet. 2011, 89, 438–445. [Google Scholar] [CrossRef] [Green Version]
  9. Guo, H.; Tong, P.; Peng, Y.; Wang, T.; Liu, Y.; Chen, J.; Li, Y.; Tian, Q.; Hu, Y.; Zheng, Y.; et al. Homozygous loss-of-function mutation of the leprel1 gene causes severe non-syndromic high myopia with early-onset cataract. Clin. Genet. 2014, 86, 575–579. [Google Scholar] [CrossRef]
  10. Yang, J.; Zhou, S.; Gu, J.; Guo, M.; Xia, H.; Liu, Y. Upr activation and the down-regulation of α-crystallin in human high myopia-related cataract lens epithelium. PLoS ONE 2015, 10, e137582. [Google Scholar] [CrossRef]
  11. Moreau, K.L.; King, J.A. Protein misfolding and aggregation in cataract disease and prospects for prevention. Trends Mol. Med 2012, 18, 273–282. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Zhang, K.; Zhu, X.; Chen, M.; Sun, X.; Yang, J.; Zhou, P.; Lu, Y. Elevated transforming growth factor-β2 in the aqueous humor: A possible explanation for high rate of capsular contraction syndrome in high myopia. J. Ophthalmol. 2016, 2016, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Zhu, X.; Zhang, K.; He, W.; Yang, J.; Sun, X.; Jiang, C.; Dai, J.; Lu, Y. Proinflammatory status in the aqueous humor of high myopic cataract eyes. Exp. Eye Res. 2016, 142, 13–18. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, J.S.; Da, W.J.; Zhu, G.Y.; Li, J.; Xiong, Y.; Yusufu, M.; He, H.L.; Sun, X.L.; Ju, T.; Tao, Y.; et al. The expression of cytokines in aqueous humor of high myopic patients with cataracts. Mol. Vis. 2020, 26, 150–157. [Google Scholar]
  15. Jia, Y.; Hu, D.N.; Sun, J.; Zhou, J. Correlations between mmps and timps levels in aqueous humor from high myopia and cataract patients. Curr. Eye Res. 2017, 42, 600–603. [Google Scholar] [CrossRef]
  16. Memczak, S.; Jens, M.; Elefsinioti, A.; Torti, F.; Krueger, J.; Rybak, A.; Maier, L.; Mackowiak, S.D.; Gregersen, L.H.; Munschauer, M.; et al. Circular rnas are a large class of animal rnas with regulatory potency. Nature 2013, 495, 333–338. [Google Scholar] [CrossRef]
  17. Zhu, K.; Hu, X.; Chen, H.; Li, F.; Yin, N.; Liu, A.L.; Shan, K.; Qin, Y.W.; Huang, X.; Chang, Q.; et al. Downregulation of circrna dmnt3b contributes to diabetic retinal vascular dysfunction through targeting mir-20b-5p and bambi. Ebiomedicine 2019, 49, 341–353. [Google Scholar] [CrossRef] [Green Version]
  18. Chang, X.; Zhu, G.; Cai, Z.; Wang, Y.; Lian, R.; Tang, X.; Ma, C.; Fu, S. Mirna, lncrna and circrna: Targeted molecules full of therapeutic prospects in the development of diabetic retinopathy. Front. Endocrinol. 2021, 12, 771552. [Google Scholar] [CrossRef]
  19. Zhou, R.M.; Shi, L.J.; Shan, K.; Sun, Y.N.; Wang, S.S.; Zhang, S.J.; Li, X.M.; Jiang, Q.; Yan, B.; Zhao, C. Circular rna-zbtb44 regulates the development of choroidal neovascularization. Theranostics 2020, 10, 3293–3307. [Google Scholar] [CrossRef]
  20. Liu, X.; Zhang, L.; Wang, J.H.; Zeng, H.; Zou, J.; Tan, W.; Zhao, H.; He, Y.; Shi, J.; Yoshida, S.; et al. Investigation of circrna expression profiles and analysis of circrna-mirna-mrna networks in an animal (mouse) model of age-related macular degeneration. Curr. Eye Res. 2020, 45, 1173–1180. [Google Scholar] [CrossRef]
  21. Chen, X.; Zhou, R.; Shan, K.; Sun, Y.; Yan, B.; Sun, X.; Wang, J. Circular rna expression profiling identifies glaucoma-related circular rnas in various chronic ocular hypertension rat models. Front. Genet. 2020, 11, 556712. [Google Scholar] [CrossRef] [PubMed]
  22. Xu, X.; Gao, R.; Li, S.; Li, N.; Jiang, K.; Sun, X.; Zhang, J. Circular rna circznf292 regulates h2o2 -induced injury in human lens epithelial hle-b3 cells depending on the regulation of the mir-222-3p/e2f3 axis. Cell Biol. Int. 2021, 45, 1757–1767. [Google Scholar] [CrossRef]
  23. Cui, G.; Wang, L.; Huang, W. Circular rna hipk3 regulates human lens epithelial cell dysfunction by targeting the mir-221–3p/pi3k/akt pathway in age-related cataract. Exp. Eye Res. 2020, 198, 108128. [Google Scholar] [CrossRef] [PubMed]
  24. Davison, J.A.; Chylack, L.T. Clinical application of the lens opacities classification system iii in the performance of phacoemulsification. J. Cataract. Refract. Surg. 2003, 29, 138–145. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, G.B.; Liu, Z.G.; Wang, J.; Fan, W. Mir-34 promotes apoptosis of lens epithelial cells in cataract rats via the tgf-β/smads signaling pathway. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 3485–3491. [Google Scholar] [PubMed]
  26. Antosova, B.; Smolikova, J.; Borkovcova, R.; Strnad, H.; Lachova, J.; Machon, O.; Kozmik, Z. Ectopic activation of wnt/β-catenin signaling in lens fiber cells results in cataract formation and aberrant fiber cell differentiation. PLoS ONE 2013, 8, e78279. [Google Scholar] [CrossRef] [Green Version]
  27. He, L.; Zhang, N.; Wang, L.; Du, L.; Li, C.; Li, Y.; Li, X.; Zhu, X.; Lu, Q.; Yin, X. Quercetin inhibits aqp1 translocation in high-glucose-cultured sra01/04 cells through pi3k/akt/mtor pathway. Curr. Molec. Pharmacol. 2020, 14, 587–596. [Google Scholar] [CrossRef]
  28. Zhang, C.; Hu, J.; Yu, Y. Circrna is a rising star in researches of ocular diseases. Front. Cell Dev. Biol. 2020, 8, 850. [Google Scholar] [CrossRef]
  29. Liu, J.; Zhang, J.; Zhang, G.; Zhou, T.; Zou, X.; Guan, H.; Wang, Y. Circmre11a_013 binds to ubxn1 and integrates atm activation enhancing lens epithelial cells senescence in age-related cataract. Aging 2021, 13, 5383–5402. [Google Scholar] [CrossRef]
  30. Liang, S.; Dou, S.; Li, W.; Huang, Y. Profiling of circular rnas in age-related cataract reveals circznf292 as an antioxidant by sponging mir-23b-3p. Aging 2020, 12, 17271–17287. [Google Scholar] [CrossRef]
  31. Zhou, C.; Huang, X.; Li, X.; Xiong, Y. Circular rna erythrocyte membrane protein band 4.1 assuages ultraviolet irradiation-induced apoptosis of lens epithelial cells by stimulating 5’-bisphosphate nucleotidase 1 in a mir-24-3p-dependent manner. Bioengineered 2021, 12, 8953–8964. [Google Scholar] [CrossRef]
  32. He, J.; Xie, P.; Ouyang, J. Circ_0122396 protects human lens epithelial cells from hydrogen peroxide-induced injury by binding to mir-15a-5p to stimulate fgf1 expression. Curr. Eye Res. 2021, 47, 1–10. [Google Scholar] [CrossRef] [PubMed]
  33. Fan, C.; Liu, X.; Li, W.; Wang, H.; Teng, Y.; Ren, J.; Huang, Y. Circular rna circ kmt2e is up-regulated in diabetic cataract lenses and is associated with mir-204-5p sponge function. Gene 2019, 710, 170–177. [Google Scholar] [CrossRef] [PubMed]
  34. Yang, Y.; Li, Q.; Zhang, X.; Cui, G. Circpag1 inhibits the high glucose-induced lens epithelial cell injury by sponging mir-630 and upregulating epha2. Curr. Eye Res. 2021, 46, 1822–1831. [Google Scholar] [CrossRef] [PubMed]
  35. Tao, D.; Liu, Z.; Wang, L.; Li, C.; Zhang, R.; Ni, N. Circpag1 interacts with mir-211-5p to promote the e2f3 expression and inhibit the high glucose-induced cell apoptosis and oxidative stress in diabetic cataract. Cell Cycle 2022, 21, 1–12. [Google Scholar] [CrossRef] [PubMed]
  36. Li, P.; Yu, H.; Zhang, G.; Kang, L.; Qin, B.; Cao, Y.; Luo, J.; Chen, X.; Wang, Y.; Qin, M.; et al. Identification and characterization of n6-methyladenosine circrnas and methyltransferases in the lens epithelium cells from age-related cataract. Invest. Ophthalmol. Vis. Sci. 2020, 61, 13. [Google Scholar] [CrossRef]
  37. Liu, C.X.; Chen, L.L. Circular rnas: Characterization, cellular roles, and applications. Cell 2022, 185, 2016–2034. [Google Scholar] [CrossRef]
  38. Li, X.; Zhang, J.L.; Lei, Y.N.; Liu, X.Q.; Xue, W.; Zhang, Y.; Nan, F.; Gao, X.; Zhang, J.; Wei, J.; et al. Linking circular intronic rna degradation and function in transcription by rnase h1. Sci. China-Life Sci. 2021, 64, 1795–1809. [Google Scholar] [CrossRef]
  39. Rossi, F.; Beltran, M.; Damizia, M.; Grelloni, C.; Colantoni, A.; Setti, A.; Di Timoteo, G.; Dattilo, D.; Centrón-Broco, A.; Nicoletti, C.; et al. Circular rna znf609/ckap5 mrna interaction regulates microtubule dynamics and tumorigenicity. Mol. Cell 2022, 82, 75–89. [Google Scholar] [CrossRef]
  40. Du, W.W.; Yang, W.; Liu, E.; Yang, Z.; Dhaliwal, P.; Yang, B.B. Foxo3 circular rna retards cell cycle progression via forming ternary complexes with p21 and cdk2. Nucleic Acids Res. 2016, 44, 2846–2858. [Google Scholar] [CrossRef] [Green Version]
  41. Du, W.W.; Zhang, C.; Yang, W.; Yong, T.; Awan, F.M.; Yang, B.B. Identifying and characterizing circrna-protein interaction. Theranostics 2017, 7, 4183–4191. [Google Scholar] [CrossRef] [PubMed]
  42. Bassnett, S.; Costello, M.J. The cause and consequence of fiber cell compaction in the vertebrate lens. Exp. Eye Res. 2017, 156, 50–57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Li, W.; Cheng, B. Knockdown of lncrna neat1 inhibits myofibroblast activity in oral submucous fibrosis through mir-760/tpm1 axis. J. Dental Sci. 2022, 17, 707–717. [Google Scholar] [CrossRef] [PubMed]
  44. Kubo, E.; Hasanova, N.; Fatma, N.; Sasaki, H.; Singh, D.P. Elevated tropomyosin expression is associated with epithelial-mesenchymal transition of lens epithelial cells. J. Cell. Mol. Med. 2013, 17, 212–221. [Google Scholar] [CrossRef] [PubMed]
  45. Janco, M.; Kalyva, A.; Scellini, B.; Piroddi, N.; Tesi, C.; Poggesi, C.; Geeves, M.A. A-tropomyosin with a d175n or e180g mutation in only one chain differs from tropomyosin with mutations in both chains. Biochemistry 2012, 51, 9880–9890. [Google Scholar] [CrossRef]
  46. Shibata, S.; Shibata, N.; Ohtsuka, S.; Yoshitomi, Y.; Kiyokawa, E.; Yonekura, H.; Singh, D.P.; Sasaki, H.; Kubo, E. Role of decorin in posterior capsule opacification and eye lens development. Cells 2021, 10, 863. [Google Scholar] [CrossRef]
Jcm 12 00813 g001 550
Figure 1. Total circRNAs detected by whole transcriptome sequencing in HMC and ARC lens epithelium samples. (A) Volcano plot of circRNAs. (B) The Venn diagram of overlapped circRNAs between HMC and ARC. (C) The genomic location of circRNAs. (D) The length distribution of circRNAs. (E) The chromosome distribution of circRNAs. (F) Hierarchical clustering analysis of the top 20 upregulated and downregulated DEcRs in HMC compared to ARC. Expression values are indicated by red and green shades, suggesting expressions above and below median expression level across all samples, respectively. H: HMC; A: ARC.
Figure 1. Total circRNAs detected by whole transcriptome sequencing in HMC and ARC lens epithelium samples. (A) Volcano plot of circRNAs. (B) The Venn diagram of overlapped circRNAs between HMC and ARC. (C) The genomic location of circRNAs. (D) The length distribution of circRNAs. (E) The chromosome distribution of circRNAs. (F) Hierarchical clustering analysis of the top 20 upregulated and downregulated DEcRs in HMC compared to ARC. Expression values are indicated by red and green shades, suggesting expressions above and below median expression level across all samples, respectively. H: HMC; A: ARC.
Jcm 12 00813 g001
Jcm 12 00813 g002 550
Figure 2. Functional enrichment analysis of DEcRs and DEGs and the predicted ceRNA network in HMC. (A) Enriched biological processes of GO by DEcRs. * p < 0.05. (B) Enriched biological processes of GO by DEGs. * p < 0.05. (C) Enriched KEGG pathways by DEcRs. (D) Enriched KEGG pathways by DEGs. (E) The ceRNA network. The association between miRNA, miRNA and mRNA was predicted based on correlation analysis according to the following standards: |log2FC| > 1 and p < 0.05, |PCC| > 0.8. Red node: upregulated circRNA, blue node: downregulated circRNA, blue arrows: downregulated miRNA, red arrows: upregulated miRNA, blue squares: downregulated mRNA, red squares: upregulated mRNA.
Figure 2. Functional enrichment analysis of DEcRs and DEGs and the predicted ceRNA network in HMC. (A) Enriched biological processes of GO by DEcRs. * p < 0.05. (B) Enriched biological processes of GO by DEGs. * p < 0.05. (C) Enriched KEGG pathways by DEcRs. (D) Enriched KEGG pathways by DEGs. (E) The ceRNA network. The association between miRNA, miRNA and mRNA was predicted based on correlation analysis according to the following standards: |log2FC| > 1 and p < 0.05, |PCC| > 0.8. Red node: upregulated circRNA, blue node: downregulated circRNA, blue arrows: downregulated miRNA, red arrows: upregulated miRNA, blue squares: downregulated mRNA, red squares: upregulated mRNA.
Jcm 12 00813 g002
Jcm 12 00813 g003 550
Figure 3. The expression of four selected circRNAs in HMC and ARC lens epithelium samples. RNA was extracted from 30 HMC and 30 ARC lens epithelium samples and used for qPCR analysis of the indicated circRNAs. The expression was normalized to GAPDH. Data were expressed as mean ± SD. ns p > 0.05, * p < 0.05, ** p < 0.01.
Figure 3. The expression of four selected circRNAs in HMC and ARC lens epithelium samples. RNA was extracted from 30 HMC and 30 ARC lens epithelium samples and used for qPCR analysis of the indicated circRNAs. The expression was normalized to GAPDH. Data were expressed as mean ± SD. ns p > 0.05, * p < 0.05, ** p < 0.01.
Jcm 12 00813 g003
Jcm 12 00813 g004 550
Figure 4. Overexpression of circAFF1 promoted cell proliferation, migration and inhibited cell apoptosis in LECs. (A) Subcellular localization of circAFF1 in LECs as determined by RNA-FISH assay. The nucleus was stained with DAPI. Scale bar: 20 μm. (B) Levels of circAFF1 expression in LECs with stable transfection. (C) The results of CCK-8 assay showing higher proliferation rate of LECcAFF1 than LECvector after 24 h. n = 3, ** p < 0.01, *** p < 0.001, **** p < 0.0001. (D) The results of EdU incorporation showing more proliferating LECcAFF1 than LECvector. The quantitation of the labeled cells was shown in the panel below. n = 3, ** p < 0.01. Scale bar: 100 μm. (E) Transwell assay showed increased migration of LECcAFF1 compared to LECvector. n = 3, * p < 0.05. Scale bar: 100 μm. (F) Wound healing assay showed that the LECcAFF1 migrated significantly faster than the LECvector. n = 3, ** p < 0.01. Scale bar: 100 μm. (G) Cell apoptosis assay showed less apoptotic LECcAFF1 than LECvector. n = 3, *** p < 0.001. Data were expressed as mean ± SD.
Figure 4. Overexpression of circAFF1 promoted cell proliferation, migration and inhibited cell apoptosis in LECs. (A) Subcellular localization of circAFF1 in LECs as determined by RNA-FISH assay. The nucleus was stained with DAPI. Scale bar: 20 μm. (B) Levels of circAFF1 expression in LECs with stable transfection. (C) The results of CCK-8 assay showing higher proliferation rate of LECcAFF1 than LECvector after 24 h. n = 3, ** p < 0.01, *** p < 0.001, **** p < 0.0001. (D) The results of EdU incorporation showing more proliferating LECcAFF1 than LECvector. The quantitation of the labeled cells was shown in the panel below. n = 3, ** p < 0.01. Scale bar: 100 μm. (E) Transwell assay showed increased migration of LECcAFF1 compared to LECvector. n = 3, * p < 0.05. Scale bar: 100 μm. (F) Wound healing assay showed that the LECcAFF1 migrated significantly faster than the LECvector. n = 3, ** p < 0.01. Scale bar: 100 μm. (G) Cell apoptosis assay showed less apoptotic LECcAFF1 than LECvector. n = 3, *** p < 0.001. Data were expressed as mean ± SD.
Jcm 12 00813 g004
Jcm 12 00813 g005 550
Figure 5. CircAFF1 increased TPM1 expression by sponging miR-760. (A) The upper panel: the predicted binding sequences of circAFF1 and miR-760; the lower panel: the relative luciferase reporter activity of 293TWTcAFF1 and 293TMUTcAFF1 following transfection with miR-760 mimics and control mimics. ** p < 0.01. (B) qPCR showed decreased expression of miR-760 in LECcAFF1. The expression of TPM1 was increased in LECcAFF1 and decreased in LECcAFF1 with miR-760 mimics. ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Figure 5. CircAFF1 increased TPM1 expression by sponging miR-760. (A) The upper panel: the predicted binding sequences of circAFF1 and miR-760; the lower panel: the relative luciferase reporter activity of 293TWTcAFF1 and 293TMUTcAFF1 following transfection with miR-760 mimics and control mimics. ** p < 0.01. (B) qPCR showed decreased expression of miR-760 in LECcAFF1. The expression of TPM1 was increased in LECcAFF1 and decreased in LECcAFF1 with miR-760 mimics. ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Jcm 12 00813 g005
Table
Table 1. Basic information of lens epithelium sample donors involved in this study.
Table 1. Basic information of lens epithelium sample donors involved in this study.
HMCARC
Number5454
Age at surgery (years) **63.04 ± 7.9769.29 ± 3.62
Gender (M/F)17/3719/35
Axial length (mm) ***29.31 ± 2.4023.28 ± 0.65
LOCS III gradeNC 3.71 ± 0.79C 3.58 ± 0.76
HMC: high-myopic cataract; ARC: age-related cataract; M: male; F: female; NC: nuclear color; C: cortical cataract; Data were presented as mean ± SD where applicable; ** p < 0.01, *** p < 0.001.
Table
Table 2. Primers used for qPCR analysis.
Table 2. Primers used for qPCR analysis.
Forward Primer (5′→3′)Reverse Primer (5′→3′)
circAFF1GCCAGAGGAAAGCAGAAGATAAGTCCAGCTGCCATTTGTTTG
circDENND5BGGAACAGATGCAGAACTTTGACGGATAGTGGGCGAGAACTTT
circSLC15A4GTATTCCTGCTGTTCCCAGAACTCCCAGGTTAATGCTCCAATA
circTRPM7TTGGGTCAGATGAACATCAAGATAACACATTCCCTCTTGGTCAAA
GAPDHGGAGCGAGATCCCTCCAAAATGGCTGTTGTCATACTTCTCATGG
Table
Table 3. The information of selected circRNAs.
Table 3. The information of selected circRNAs.
circRNAcircBaseIDLocationLength (bp)Trendlog2FCPredicted Target miRNATrendlog2FC
circAFF1hsa_circ_0070386chr4:88035519|88036451933up3.2hsa-miR-760down−2
circDENND5Bhsa_circ_0025830chr12:31604874|316488531502down−11.51hsa-miR-103a-2-5pup1.26
circSLC15A4hsa_circ_0000462chr12:129299320|129299615296up12.44hsa-miR-204-3pdown−1.01
circTRPM7hsa_circ_0035249chr15:50923614|509552431201down−2.3hsa-miR-520d-3pup1.13
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ma, S.; Zhu, X.; Li, D.; Yang, F.; Meng, J.; Jiang, Y.; Ma, J.; Lu, Y. The Differential Expression of Circular RNAs and the Role of circAFF1 in Lens Epithelial Cells of High-Myopic Cataract. J. Clin. Med. 2023, 12, 813. https://doi.org/10.3390/jcm12030813

AMA Style

Ma S, Zhu X, Li D, Yang F, Meng J, Jiang Y, Ma J, Lu Y. The Differential Expression of Circular RNAs and the Role of circAFF1 in Lens Epithelial Cells of High-Myopic Cataract. Journal of Clinical Medicine. 2023; 12(3):813. https://doi.org/10.3390/jcm12030813

Chicago/Turabian Style

Ma, Shiyu, Xiangjia Zhu, Dan Li, Fan Yang, Jiaqi Meng, Yongxiang Jiang, Jing Ma, and Yi Lu. 2023. "The Differential Expression of Circular RNAs and the Role of circAFF1 in Lens Epithelial Cells of High-Myopic Cataract" Journal of Clinical Medicine 12, no. 3: 813. https://doi.org/10.3390/jcm12030813

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop