Next Article in Journal
An Interaction between Brain-Derived Neurotrophic Factor and Stress-Related Glucocorticoids in the Pathophysiology of Alzheimer’s Disease
Next Article in Special Issue
Integrated Discriminant Evaluation of Molecular Genetic Markers and Genetic Diversity Parameters of Endangered Balearic Dog Breeds
Previous Article in Journal
Optimizing the Ion Conductivity and Mechanical Stability of Polymer Electrolyte Membranes Designed for Use in Lithium Ion Batteries: Combining Imidazolium-Containing Poly(ionic liquids) and Poly(propylene carbonate)
Previous Article in Special Issue
Identification of miRNA Associated with Trichomonas gallinae Resistance in Pigeon (Columba livia)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 3
10.3390/ijms25031594
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Genetic Characteristics of the Hoxc13 Gene and Association Analysis of Wool Traits

by
Hongxian Sun
,
Zhaohua He
,
Fangfang Zhao
,
Jiang Hu
,
Jiqing Wang
,
Xiu Liu
,
Zhidong Zhao
,
Mingna Li
,
Yuzhu Luo
and
Shaobin Li
*
Gansu Key Laboratory of Herbivorous Animal Biotechnology, Faculty of Animal Science and Technology, International Wool Research Institute, Gansu Agricultural University, Lanzhou 730070, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(3), 1594; https://doi.org/10.3390/ijms25031594
Submission received: 7 December 2023 / Revised: 23 January 2024 / Accepted: 25 January 2024 / Published: 27 January 2024
(This article belongs to the Special Issue Molecular Genetics and Breeding Mechanisms in Domestics Animals 2.0)
Browse Figures
Versions Notes

Abstract

:
Homobox C13 (Hoxc13) is an important transcription factor in hair follicle cycle development, and its deletion had been found in a variety of animals leading to abnormal hair growth and disruption of the hair follicle system. In this study, we used immunofluorescence, immunohistochemistry, real-time fluorescence quantitative PCR (RT-qPCR), and Kompetitive Allele-Specific PCR (KASP) genotyping to investigate molecular genetic characteristics of the Hoxc13 gene in Gansu alpine fine-wool sheep. The results revealed that Hoxc13 was significantly expressed during both the anagen and catagen phases (p < 0.05). It was found to be highly expressed predominantly in the dermal papillae and the inner and outer root sheaths, showing a distinct spatiotemporal expression pattern. Two single nucleotide polymorphisms (SNPs) in the exon 1 of Hoxc13, both the individual locus genotypes and the combined haplotypes were found to be correlated with wool length (p < 0.05). It was determined the mutations led to changes in mRNA expression, in which higher expression of this gene was related with longer wool length. In summary, this unique spatiotemporal expression pattern of the Hoxc13 gene may regulate the wool length of Gansu alpine fine-wool sheep, which can be used as a molecular genetic marker for wool traits and thus improve the breed.

1. Introduction

The hair follicle is a complex microscopic organ that undergoes cyclic transformations of anagen, catagen, and telogen phases [1]. A very important condition in the cycle of hair follicle development is the regenerative system of the hair follicle. This regenerative action of the hair follicle depends mainly on a unique interaction between the epithelium and the mesenchyme [2,3]. In recent years, several molecular signals such as fibroblast growth factor, transforming growth factor-β, WNT signaling pathway, sonic hedgehog, neurotrophins, and homeobox, and their interactions in the hair follicle cycle have been identified [4,5,6]. The hair cycle is tightly controlled by autonomous and external molecular signals, and defects in the hair cycle may lead to skin diseases such as alopecia [7].
Homeobox (HOX) proteins contain an evolutionarily conserved DNA-binding homeobox domain. Several members of HOX have been detected in different subregions of the hair follicle during the early stages of mouse hair development [8,9], Hoxc13 is a key member of the HOX family and plays an important role in regulating cell proliferation, differentiation and apoptosis [8,10,11]. In mice, over expression of Hoxc13 led to hair brittleness, and this phenomenon was also observed in mouse Hoxc13 mutants [8,12]. In humans, mutations in Hoxc13 are associated with complete hair loss in pure hair and nail ectodermal dysplasia (PHNED) [13]. The abnormal phenotypes of hair and nails in transgenic mice [12] overexpressing Hoxcl3, as well as in Hoxc13 mutant mice [8], Hoxc13 mutant pigs [14], and humans [15], suggest that the Hoxc13 gene may regulate the expression of the genes that are associated with the formation of hair and nail such as hair- or nail-specific keratin and keratin-associated protein (KAP) genes.
Given the potential regulatory role of the Hoxc13 gene in hair follicle development and hair growth, characterization of the gene and it association with wool traits is of significance for the development of molecular markers for improving wool traits. In this study, we investigated Hoxc13 in Gansu alpine fine-wool sheep using immunofluorescence, immunohistochemistry, sanger sequencing, Kompetitive Allele-Specific PCR (KASP), and RT-qPCR, and we analyzed the association between Hoxc13 genotypes, haplotypes, and wool traits. Therefore, this study evaluated using a candidate gene approach to provide some support for subsequent studies.

2. Results

2.1. AOD Values of Hoxc13 in Different Stages of Skin Follicle Cycle Development

Hoxc13 protein expression was counted in immunohistochemical sections of skin at different stages of hair follicle cycle development, and multiple sites were selected for counting the optical density of stable expression and calculating it using the AOD statistic (AOD = IOD/Area) (Figure 1). The results of AOD showed that Hoxc13 protein was expressed in skin at different stages, and the protein level changed significantly at different stages of hair follicle cycle development. The AOD of Hoxc13 in 1-day-old skin was the lowest among the six periods (p < 0.05; Figure 2).

2.2. Distribution and Localization of Hoxc13 in Different Stages of Hair Follicle Cycle Development in the Skin

The immunofluorescence technique was used to analyze the protein expression of Hoxc13 in the skin at different periods of time, and the intensity of expression was scored positively (Figure 3). Positive scoring results showed Hoxc13 expressed in all six stages of skin hair follicle cycle development, and showed high expression in the dermal papillae and the inner and outer root sheaths, weak expression in hair medulla, and medium or strong expression in the corneum (Table 1). According to the results of different stages of hair follicle development, Hoxc13 may play an important role in the hair follicle cycle, which is regulated mainly through the dermal papillae and the inner and outer root sheaths.

2.3. PCR Amplification Product Electrophoresis, Product Sequencing Results, and SNP Loci Detection Results

Sequencing of the first exon of Hoxc13 in 20 Gansu alpine fine-wool sheep revealed a total of two variant sites (Figure 4). A Blast comparison of Hoxc13 sequencing results identified two SNPs at c.405 and c.673, which were analyzed by KASP in 315 samples, whereas five samples failed to be identified, and in the 310 samples that were successfully identified, these SNPs were found to show two genotypes, TG and TT, and AG and AA, respectively (Figure 5).

2.4. Genotype Frequencies, Gene Frequencies, and Population Genetic Diversity at Each Locus of the Hoxc13 Gene

KASP genotyping was performed on all DNA samples, and the genotype frequencies and gene frequencies of the two SNPs loci were analyzed in the Gansu alpine fine-wool sheep population (Table 2). Two SNPs were detected in the Hoxc13 gene at c.405 (G/T) and c.673 (A/G) with the latter altering the amino acid from serine to glycine. The highest genotype frequency was observed for TT (0.8613) at c.405 (G/T) locus and AA (0.8613) at c.673 (A/G) locus.
The population genetic diversity of the two SNPs loci was counted in the Gansu alpine fine-wool sheep population (Table 3), and both SNP loci were in Hardy–Weinberg equilibrium in the sheep population (p > 0.05), and the frequency of homozygotes is higher than that of heterozygotes. These two SNP provided low polymorphic content (PIC < 0.25).The association analysis of different genotypes of two SNPs of the Hoxc13 gene with the traits of Gansu alpine fine-wool sheep wool was performed (Table 4), and the results showed that, two SNPs of the Hoxc13 gene were strongly associated with wool length (p < 0.05). The sheep with genotype TG and AG have a longer MSL than TT and AA, respectively (p < 0.05). The data for all wool traits were tested with the assumption of normal distribution and all conformed to a normal distribution.

2.5. Haplotype Analysis in the Hoxc13 Gene of Gansu Alpine Fine-Wool Sheep

Linkage disequilibrium analysis of the Hoxc13 gene showed that a haplotype block could be constructed for the 2 SNPs loci of the Hoxc13 gene, and the 2 SNPs were in weak linkage (D′ = 0.72, R2 = 0.518). As can be seen from Table 5, after the haplotype construction of the Hoxc13 gene, four haplotypes with frequency > 0.01 were constructed, i.e., H1 (TA, 0.913), H2 (GG, 0.051), H3 (GA, 0.018), and H4 (TG, 0.018), and the combination of four haplotypes of the Hoxc13 gene showed a total of two haplotype combinations (H1H1, H1H2) with frequency > 0.03. As shown in Table 6, the association analysis of these two haplotype combinations with wool traits indicated that the two different haplotype combinations of the Hoxc13 gene were significantly (p < 0.05) associated with wool length, where the wool length of H1H2 individuals was significantly higher than that of HIH1 (p < 0.05).

2.6. Results of RT-qPCR for Different Genotypes of Two SNPs in the Hoxc13 Gene of Gansu Alpine Fine-Wool Sheep

RT-qPCR study of different genotypes of two SNPs of the Hoxc13 gene in Gansu alpine fine-wool sheep revealed (Figure 6). The c.405 locus TG genotype showed significantly higher expression lever than TT genotype (p < 0.05); c.673 locus AG genotype was significantly high expressed than AA genotype (p < 0.05). Two SNPs of the Hoxc13 gene were expressed at higher levels in heterozygotes than in homozygotes.

3. Discussion

3.1. Protein Expression and Localization Study of Hoxc13 in Skin Tissues of Different Ages

Hair follicle growth and development is a complex long-term physiological process regulated by a variety of physical factors and signaling pathways, and gene expression is one of the determining factors affecting wool growth [16,17]. Therefore, in this study, we investigated the expression of Hoxc13 protein in skin tissues of Gansu alpine fine-wool sheep at different periods, and found that Hoxc13 was expressed at different periods, and showed strong temporal and spatial expression characteristics, with the lowest expression at 1 day of age (telogen), which also indicated that Hoxc13 may play an important role in the development of hair follicles, especially during the anagen and catagen phase. Studies have shown that Hoxc13 knockout in rats, rabbits, and pigs found that the animals appeared to have less hair and no hair [16]. Another study found that Hoxc13 was expressed in the epidermis, outer root sheath, inner root sheath, and hair shaft of secondary hair follicles, but showed a high expression in the outer root sheath [18]. Hoxc13 was found to be expressed in the epidermis and outer root sheaths and correlated with the skin thickness of the Hexi cashmere goat [19], whereas in the Tibetan cashmere goat, Hoxc13 was found to be expressed mainly in the outer root sheath and hair shaft [20]. In addition, the expression of Hoxc13 was found to have an effect on hair follicle activity, which has a stimulatory effect on hair follicle development [18]. In this study, we found that Hoxc13 showed high density strong positive expression in the outer root sheath and inner root sheath in the different stages of skin follicle cycle development, which is consistent with previous studies. Combined with previous studies, it is suggested that Hoxc13 regulates hair follicle growth and development and periodicity through the outer and inner root sheaths. In addition, this study also found that Hoxc13 also showed a high expression in the dermal papillae, which has not been reported in other studies. At the base of the hair follicle, there are cells called papilla cells, which play an important role in hair growth and renewal because they can secrete various factors and thus regulate the surrounding tissues [21,22]. It was found that the dermal papillae have an important role in the hair follicle development cycle because of their function of receiving and sending signals. Therefore, this study found that Hoxc13 regulated hair follicle cycle development and hair growth through the outer root sheath, inner root sheath, and dermal papillae in Gansu alpine fine-wool sheep.

3.2. Identification of Hoxc13 Polymorphisms and Association Analysis of Wool Traits

Hoxc13 plays an important role in the morphogenesis and cyclic development of hair follicles, and has a great influence on the formation of hair traits. And it was found that Hoxc13 gene deletion [13] and mutation [23] cause dysplasia of pure hair and nail ectodermal. Therefore, in a study of Hoxc13 polymorphisms, the results showed that the Blast comparison of Hoxc13 sequencing of exon 1 results revealed two SNPs. One of the SNPs from A to G at the c.673 site resulted in a missense mutation of the amino acid serine to glycine. It has been found that missense mutations tend to occur in the coding region, so that biological traits are altered as a direct result of the occurrence of missense mutations, and that alterations in the base sequences cause changes in the initially translated protein sequences, which ultimately allow for changes in the function of the proteins, leading to the development of many diseases [24]. Although the other mutation site, c.405, is synonymous and does not affect the amino acid sequence of the protein it translates, it has been found that the synonymous mutation affects the efficiency or accuracy of mRNA shearing, the miRNA binding site, or the translation efficiency, as well as the structure and quantity of the expressed protein product, which we should not be ignored [25,26]. An association analysis of the two Hoxc13 SNPs genotypes with wool traits revealed that both were significantly associated with wool length (p < 0.05). Also, to further investigate the relationship between the two SNPs, the two points were found to be weakly interlocked and the haplotype combinations were also found to be significantly correlated with the mean sample length, which in turn further supports the results of the genotype–wool trait association analysis.
To further investigate the effect of mutation on Hoxc13 mRNA expression, mRNA expression of different genotypes was measured and found to be higher in heterozygotes than in the observed homozygotes. The higher expression of Hoxc13 for the TG and AG genotypes is associated with longer wool fibers, compared to the TT and AA genotypes, suggesting a positive correlation between the Hoxc13 expression and wool fiber growth. Although we did not detect the GG genotype at the two SNP sites, it is safe to speculate that individuals with GG genotypes have higher expression levels. It was shown that in a study on the role of bone morphogenetic protein (BMP) in nail differentiation, a high expression of BMP5 in nail fibroblasts was observed by BMP5 treatment of cultured human nail matrix keratin-forming cells (NMK), and also, increased expression of Hoxc13 was observed [27]. Studies on mice have found that the injection of recombinant Hoxc13 polypeptide (rhHoxc13) at the telogen phase significantly promoted hair growth and induced initial hair growth progression [28]. Ectodermal dysplasia-9 (ED-9) is a congenital disorder with clinical manifestations of hypotrichosis and nail dystrophy, and Hoxc13 is the pathogenic gene for ED-9 [29]. In a study in pigs, it was found that when Hoxc13 was knocked down, hair follicles showed various abnormal phenotypes, such as reduced hair follicles and abnormal hair all over the body [14]. The clinical features of knockout mice all exhibit generalized hairlessness and nail abnormalities, while in the mouse study, the gene ends of Hoxc13 were truncated, which is similar to the clinical features of knockout mice with purified Hoxc13 [30].
It has been found that the level of mRNA expression is affected to some extent by intronic mutations [31]. It has also been shown that missense and intronic mutations cause changes in gene mRNA expression and that such changes are significantly associated with these two mutations [32]. The occurrence of synonymous mutations can have an effect on production traits, which has also been reported in several studies [33,34,35,36]. Studies have demonstrated that keratin, a target gene of Hoxc13, is critically regulated by Hoxc13 and also has a regulatory role in hair follicle development, and mutations in Hoxc13 have been shown to cause hair defects in mice and human patients [8,37,38]. Meanwhile, seven SNPs in Hoxc13 have been identified so far in human studies to cause PHNED in patients with clinical manifestations of complete hair loss and nail dysplasia [13,39]. And two of these SNPs belong to missense mutations (c.812A>G and c.929A>C) leading to PHNED [38,40]. In a study on velvet goats, two SNPs (c.812A>G and c.929A>C) were found in the homologous structural domain of Hoxc13, which could lead to the loss of regulatory function of Hoxc13 on keratin, but did not affect the protein expression of Hoxc13 [41]. Therefore, this also suggests that changes in alleles caused by synonymous and missense mutations could potentially make changes in the sequence of DNA and RNA, further affecting gene transcription and mRNA expression. Interestingly, a 27.6 kb homozygous microdeletion was found in the first exon of Hoxc13 in a female patient from Afghanistan, and this deletion resulted in a significant reduction in Hoxc13 mRNA levels in skin tissue [13]. Similarly, in a study of knockout pigs, it was found that Hoxc13 mutations resulted in reduced or even absent Hoxc13 mRNA expression, and that the expression levels of the Hoxc13 downstream genes Foxn1, Krt85, and Krt35 were similarly reduced [14]. And this is consistent with the findings of this study that Hoxc13 mutations will result in changing of mRNA expression of Hoxc13. The same reduction in expression may present with hairlessness symptoms. Thus, this also demonstrates that mutations do cause changes in mRNA expression and ultimately affect production traits; i.e., mutations in the Hoxc13 gene would cause changes in Hoxc13 mRNA expression, thus further affecting wool length. Increasing the length of wool will increase its textile value. However, the present study found that genotypes with less distribution within the population (GT and AT) were more important for wool length, leading to longer wool. This may due to the sheep herd being small with very few rams. Next, it is necessary to expand the population to further validate the experimental results.
In summary, the present study discusses the Hoxc13 gene, and finds a unique and strong expression pattern both temporally and spatially. We found that Hoxc13 gene is highly expressed in the anagen and catagen of hair follicle development, and we further localized the expression sites and found that the Hoxc13 gene is highly expressed in the dermal papillae and the inner and outer root sheaths of the hair follicle. Thus, we can infer that Hoxc13 has an important role in the anagen to realize the maintenance of hair follicle development and wool. Then, a further study found that the first exon of Hoxc13 has two SNPs, and these two mutation sites were significantly correlated with the length of the wool, and its mutation leads to allelic changes that will result in changes in the expression of mRNA. This also suggests that this unique spatiotemporal expression pattern of Hoxc13 may regulate the trait of wool length.

4. Materials and Methods

4.1. Animal Samples

All of the sheep used in this research came from the same herd in Tianzhu Tibetan Autonomous County, Gansu Province, China, to ensure they had the same environmental conditions.
Three newborn healthy Gansu alpine fine-wool sheep ewes with similar weight randomly selected. At 1, 30, 60, 90, 180, and 270 days after birth, a skin tissue of 5 cm2 area was taken from the posterior edge of the scapula of each lamb, and the sample was cleaned with distilled water. A portion of the sample was frozen rapidly in liquid nitrogen and stored at −80 °C. The other part of the sample was fixed in 4% paraformaldehyde and stored at 4 °C. We used 2% lidocaine for local anesthesia on the posterior edge of the scapula of Gansu alpine fine-wool sheep, and then treated with penicillin (Hebei Cheng sheng tang Animal Pharmaceutical Co., Ltd., Shijiazhuang, China) and other drugs to prevent wound infection after sampling was completed, and bandaged with gauze.
A total of 315 Gansu alpine fine-wool sheep of the same age (1 year old) and sex (female) were selected. Blood was collected from all sheep using sodium citrate anticoagulation tubes, then stored at −20 °C and brought back to the laboratory for subsequent experiments. At the same time, wool collection was performed within 5 cm2 of the scapula for subsequent analysis. Wool traits were measured by the New Zealand Pastoral Measurements LTD. (Ahuriri, Napier, New Zealand).
Sixty-six one-year-old Gansu alpine fine-wool sheep ewes were selected at June (hair follicles are in the growth phase), and their skin tissues were taken from the posterior edge of the scapula within an area of 5 cm2 of skin. The samples were washed with distilled water, stored in a liquid nitrogen tank, and brought back to the laboratory at −80 °C. These skin samples were used for analyzing mRNA expression of Hoxc13.

4.2. Immunohistochemical Analysis

Refer to previous research for detailed steps [42], in brief, paraffin sections were routinely dewaxed to water and washed with phosphate-buffered saline (PBS) before antigen repair with citric acid antigen repair buffer (pH = 6.0). The sections were incubated with 3% hydrogen peroxide solution at room temperature for 25 min in darkness to eliminate the activity of endogenous peroxidase. The slices were dripping with the proportional Hoxc13 rabbit primary antibody (bs-13599r) prepared with PBS, and were treated overnight in the box at 4 °C. The sections were spun dry and the corresponding secondary antibody was added, and then freshly prepared Diaminobenzidine (DAB) was added to the sections for color development, which was positive (brown and yellow), and the color development was terminated by using running water. Steps were as follows: Tap water fully rinsed, counterstained, dehydrated; transparent, sealed film; microscope examination, image acquisition, and analysis.

4.3. Immunofluorescence Analysis

Refer to previous research for detailed steps [42]; in brief, paraffin sections were routinely dewaxed to water, and antigen repair was carried out with ethylene diamine tetra-acetic acid (EDTA) antigen repair buffer (pH = 8.0), and then bovine serum albumin (BSA) was added dropwise to block for 30 min. The slices were dripping with the proportional Hoxc13 rabbit primary antibody (bs-13599r) prepared with PBS, and were treated overnight in the box at 4 °C, and then the corresponding secondary antibody was added by drop and incubated for 50 min at room temperature. After the sections were slightly dried, DAPI dihydrochloride (DAPI) dye solution was added to the rings, and the slices were incubated for 10 min at room temperature in the dark. Autofluorescence quencher was added into the ring for 5 min, and then washed with water for 10 min. The sections were slightly dried and sealed with anti-fluorescence quench sealer. The sections were observed and images were collected under a fluorescence microscope.

4.4. PCR Amplification and Genotyping

Hoxc13 is the causative gene for PHNED, and two missense mutations have been found in humans that lead to hairlessness [38,40]. The first exon was selected for the study because it was found to have a missense mutation in the first exon of the Hoxc13 gene predicted by the Ensemble website for sheep. Primers of 200 bp before and after this exon were designed using Oligo7 software (Beijing Huanzhong Reach Technology Co., Ltd., Beijing, China) (Table 7). Twenty Gansu alpine fine-wool sheep were selected for PCR amplification, and the amplification products were later sequenced. Primer synthesis and sequencing were performed at Sangon Biotech Co., Ltd. (Shanghai, China) to further determine the location of SNPs. KASP typing was performed on all samples using an enzyme marker with fluorescence resonance energy transfer (FRET) capability, and the analysis was performed by Gentides Biotechnology (Wuhan, China).

4.5. RT-qPCR Analysis

Trizol method (Thermo Fisher Scientific Co., Ltd., Shanghai, China) was used for the extraction of total RNA from the collected skin samples. The purity and concentration of the extracted RNA were then determined using ultraviolet spectrophotometer and subsequently stored at −80 °C. RNA reverse transcription was performed using the Prime ScriptTM RT kit (Nanjing Novizan Biotechnology Co., Ltd., Nanjing, China) according to the manufacturer’s instructions, and the cDNA was then stored at −20 °C. β-actin was selected as the internal reference gene. All primers and PCR information are given in Table 1. RT-qPCR was carried out using Biosystems QuantStudio®6 Flex (Thermo Lifetech, Waltham, MA, USA) and SYBR Green Pro Taq HS qPCR Kit (Accurate Biology, Changsha, China). To ensure the authenticity and reliability of the results, we used three biological replicates and four technical replicates for each period.

4.6. Measurements and Statistical Analysis

Immunohistochemistry and immunofluorescence were scanned and imaged using PANNORAMIC (3DHISTECH Ltd., Budapest, Hungary) panoramic slice scanner. The cumulative optical density (IOD) values of six positive fields in each slice were measured by Image-Pro 6.0 software (Media Cybernetics Inc., Rockville, MD, USA). The corresponding positive pixel Area (Area), and AOD = IOD/Area was calculated. Positive scoring was performed on five selected sites within three fields of view per section (Note: +, Weak expression; ++, Medium expression; +++, Strong expression; ++++, High expression). For fluorescence quantification, the raw data were first processed using the Excel 19.0 software package and then calculated after the commonly used −2ΔΔCT method [43]. The genotype frequencies, allele frequencies, homozygosity (Ho), heterozygosity (He), effective allele numbers (Ne), and polymorphism information content (PIC) of Hoxc13 gene SNPs were counted, and the X2 test for Hardy–Weinberg equilibrium detection. Correlation of Hoxc13 SNPs genotypes with wool traits was analyzed using t-tests. All results of this study were analyzed using the SPSS 22.0 (SPSS Inc., Chicago, IL, USA) statistical software package, and the results are expressed as mean ± standard error (S.E.), and different letters are indicated as significant (p < 0.05). SPSS 22.0 Kolmogorov–Smirnova (K-S test) was used to test the assumption of normal distribution of wool trait data.

5. Conclusions

In conclusion, this study showed that (1) the Hoxc13 gene was mainly expressed in the outer root sheath, inner root sheath, and dermal papillae of Gansu alpine fine-wool sheep to achieve the regulation of hair follicle cycle; and (2) it was found that two SNPs in exon 1 of the Hoxc13 gene were significantly associated with wool length, and the mutations led to changes in mRNA expression, and there was a positive correlation between the Hoxc13 expression and wool fiber growth. It can be used as a candidate gene or molecular genetic marker to improve Gansu alpine fine-wool sheep and increase economic benefits.

Author Contributions

H.S. performed the data analysis and wrote the manuscript. S.L. and F.Z. performed investigation and collected the samples. J.W., X.L., J.H., Z.Z., M.L. and Z.H. performed the procedures and formal analysis using software. Y.L. and S.L. carried out the project administration and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the National Natural Science Foundation of China (32060140), the Distinguished Young Scholars Fund of Gansu Province (21JR7RA857), Discipline Team Project of Gansu Agricultural University (GAU-XKTD-2022-21), Fuxi Young Talents Fund of Gansu Agricultural University (Gaufx-03Y04), and Gansu Provincial Key R&D Program Projects (22YF7WA115).

Institutional Review Board Statement

The animal study was reviewed and approved by the Faculty Animal Policy and Welfare Committee of Gansu Agricultural University (Ethic approval file No. GSAU-ETH-AST-2021-028).

Data Availability Statement

The authors affirm that all data necessary for confirming the conclusions of the article are present within the article, figures, and tables.

Acknowledgments

We thank Abmart Biomedical (Shanghai) Co. for providing us with the required Hoxc13 antibodies. The authors would like to thank all the reviewers who participated in the review.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Müller-Röver, S.; Handjiski, B.; van der Veen, C.; Eichmüller, S.; Foitzik, K.; McKay, I.A.; Stenn, K.S.; Paus, R. A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages. J. Investig. Dermatol. 2001, 117, 3–15. [Google Scholar] [CrossRef] [PubMed]
  2. Sennett, R.; Rendl, M.J.S.I.C.; Biology, D. Mesenchymal-epithelial interactions during hair follicle morphogenesis and cycling. Semin. Cell Dev. Biol. 2012, 23, 917–927. [Google Scholar] [CrossRef] [PubMed]
  3. Asakawa, K.; Toyoshima, K.E.; Tsuji, T. Functional hair follicle regeneration by the rearrangement of stem cells. Methods Mol. Biol. 2017, 1597, 117–134. [Google Scholar] [PubMed]
  4. Tsai, S.Y.; Sennett, R.; Rezza, A.; Clavel, C.; Grisanti, L.; Zemla, R.; Najam, S.; Rendl, M.J.D.B. Wnt/β-catenin signaling in dermal condensates is required for hair follicle formation. Dev. Biol. 2014, 385, 179–188. [Google Scholar] [CrossRef] [PubMed]
  5. Mukhopadhyay, A.; Krishnaswami, S.R.; Cowing-Zitron, C.; Hung, N.J.; Reilly-Rhoten, H.; Burns, J.; Yu, B.D. Negative regulation of shh levels by kras and fgfr2 during hair follicle development. Dev. Biol. 2013, 373, 373–382. [Google Scholar] [CrossRef]
  6. Mizutari, K.; Fujioka, M.; Hosoya, M.; Bramhall, N.; Okano, H.; Okano, H.; Edge, A.S. Notch inhibition induces cochlear hair cell regeneration and recovery of hearing after acoustic trauma. Neuron 2013, 77, 58–69. [Google Scholar] [CrossRef]
  7. Li, J.; Jiang, T.X.; Chuong, C.M. Many paths to alopecia via compromised regeneration of hair follicle stem cells. J. Investig. Dermatol. 2013, 133, 1450–1452. [Google Scholar] [CrossRef]
  8. Godwin, A.R.; Capecchi, M.R. Hoxc13 mutant mice lack external hair. Genes Dev. 1998, 12, 11–20. [Google Scholar] [CrossRef]
  9. Stelnicki, E.J.; Kömüves, L.G.; Kwong, A.O.; Holmes, D.; Klein, P.; Rozenfeld, S.; Lawrence, H.J.; Adzick, N.S.; Harrison, M.; Largman, C. Hox homeobox genes exhibit spatial and temporal changes in expression during human skin development. J. Investig. Dermatol. 1998, 110, 110–115. [Google Scholar] [CrossRef] [PubMed]
  10. Kasiri, S.; Ansari, K.I.; Hussain, I.; Bhan, A.; Mandal, S.S. Antisense oligonucleotide mediated knockdown of hoxc13 affects cell growth and induces apoptosis in tumor cells and over expression of hoxc13 induces 3d-colony formation. RSC Adv. 2013, 3, 3260–3269. [Google Scholar] [CrossRef] [PubMed]
  11. Thummel, R.; Li, L.; Tanase, C.; Sarras, M.P.; Godwin, A.R. Differences in expression pattern and function between zebrafish hoxc13 orthologs: Recruitment of hoxc13b into an early embryonic role. Dev. Biol. 2004, 274, 318–333. [Google Scholar] [CrossRef] [PubMed]
  12. Tkatchenko, A.V.; Visconti, R.P.; Shang, L.; Papenbrock, T.; Pruett, N.D.; Ito, T.; Ogawa, M.; Awgulewitsch, A. Overexpression of hoxc13 in differentiating keratinocytes results in downregulation of a novel hair keratin gene cluster and alopecia. Development 2001, 128, 1547–1558. [Google Scholar] [CrossRef] [PubMed]
  13. Lin, Z.; Chen, Q.; Shi, L.; Lee, M.; Giehl, K.A.; Tang, Z.; Wang, H.; Jie, Z.; Yin, J.; Wu, L.; et al. Loss-of-function mutations in hoxc13 cause pure hair and nail ectodermal dysplasia. Am. J. Hum. Genet. 2012, 91, 906–911. [Google Scholar] [CrossRef]
  14. Han, K.; Liang, L.; Li, L.; Ouyang, Z.; Zhao, B.; Wang, Q.; Liu, Z.; Zhao, Y.; Ren, X.; Jiang, F.; et al. Generation of hoxc13 knockout pigs recapitulates human ectodermal dysplasia-9. Hum. Mol. Genet. 2017, 26, 184–191. [Google Scholar] [CrossRef] [PubMed]
  15. Humbatova, A.; Maroofian, R.; Romano, M.T.; Tafazzoli, A.; Behnam, M.; Dilaver, N.; Nouri, N.; Salehi, M.; Wolf, S.; Frank, J.; et al. An insertion mutation in hoxc13 underlies pure hair and nail ectodermal dysplasia with lacrimal duct obstruction. Br. J. Dermatol. 2018, 178, e265–e267. [Google Scholar] [CrossRef]
  16. Sulayman, A.; Tian, K.; Huang, X.; Tian, Y.; Xu, X.; Fu, X.; Zhao, B.; Wu, W.; Wang, D.; Yasin, A.; et al. Genome-wide identification and characterization of long non-coding rnas expressed during sheep fetal and postnatal hair follicle development. Sci. Rep. 2019, 9, 8501. [Google Scholar] [CrossRef]
  17. Zhang, R.; Wu, H.; Lian, Z.J.G. Bioinformatics analysis of evolutionary characteristics and biochemical structure of fgf5 gene in sheep. Gene 2019, 702, 123–132. [Google Scholar] [CrossRef]
  18. Wang, J.; Yu, P.; Wang, H.; He, Y. Hoxc13 and hsp27 expression in skin and the periodic growth of secondary fiber follicles from longdong cashmere goats raised in different production systems. Anat. Rec. 2018, 301, 742–752. [Google Scholar] [CrossRef]
  19. He, Y.; Luo, Y.; Cheng, L.; Wang, J.; Liu, X.; Shao, B.; Cui, Y. Determination of secondary follicle characteristics, density, activity, and hoxc13 expression pattern of hexi cashmere goats breed. Anat. Rec. 2015, 298, 1796–1803. [Google Scholar] [CrossRef]
  20. He, Y.; Liu, X.; De, J.; Kang, S.; Munday, J.S. Altered hypoxia-induced and heat shock protein immunostaining in secondary hair follicles associated with changes in altitude and temperature in tibetan cashmere goats. Animals 2021, 11, 2798. [Google Scholar] [CrossRef]
  21. Jeong, K.H.; Joo, H.J.; Kim, J.E.; Park, Y.M.; Kang, H.J.C.; Dermatology, E. Effect of mycophenolic acid on proliferation of dermal papilla cells and induction of anagen hair follicles. Clin. Exp. Dermatol. 2015, 40, 894–902. [Google Scholar] [CrossRef]
  22. Morgan, B.A. The dermal papilla: An instructive niche for epithelial stem and progenitor cells in development and regeneration of the hair follicle. Cold Spring Harb. Perspect. Med. 2014, 4, a015180. [Google Scholar] [CrossRef]
  23. Farooq, M.; Kurban, M.; Fujimoto, A.; Fujikawa, H.; Abbas, O.; Nemer, G.; Saliba, J.; Sleiman, R.; Tofaili, M.; Kibbi, A.G.; et al. A homozygous frameshift mutation in the hoxc13 gene underlies pure hair and nail ectodermal dysplasia in a syrian family. Hum. Mutat. 2013, 34, 578–581. [Google Scholar]
  24. Lee, S.T.; Choi, K.W.; Yeo, H.T.; Kim, J.W.; Ki, C.S.; Cho, Y.D. Identification of an arg35x mutation in the pdcd10 gene in a patient with cerebral and multiple spinal cavernous malformations. J. Neurol. Sci. 2008, 267, 177–181. [Google Scholar] [CrossRef]
  25. Sharma, Y.; Miladi, M.; Dukare, S.; Boulay, K.; Caudron-Herger, M.; Groß, M.; Backofen, R.; Diederichs, S. A pan-cancer analysis of synonymous mutations. Nat. Commun. 2019, 10, 2569. [Google Scholar] [CrossRef]
  26. Sauna, Z.E.; Kimchi-Sarfaty, C. Understanding the contribution of synonymous mutations to human disease. Nat. Rev. Genet. 2011, 12, 683–691. [Google Scholar] [CrossRef]
  27. Shim, J.; Park, J.; Abudureyimu, G.; Kim, M.H.; Shim, J.S.; Jang, K.T.; Kwon, E.J.; Jang, H.S.; Yeo, E.; Lee, J.H.; et al. Comparative spatial transcriptomic and single-cell analyses of human nail units and hair follicles demonstrate transcriptional similarities between the onychodermis and follicular dermal papilla. J. Investig. Dermatol. 2022, 142, 3146–3157. [Google Scholar] [CrossRef]
  28. Qiu, W.; Lei, M.; Tang, H.; Yan, H.; Wen, X.; Zhang, W.; Tan, R.; Wang, D.; Wu, J. Hoxc13 is a crucial regulator of murine hair cycle. Cell Tissue Res. 2016, 364, 149–158. [Google Scholar] [CrossRef]
  29. Naeem, M.; John, P.; Ali, G.; Ahmad, W. Pure hair-nail ectodermal dysplasia maps to chromosome 12p11.1-q21.1 in a consanguineous pakistani family. Clin. Exp. Dermatol. 2007, 32, 502–505. [Google Scholar] [CrossRef]
  30. Perez, C.J.; Mecklenburg, L.; Fernandez, A.; Cantero, M.; de Souza, T.A.; Lin, K.; Dent, S.Y.R.; Montoliu, L.; Awgulewitsch, A.; Benavides, F. Naked (n) mutant mice carry a nonsense mutation in the homeobox of hoxc13. Exp. Dermatol. 2022, 31, 330–340. [Google Scholar] [CrossRef]
  31. Zhang, S.; Zhao, H.; Lei, C.; Pan, C.; Chen, H.; Lin, Q.; Lan, X. Effects of genetic variations within goat pitx2 gene on growth traits and mrna expression. Anim. Biotechnol. 2020, 31, 107–114. [Google Scholar] [CrossRef]
  32. Cai, H.; Lan, X.; Li, A.; Zhou, Y.; Sun, J.; Lei, C.; Zhang, C.; Chen, H. Snps of bovine hgf gene and their association with growth traits in nanyang cattle. Res. Vet. Sci. 2013, 95, 483–488. [Google Scholar] [CrossRef]
  33. Zhang, D.; Zhang, X.; Li, F.; La, Y.; Li, G.; Zhang, Y.; Li, X.; Zhao, Y.; Song, Q.; Wang, W. The association of polymorphisms in the ovine ppargc1b and zeb2 genes with body weight in hu sheep. Anim. Biotechnol. 2022, 33, 90–97. [Google Scholar] [CrossRef]
  34. Zhang, Z.; He, X.; Liu, Q.; Tang, J.; Di, R.; Chu, M. Tgif1 and sf1 polymorphisms are associated with litter size in small tail han sheep. Reprod. Domest. Anim. 2020, 55, 1145–1153. [Google Scholar] [CrossRef]
  35. Zhao, L.; Li, F.; Yuan, L.; Zhang, X.; Zhang, D.; Li, X.; Zhang, Y.; Zhao, Y.; Song, Q.; Wang, J.; et al. Expression of ovine ctnna3 and cap2 genes and their association with growth traits. Gene 2022, 807, 145949. [Google Scholar] [CrossRef]
  36. Wang, W.; La, Y.; Li, F.; Liu, S.; Pan, X.; Li, C.; Zhang, X. Molecular characterization and expression profiles of the ovine lhβ gene and its association with litter size in chinese indigenous small-tailed han sheep. Animals 2020, 10, 460. [Google Scholar] [CrossRef]
  37. Awgulewitsch, A.; Tkatchenko, A.V. Hoxc13 Transgenic Mice Exhibiting Hair Loss and Ichthyosis-Like Syndrome. AU20010022721, 25 June 2001. [Google Scholar]
  38. Khan, A.K.; Muhammad, N.; Aziz, A.; Genetics, S. A novel mutation in homeobox DNA binding domain of hoxc13 gene underlies pure hair and nail ectodermal dysplasia (ectd9) in a pakistani family. BMC Med. Genet. 2017, 18, 42. [Google Scholar] [CrossRef]
  39. Ali, R.H.; Habib, R.; Ud-Din, N.; Khan, M.N.; Ansar, M.; Ahmad, W. Novel mutations in the gene hoxc13 underlying pure hair and nail ectodermal dysplasia in consanguineous families. Br. J. Dermatol. 2013, 169, 478–480. [Google Scholar] [CrossRef]
  40. Li, X.; Orseth, M.L.; Smith, J.M.; Brehm, M.A.; Agim, N.G.; Glass, D.A., 2nd. A novel homozygous missense mutation in hoxc13 leads to autosomal recessive pure hair and nail ectodermal dysplasia. Pediatr. Dermatol. 2017, 34, 172–175. [Google Scholar] [CrossRef]
  41. Shanhe, W.; Zhixin, L.; Yuelang, Z.; Dan, Y.; Wei, G.; Xin, W. The inconsistent regulation of hoxc13 on different keratins and the regulation mechanism on hoxc13 in cashmere goat (Capra hircus). BMC Genom. 2018, 19, 630. [Google Scholar]
  42. Sun, H.; He, Z.; Xi, Q.; Zhao, F.; Hu, J.; Wang, J.; Liu, X.; Zhao, Z.; Li, M.; Luo, Y.; et al. Lef1 and dlx3 may facilitate the maturation of secondary hair follicles in the skin of gansu alpine merino. Genes 2022, 13, 1326. [Google Scholar] [CrossRef] [PubMed]
  43. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Ijms 25 01594 g001
Figure 1. Immunohistochemical staining of Hoxc13 at different stages of skin hair follicle cycle development (40×). A(A′)–F(F′): six groups of immunohistochemical staining at day 1, 30, 60, 90, 180, and 270, in that order. (A,A′) are the same sample from the same period, (A) is the upper part of the hair follicle, (A′) is the lower part of the hair follicle. All similarly numbered samples that follow are the same sample. ORS: outer root sheath; IRS: inner root sheath; DP: dermal papilla; HM: hair matrix; HS: hair shaft; e: epidermis; SG: sebaceous glands.
Figure 1. Immunohistochemical staining of Hoxc13 at different stages of skin hair follicle cycle development (40×). A(A′)–F(F′): six groups of immunohistochemical staining at day 1, 30, 60, 90, 180, and 270, in that order. (A,A′) are the same sample from the same period, (A) is the upper part of the hair follicle, (A′) is the lower part of the hair follicle. All similarly numbered samples that follow are the same sample. ORS: outer root sheath; IRS: inner root sheath; DP: dermal papilla; HM: hair matrix; HS: hair shaft; e: epidermis; SG: sebaceous glands.
Ijms 25 01594 g001
Ijms 25 01594 g002
Figure 2. AOD values of Hoxc13 at different stages of hair follicle cycle development in the skin. The data are presented as mean ± standard error (S.E.). Different letters indicate significant differences between ages (p < 0.05).
Figure 2. AOD values of Hoxc13 at different stages of hair follicle cycle development in the skin. The data are presented as mean ± standard error (S.E.). Different letters indicate significant differences between ages (p < 0.05).
Ijms 25 01594 g002
Ijms 25 01594 g003
Figure 3. Immunofluorescence staining of Hoxc13 at different stages of skin follicle cycle development (10×). (A–C): 1 day; (D–F): 30 days; (G–I): 60 days; (J–L): 90 days: (M–O): 180 days; (P–R): 270 days. The blue tissue in the figure shows DAPI-labeled nuclear fluorescence staining and the red tissue shows fluorescence staining of Hoxc13. ORS: outer root sheath; IRS: inner root sheath; DP: dermal papilla; HM: hair matrix; e: epidermis; SG: sebaceous gland.
Figure 3. Immunofluorescence staining of Hoxc13 at different stages of skin follicle cycle development (10×). (A–C): 1 day; (D–F): 30 days; (G–I): 60 days; (J–L): 90 days: (M–O): 180 days; (P–R): 270 days. The blue tissue in the figure shows DAPI-labeled nuclear fluorescence staining and the red tissue shows fluorescence staining of Hoxc13. ORS: outer root sheath; IRS: inner root sheath; DP: dermal papilla; HM: hair matrix; e: epidermis; SG: sebaceous gland.
Ijms 25 01594 g003
Ijms 25 01594 g004
Figure 4. PCR amplification and sequencing results of Hoxc13-E1 in Gansu alpine fine-wool sheep. (A) is the PCR band plot of Hoxc13-E1 amplification product. (B,C) are Hoxc13 sequencing results. The overlapping peaks indicated by arrows are SNPs mutation sites.
Figure 4. PCR amplification and sequencing results of Hoxc13-E1 in Gansu alpine fine-wool sheep. (A) is the PCR band plot of Hoxc13-E1 amplification product. (B,C) are Hoxc13 sequencing results. The overlapping peaks indicated by arrows are SNPs mutation sites.
Ijms 25 01594 g004
Ijms 25 01594 g005
Figure 5. Results of KASP genotyping analysis of two positions of Hoxc13 gene in Gansu alpine fine-wool sheep. Horizontal and vertical coordinates for the two joints recognized by mutant base signaling, respectively. FAM is blue, HEX is green, and FAMHEX is red. Red and blue dots in (A) indicate TG and TT genotypes, respectively, and red and blue dots in (B) indicate AG and AA genotypes, respectively. Gray dots in plots (A,B) represent unrecognized signals.
Figure 5. Results of KASP genotyping analysis of two positions of Hoxc13 gene in Gansu alpine fine-wool sheep. Horizontal and vertical coordinates for the two joints recognized by mutant base signaling, respectively. FAM is blue, HEX is green, and FAMHEX is red. Red and blue dots in (A) indicate TG and TT genotypes, respectively, and red and blue dots in (B) indicate AG and AA genotypes, respectively. Gray dots in plots (A,B) represent unrecognized signals.
Ijms 25 01594 g005
Ijms 25 01594 g006
Figure 6. Results of RT-qPCR for different genotypes of two SNPs in the Hoxc13 of Gansu alpine fine-wool sheep. The results are expressed as mean ± standard error (S.E.), and different letters are indicated as significant (p < 0.05). (A) is the result of mRNA expression for both genotypes of mutation c.405 and (B) is the result of mRNA expression for both genotypes of mutation c.673.
Figure 6. Results of RT-qPCR for different genotypes of two SNPs in the Hoxc13 of Gansu alpine fine-wool sheep. The results are expressed as mean ± standard error (S.E.), and different letters are indicated as significant (p < 0.05). (A) is the result of mRNA expression for both genotypes of mutation c.405 and (B) is the result of mRNA expression for both genotypes of mutation c.673.
Ijms 25 01594 g006
Table 1. Positive intensity of Hoxc13 in various parts of skin tissue at different ages.
Table 1. Positive intensity of Hoxc13 in various parts of skin tissue at different ages.
DaysCorneumInner Root SheathOuter Root SheathHair MedullaDermal Papillae
1++++++++++++++++
30+++++++++++++++
60+++++++++++++++
90+++++++++++++++
180+++++++++++++++
270+++++++++++++++
Note: +, Weak expression; ++, Medium expression; +++, Strong expression; ++++, High expression.
Table 2. Genotype frequency and gene frequency of 2 SNPs of Hoxc13 gene.
Table 2. Genotype frequency and gene frequency of 2 SNPs of Hoxc13 gene.
GeneSNP SiteNumberGenotype Frequency (Number)Allele Frequency
Hoxc13c.405 T > G310TTTGTG
0.8613 (267)0.1387 (43)0.93060.0694
c.673 A > G310AAAGA G
0.8613 (267)0.1387 (43)0.93060.0694
Table 3. The population genetic diversity of 2 SNPs of Hoxc13 gene.
Table 3. The population genetic diversity of 2 SNPs of Hoxc13 gene.
GeneSNP SiteHoHeNePICHardy–Weinberg
p-Value
Hoxc13c.405 T > G0.87080.12921.14840.1209p > 0.05
c.673 A > G0.87080.12921.14840.1209p > 0.05
Table 4. Effect of different genotypes of Hoxc13 gene SNPs on wool traits.
Table 4. Effect of different genotypes of Hoxc13 gene SNPs on wool traits.
GeneSNP SiteTraitGenotype (Number)
Hoxc13c.405 T > G TT (267)TG (43)
Mean Fiber Diameter (μm)22.182 ± 0.17222.384 ± 0.408
Mean Staple Length (mm)80.019 ± 1.297 b94.114 ± 3.606 a
Mean Fiber Curve (n/mm)105.359 ± 0.802105.514 ± 2.490
Comfort Factor (%)88.241 ± 0.78085.890 ± 3.120
Fiber Shift12.245 ± 0.25713.533 ± 0.881
Strength (cN/dT)14.332 ± 0.41614.847 ± 1.329
c.673 A > G AA (267)AG (43)
Mean Fiber Diameter (μm)22.274 ± 0.17421.887 ± 0.372
Mean Staple Length (mm)79.717 ± 1.256 b95.941 ± 3.986 a
Mean Fiber Curve (n/mm)105.359 ± 0.791109.169 ± 3.478
Comfort Factor (%)87.793 ± 0.79090.375 ± 3.163
Fiber Shift12.433 ± 0.25211.518 ± 1.156
Strength (cN/dT)14.353 ± 0.41014.381 ± 1.610
Note: Different letters indicate significant differences.
Table 5. Frequency of haplotype and haplotype combination of SNPs locus reconfiguration in Hoxc13 gene.
Table 5. Frequency of haplotype and haplotype combination of SNPs locus reconfiguration in Hoxc13 gene.
HaplotypeSNP1SNP2FrequencyHaplotype CombinationFrequency
H1 (TA)TA0.913H1H10.836
H2 (GG)GG0.051H1H20.047
H3 (GA)GA0.018
H4 (TG)TG0.018
Table 6. Effect of Hoxc13 gene reconfiguration haplotype on wool traits.
Table 6. Effect of Hoxc13 gene reconfiguration haplotype on wool traits.
Haplotype CombinationMean Fiber
Diameter (μm)		Mean Staple Length (mm)Mean Fiber Curve (n/mm)Comfort Factor (%)Fiber ShiftStrength (cN/dT)
H1H122.161 ± 0.16879.970 ± 1.272 b105.143 ± 0.79988.403 ± 0.76712.296 ± 0.26314.293 ± 0.427
H1H222.332 ± 0.617100.794 ± 4.062 a112.740 ± 4.61185.600 ± 4.61112.808 ± 1.37616.551 ± 2.157
Note: Different letters indicate significant differences.
Table 7. Primer sequences and annealing temperatures used for PCR and RT-qPCR.
Table 7. Primer sequences and annealing temperatures used for PCR and RT-qPCR.
GeneGenBank
Accession No.		Primer Sequence (5′–3′)Product Length (bp)Annealing
Temperature
(°C)		Application
Hoxc13ENSOARG00020018195F: GGCGGTGGAAACACCAGGAG100760PCR
R: TCCATCTGCAGCCCAGCAAAG
Hoxc13AY_266017.1F: GATAGTCAGGTGTACTGCTC13260RT-qPCR
R: CTGCGTACTCCTTCTCTAGC
β–actinNM_001009784F: AGCCTTCCTTCCTGGGCATGGA11360
R: GGACAGCACCGTGTTGGCGTAGA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sun, H.; He, Z.; Zhao, F.; Hu, J.; Wang, J.; Liu, X.; Zhao, Z.; Li, M.; Luo, Y.; Li, S. Molecular Genetic Characteristics of the Hoxc13 Gene and Association Analysis of Wool Traits. Int. J. Mol. Sci. 2024, 25, 1594. https://doi.org/10.3390/ijms25031594

AMA Style

Sun H, He Z, Zhao F, Hu J, Wang J, Liu X, Zhao Z, Li M, Luo Y, Li S. Molecular Genetic Characteristics of the Hoxc13 Gene and Association Analysis of Wool Traits. International Journal of Molecular Sciences. 2024; 25(3):1594. https://doi.org/10.3390/ijms25031594

Chicago/Turabian Style

Sun, Hongxian, Zhaohua He, Fangfang Zhao, Jiang Hu, Jiqing Wang, Xiu Liu, Zhidong Zhao, Mingna Li, Yuzhu Luo, and Shaobin Li. 2024. "Molecular Genetic Characteristics of the Hoxc13 Gene and Association Analysis of Wool Traits" International Journal of Molecular Sciences 25, no. 3: 1594. https://doi.org/10.3390/ijms25031594

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop