Next Article in Journal
Genome-Wide Identification of the CBF Gene Family and ICE Transcription Factors in Walnuts and Expression Profiles under Cold Conditions
Previous Article in Journal
Pushing the Resolution Limit of Stimulated Emission Depletion Optical Nanoscopy
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 1
10.3390/ijms25010023
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Role of Thyroid Hormone in Dynamic Variation of gdf6a Gene during Metamorphosis of Paralichthys olivaceus

by
Yaxin Shi
1,2,†,
Junqiang Qiu
1,2,†,
Xike Li
1,2,
Yue Lin
1,2,
Wenjuan Li
1,2,
Jilun Hou
3,* and
Yuanshuai Fu
1,2,*
1
Key Laboratory of Freshwater Aquatic Genetic Resources, Ministry of Agriculture and Rural Affairs, Shanghai Ocean University, Shanghai 201306, China
2
Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, Shanghai 201306, China
3
Hebei Key Laboratory of the Bohai Sea Fish Germplasm Resources Conservation and Utilization, Beidaihe Central Experiment Station, Chinese Academy of Fishery Sciences, Qinhuangdao 066100, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2024, 25(1), 23; https://doi.org/10.3390/ijms25010023
Submission received: 12 November 2023 / Revised: 3 December 2023 / Accepted: 7 December 2023 / Published: 19 December 2023
(This article belongs to the Special Issue Metabolism and Diseases Related to Thyroid Function)
Browse Figures
Versions Notes

Abstract

:
The Japanese flounder (Paralichthys olivaceus) is a marine fish that undergoes a dramatic postembryonic metamorphosis, with the right eye shifting to the left and its lifestyle transitioning from planktonic to benthic. As the light environment of the habitat changes from bright to dim, its photoreceptor system also undergoes adaptive change. Growth differentiation factor 6a (Gdf6a) is a member of the BMP family, which plays a key role in regulating the dorsal–ventral pattern of the retina and photoreceptor fate, and the differentiation of different photoreceptors is also modulated by a thyroid hormone (TH) binding its receptor (TR). However, the relationship between gdf6a and TH and its role in the regulation of photoreceptors during flounder metamorphosis is still poorly understood. In this study, bioinformatics analysis showed that Gdf6a had a conserved TGFB structural domain and clusters with fishes. The expression analysis showed that the expression of gdf6a was highest in the eye tissue of adult flounder and tended to increase and then decrease during metamorphosis, reaching its highest levels at the peak of metamorphosis. Moreover, the expression of gdf6a increased in the early stages of metamorphosis after exogenous TH treatment, while it was inhibited after exogenous thiourea (a TH inhibitor, TU) treatment. To further investigate the targeting role of TH and gdf6a in the metamorphosis of flounder, the results of the Dual-Luciferase revealed that triiodothyronine (T3) may regulate the expression of gdf6a through TRβ. In conclusion, we speculate that TH influences the development of cone photoreceptors during the metamorphosis of the flounder by regulating the expression of gdf6a.

1. Introduction

Japanese flounder (Paralichthys olivaceus) is an economic marine fish, mainly distributed along the coasts of China, the Korean Peninsula, and Japan, which undergoes a drastic metamorphosis during postembryonic development. After metamorphosis, the right eye moves to the left side of the body, and the lifestyle changes from planktonic to benthic, so the light environment changes from bright to dim [1]. With the change in the light environment, the visual system also undergoes adaptive changes. A previous study showed that opsin genes (Rh1, M/Lws, Rh2, Sws1, Sws2) of the flounder varied with the metamorphosis process, and rh1, sws2aβ, and lws were positively regulated by exogenous thyroid hormone (TH) binding to thyroid hormone receptors (TRs) [2]. Opsin is mainly synthesized by photoreceptor cells, which include the cone cells and rod cells. The rod cells perceive weak light and are responsible for acquiring light information in dim light conditions, while the cone cells are responsible for distinguishing between structural and color information in images [3,4]. It has been shown that both rod and cone cells are differentiated from retinal photoreceptor precursor cells (PPC) and regulated by multiple transcription factors during differentiation in higher animals [5]. However, the molecular mechanisms underlying visual adaptation to the altered light environment during flounder metamorphosis are so far poorly understood.
Growth differentiation factor 6a (Gdf6a) is a member of the BMP family and belongs to the transforming growth factor beta (TGF-β) super-family [6]. It is a key factor in regulating dorsal–ventral retinal patterns and photoreceptor fate [7,8]. Abnormal photoreceptor morphology occurs in zebrafish gdf6a mutants, and their functional defects lead to photoreceptor degeneration [9]. Gdf6a plays different roles in different subtypes of cone photoreceptors. For instance, the number of UV cones in gdf6a−/− zebrafish was normal, while the number of blue cones was reduced [10]. T-box transcription factor 2b (Tbx2b) is a regulator of photoreceptor fate, specifically a key factor specifying the fate of UV cone photoreceptors [11]. The deletion of gdf6a in tbx2b heterozygous mutant zebrafish resulted in a further reduction in the number of UV cones [12,13].
TH is present in almost all tissues and plays a key regulatory role in growth, metabolism, and cell differentiation [14]. TH has two forms, triiodothyronine (T3) and thyroxine (T4), in which T3 plays a major role and produces the thyroid hormone’s effects through the thyroid hormone receptor (TR) [15]. TR is a member of the nuclear receptor superfamily, which binds to the thyroid hormone response element (TRE) in the promoter region of target genes, thereby regulating gene transcription [16]. TH is associated with photoreceptor development, directing the expression of the correct genes in differentiated photoreceptors. Under the influence of TH, PPC produces cone cells at the expense of reducing another cell type. Thus, PPC may use thyroid hormones to direct the fate of photoreceptor cells [17]. Related experiments have shown that TH promotes the differentiation of PPC to cone photoreceptors in rats, chickens, and humans [18,19]. A study found that TR may affect the number of blue cones in zebrafish by influencing the expression of the gdf6a gene [12,20].
In this study, we constructed the spatiotemporal expression patterns of the gdf6a gene in flounder and analyzed the effect of exogenous TH on the expression level of gdf6a during metamorphosis to elucidate the important role of TH in regulating photoreceptor differentiation. By verifying the regulatory relationship between TH, TRs, and the gdf6a gene, the molecular mechanism of thyroid hormone regulation of retinal photoreceptor differentiation was initially revealed.

2. Results

2.1. Bioinformatics Analysis of gdf6a Gene

The CDS region of the Paralichthys olivaceus gdf6a gene is 1353 bp, with ATG as the start codon and TAG as the stop codon, encoding 450 amino acids. As shown in Figure 1A, the amino acid sequence analysis showed that the N-terminal positions 1–28 of the flounder Gdf6 protein contained a signal peptide structure, positions 28–29 were cleavage sites, positions 7–29 had a transmembrane region, and positions 349–450 contained a TGFB structural domain. In Figure 1B, a comparison of the homology of the flounder Gdf6 amino acid sequence with other species shows that Gdf6 has a conserved TGFB structural domain and the highest homology between the flounder Gdf6 and Hippoglossus hippoglossus (97.56%), and the lowest homology with Xenopus laevis (53.88%). The phylogenetic tree of different species of Gdf6 was constructed using MEGA 5.0 software, and the results showed that flounder and Hippoglossus hippoglossus were most closely related and clustered together in the Osteichthyes, which follows the results of the amino acid homology analysis and is in line with the species evolutionary pattern (Figure 1C).

2.2. Expression of gdf6a in Adult Fish Tissues and Larval Eyes during Flounder Metamorphosis

The results of fluorescence quantitative PCR showed that the gdf6a gene was expressed in all tissues of the adult flounder, and the expression of gdf6a was highest in the eyes, followed by the brain, using the intestine as a reference (Figure 2A). As shown in Figure 2B, the expression of gdf6a in the eyes of flounder during metamorphosis was referenced to 40 dph and gradually increased throughout the metamorphosis process, peaking at 28 dph and then gradually decreasing.

2.3. Effects of Exogenous TH and TU on gdf6a Expression in the Eyes during Flounder Metamorphosis

As shown in Figure 3A, the NC group data at 40 dph were used as a reference. After exogenous TH treatment, the expression levels of gdf6a in the eyes were significantly increased at 20 dph, 24 dph, and 40 dph (p < 0.05), while the expression levels of gdf6a were significantly decreased (p < 0.05) from 20 dph to 36 dph after exogenous TU treatment. In addition, in the rescue group experiment, the TU-treated flounders at 36 dph were transferred to normal seawater (TU + NC) and TH-added seawater (TU + TH) to continue rearing until 40 dph. As shown in Figure 3B, the expression levels of gdf6a in the eyes were significantly higher in the rescue group (p < 0.05), using the 36 dph-TU group data as a reference. The above results indicate that TH affects the expression level of gdf6a in the eyes of flounder during metamorphosis.

2.4. Subcellular Localization

Predicted flounder gdf6a results using the subcellular localization online prediction site showed that 69.6% of the gdf6a was expressed in the nucleus, 13.0% in the cytoplasm, 13.0% in the mitochondria, and 4.3% in the plasma membrane. At the same time, 293T cells were transfected with pEGFP-N1 empty plasmid and pEGFP-gdf6a recombinant plasmid, respectively. As shown in Figure 4, it is verified that gdf6a is expressed in both the nucleus and cytoplasm of 293T cells.

2.5. T3 Mediates Targeting Regulation of the gdf6a Gene in Flounder through TRs

The TRE sites in the gdf6a promoter region were analyzed using the Transcription Factor Online Prediction website and according to the principle of action of TH. As shown in Figure 5A, the gdf6a promoter region has one T3R transcription factor binding site, three T3R-alpha transcription factor binding sites, one T3R-beta1 transcription factor binding site, and two potential TRE binding sites in the promoter region of gdf6a. The above results indicate that gdf6a has a very close relationship with TH.
As shown in Figure 5B, 293T cells were co-transfected with gdf6apro (recombinant plasmid of gdf6a promoter region) and p3×Flag-TRs over-expressed plasmids, and exogenous T3 was added simultaneously. The Dual-Luciferase reporter gene validation showed that taking promoter activity of gdf6a as a reference, the luciferase activities were significantly elevated (p < 0.05) in both gdf6apro + TRαA/TRαB/TRβ + T3 groups (Figure 5C–E). The luciferase activities were also significantly elevated in the gdf6apro + TRαA/TRαB group (p < 0.05), while there was no significant difference in the gdf6apro + TRβ group. The above results suggest that T3 may regulate the expression of gdf6a through TRβ. In addition, we constructed the promoter region plasmid of tbx2b and co-transfected it with the pEGFP-Gdf6a recombinant plasmid. As shown in Figure 5F, the Dual-Luciferase results indicated that, using the promoter activity of tbx2b as a reference, Gdf6a could significantly upregulate the transcription initiation activity of tbx2b (p < 0.05).

3. Discussion

The retinal photoreceptor system of dental flounder may also undergo adaptive changes as the light environment changes markedly during metamorphosis. gdf6a is thought to be required to initiate dorsal–ventral retinal patterning and lens development [7,8]. In this paper, we analyzed the regulation of gdf6a gene expression by exogenous TH. The amino acid sequence analysis revealed that flounder Gdf6a has a conserved TGFB structural domain. The amino acid sequence of Gdf6 was compared with nine other species for homology and phylogenetic tree analysis, and it was found to have the highest homology with Hippoglossus hippoglossus and to be clustered with Osteichthyes, which follows the genetic law. Paralichthys olivaceus and Hippoglossus hippoglossus have similar appearance and habits, and both belong to the Pleuronectiformes, Osteichthyes. Similar studies have found that the amino acid sequence of GDF6 is highly conserved in vertebrates [21]. The subcellular localization results showed that Gdf6a of the flounder was expressed in both the nucleus and cytoplasm of 293T cells, which was the same as the online prediction. And we found that the dental flounder gdf6a gene was expressed in the eye, brain, liver, intestine, stomach, kidney, and gonad tissues, but the highest expression was in the eye, which is consistent with its key role in eye development [22,23]. Moreover, the expression level of gdf6a in the eye also changed during the metamorphosis of flounder, peaking at the peak of metamorphosis and then decreasing. Therefore, we believe that the differential expression of gdf6a in the eye is related to the metamorphosis process of flounder.
Previous studies found that TH was closely related to the metamorphosis process in flounder, with exogenous TH promoting metamorphosis and exogenous TU inhibiting the metamorphosis process [24]. In this study, exogenous TH promoted the expression of gdf6a in the eyes of flounder at the early stage of metamorphosis, whereas exogenous TU inhibited the expression of gdf6a in the eyes throughout the metamorphosis period. In the rescue group, both normal seawater and seawater supplemented with T3 increased the expression level of gdf6a in the eyes of the TU group. Therefore, we believe that TH affects the expression of gdf6a in the eye of flounder. We analyzed the promoter region sequence of gdf6a through prediction and found that there are multiple TRE sites and T3R transcription factor binding sites in the promoter region of gdf6a. Subsequently, we further verified the regulatory relationship between TH, TRs, and gdf6a using the Dual-Luciferase reporter gene results. gdf6apro showed significantly higher luciferase activity (p < 0.05) with the addition of T3 + TRαA/TRαB, indicating that exogenous T3 can exert a regulatory effect on gdf6a expression via TRαA and TRαB. The luciferase activity of gdf6apro was also significantly increased when only TRαA or TRαB was added (p < 0.05). For this result, we have two hypotheses: one is the existence of endogenous T3 regulating the expression of gdf6a through TRαA and TRαB; the other is that TRαA and TRαB, as transcription factors, regulate the expression of gdf6a by binding to its promoter region. In contrast, the difference in luciferase activity of gdf6apro was not significant when only TRβ was added, while the luciferase activity was significantly higher when T3 was added at the same time (p < 0.05). Combined with the above results, we speculate that T3 may directly regulate the expression of gdf6a through TRβ. Studies in mice have found that thyroid hormones regulate the expression of a large number of genes through TRs during retinal development [25]. A similar study found that the knockdown of trβ alone did not affect blue cone fate in zebrafish, while blue cones were almost absent in the retina after the knockdown of trβ in gdf6a mutant zebrafish, further confirming the regulatory role of trβ in gdf6a gene expression [12]. In addition, luciferase results showed that gdf6a promotes the expression of tbx2b. Similarly, it was found that over-expression of gdf6a in zebrafish similarly increased tbx2b expression in the retina [26,27,28]. The above results indicate that gdf6a has a regulatory effect on the transcription of tbx2b.
In summary, the study found that gdf6a of flounder is closely related to its metamorphosis process and eye development. Meanwhile, exogenous TH affects the expression of gdf6a in the eye of flounder, and we found that exogenous T3 may directly regulate the expression of gdf6a through TRβ. In addition, we found that Gdf6a positively regulates its downstream gene tbx2b. We further speculate that TH regulates the expression of gdf6a to regulate the photoreceptor system of dental flounder to adapt to environmental changes during metamorphosis.

4. Materials and Methods

4.1. Sample Collection

All animal experiments in this study were conducted in strict accordance with the Laboratory Animals—Guidelines for Ethical Review of Animal Welfare of China (GB/T 35892-2018, https://openstd.samr.gov.cn/bzgk/gb/std_list, accessed on 11 November 2023). All experiments have been approved by the Animal Ethics Committee of Shanghai Ocean University (SHOU-DW-2021-060).
Flounder samples were obtained from the Beidaihe Central Experimental Station of the Chinese Academy of Fisheries Sciences and were uniformly cultured in filtered recirculating seawater. The water temperature was maintained at 17 ± 2 °C, salinity at 30‰, and natural light during the culture process. Larvae were fed with nutrient-fortified rotifers (Brachionus plicatilis) paired with Artemia salina larvae. Sample sex was not a consideration. All flounders were anesthetized with ms-222 (Sangon, Shanghai, China), euthanized by severing their heads, and rinsed with DEPC (Thermo, Waltham, MA, USA) water before sample collection. Three adult flounders of the same age (weighing 1.25 ± 0.10) were randomly selected from the culture water, and seven tissues were taken from each fish: eye, brain, liver, intestine, stomach, kidney, and gonad. Eye samples were collected from flounder larvae at 17 dph (days post-hatching), 24 dph, 28 dph, 32 dph, 36 dph, and 40 dph after emergence from the membrane at each metamorphic stage. Based on the results of the pre-test, the larvae at 15 dph were randomly divided into three groups with three replicates each. NC group: cultured in normal seawater (normal metamorphosis samples); TH group: cultured seawater supplemented with 0.1 mg/L of exogenous thyroid hormone (T3; Sangon, Shanghai, China); TU group: cultured seawater supplemented with 30 mg/L of exogenous thiourea (TU; Sangon, Shanghai, China). Sampling was then performed within 17–40 dph of metamorphosis, and three samples were taken from each tank for each group as biological replicates.
Rescue group: based on the results of the pre-test, flounders in the TU group at 36 dph were randomly divided into three groups with three replicates in each group and continued to be reared until 40 dph. TU group: the larvae continued to be cultured in seawater supplemented with 30 mg/L of exogenous TU; TU + NC group: the larvae were transferred to normal seawater and continued to be cultured; TU + TH group: the pups were transferred to seawater supplemented with 0.1 mg/L of exogenous T3 and continued to culture. The eye samples collected above were placed in 1.5 mL enzyme removal centrifuge tubes and immediately put into liquid nitrogen and then stored at −80 °C.

4.2. Bioinformatics Analysis of gdf6a

The amino acid sequence of the flounder Gdf6 (XP_019946621.1) protein was obtained from the NCBI database. The signal peptide and protein structure of Gdf6 protein were analyzed using SignalP-5.0 and SMART protein structural domain database. Multiple comparisons and homology analyses of the amino acid sequences of the Gdf6 protein were performed using DNAMAN 8.0 software, and the phylogenetic tree was constructed using the neighbor-joining method of MEGA 5.0 software.

4.3. Quantitative Real-Time PCR

Total RNA was extracted from pre-collected samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The integrity of RNA was assessed via agarose gel electrophoresis and RNA concentration was checked with a spectrophotometer NANODROP 2000C (Thermo, Waltham, MA, USA), 2.0 > A260/280 > 1.8. Total RNA (1 μg) from adult tissues was reverse transcribed using an RT-PCR kit (Vazyme, Nanjing, Jiangsu, China) according to the manufacturer’s instructions.
We obtained the sequence of the CDS region of gdf6a (gene ID: 109631977) from the NCBI website and designed primers (Table 1) using Primer Premier 5.0 software. Real-time fluorescence quantification was performed using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, California, USA) and according to the instructions of ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, Jiangsu, China). Three biological replicates were available for each group, and 18S was selected as the internal reference gene to determine the relative expression of gdf6a mRNA using the 2−ΔΔCT method.

4.4. Subcellular Localization

Prediction of Gdf6a subcellular localization was performed using two online sites (PSORT II Prediction; Uniprot). Based on the sequence of the CDS region of gdf6a obtained from NCBI and the sequence of the pEGFP-N1 vector, the primers (Table 1) of the vector homology arm with EcoRI enzyme cut site were designed to construct eukaryotic expression recombinant plasmids according to the principle of seamless cloning. First, 293T cells were cultured in a medium (Invitrogen, Carlsbad, CA, USA) containing 10% FBS and 1% triple antibody at 37 °C and 5% CO2. Cells were inoculated in six-well plates one day before transfection, and the constructed recombinant plasmids were transfected into 293T cells with Lipofectamine™ 3000 transfection reagent (Invitrogen, Carlsbad, CA, USA) when the cell density reached about 70%, while a control group was set up. After transfection for 24–36 h, the cells were fixed with 4% paraformaldehyde for 15 min, nuclei were stained with DAPI for 10 min, and washed three times with phosphate-buffered saline (PBS). The samples were observed and photographed under an inverted fluorescence microscope Axio Observer (ZEISS, Oberkochen, Germany).

4.5. Promoter Region Prediction

Based on the genome sequence of flounder gdf6a in the NCBI database, a sequence of about 2000 bp upstream of ATG was selected for promoter prediction analysis. Potential transcription factor binding sites were analyzed using the AliBaba2.1 online website, and TRE sites in the gdf6a promoter region were screened according to the mechanism of action of the thyroid hormone receptor site.

4.6. Double Luciferase Reporting Assay

The primer premier 5.0 software was used to design amplification primers based on the gdf6a and tbx2b promoter sequences of flounder (Table 1). The promoter region was amplified by PrimeSTAR® Max DNA polymerase (TAKARA, Beijing, China) and constructed into the pGL3-basic vector to obtain the recombinant plasmid gdf6apro/tbx2bpro. The plasmids p3×Flag-TRαA, p3×Flag-TRαB, and p3×Flag-TRβ were previously constructed and preserved in the laboratory. The 293T cells were seeded into 48-well plates and transfected when the cell density reached about 70%. The recombinant plasmid gdf6apro was co-transfected with p3×Flag-TRαA, p3×Flag-TRαB, and p3×Flag-TRβ, respectively. The pRL-TK was used as the internal reference plasmid, and a control group with a final concentration of 75 nM T3 was set up, with 3 replicates in each group. The culture was continued for 24–36 h, and the luciferase activity was detected according to the instructions of the Dual-Luciferase Reporter Gene Assay Kit (Yeasen, Shanghai, China) (n = 3). The pEGFP-Gdf6a plasmid and tbx2bpro plasmid were co-transfected with the same method to detect the double luciferase activity.

4.7. Statistical Analysis

All data in this paper were expressed as mean ± standard deviation and analyzed using IBM SPSS Statistics 25.0 software. One-way ANOVA analysis was used, and Duncan was selected to compare the statistical differences of the test data after the event. p < 0.05 was considered statistically significant. The images in this article were plotted using SigmaPlot 12.5 software.

Author Contributions

Methodology, Y.S. and X.L.; software, Y.S. and J.Q.; validation, Y.S. and Y.L.; investigation, X.L.; resources, Y.S. and J.Q.; data curation, Y.S. and J.Q.; writing—original draft preparation, Y.S.; writing—review and editing, W.L. and J.Q.; supervision, Y.F. and J.H.; funding acquisition, and J.Q. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science and Technology of China (Grant number: 2023ZD04065) and the National Natural Science Foundation of China (No. 41506159 and No. 41676138).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Animal Ethics Committee of Shanghai Ocean University (No.: SHOU-DW-2021-060), and strictly followed the “Guidelines for the Care and Use of Experimental Animals”.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets generated and/or analyzed during the current study are not publicly available owing to security protocols and privacy regulations, but they may be made available on reasonable request to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Okada, N.; Takagi, Y.; Seikai, T.; Tanaka, M.; Tagawa, M. Asymmetrical development of bones and soft tissues during eye migration of metamorphosing Japanese flounder, Paralichthys olivaceus. Cell Tissue Res. 2001, 304, 59–66. [Google Scholar] [CrossRef] [PubMed]
  2. Shi, Y.X.; Shi, Y.; Ji, W.Y.; Li, X.K.; Shi, Z.Y.; Hou, J.L.; Li, W.; Fu, Y. Thyroid hormone signaling is required for dynamic variation in opsins in the retina during metamorphosis of the Japanese Flounder (Paralichthys olivaceus). Biology 2023, 12, 397. [Google Scholar] [CrossRef] [PubMed]
  3. Hagen, J.F.; Roberts, N.S.; Johnston, R.J., Jr. The evolutionary history and spectral tuning of vertebrate visual opsins. Dev. Biol. 2022, 493, 40–66. [Google Scholar] [CrossRef]
  4. Zhang, R.; Zhao, J.; Hao, Y.; Cao, X.; Zhao, Y.; Tang, S. Retinal development in mandarinfish Siniperca chuatsi and morphological analysis of the photoreceptor layer. J. Fish Biol. 2019, 95, 903–917. [Google Scholar] [CrossRef] [PubMed]
  5. Zhang, Y.; Yao, X.; Song, Y.; Ying, H. Thyroid hormones and metabolic regulation. Chin. Bull. Life Sci. 2013, 25, 176–183. [Google Scholar] [CrossRef]
  6. French, C.R.; Stach, T.R.; March, L.D.; Lehmann, O.J.; Waskiewicz, A.J. Apoptotic and proliferative defects characterize ocular development in a microphthalmic BMP model. Investig. Ophthalmol. Vis. Sci. 2013, 54, 4636–4647. [Google Scholar] [CrossRef] [PubMed]
  7. French, C.R.; Erickson, T.; French, D.V.; Pilgrim, D.B.; Waskiewicz, A.J. Gdf6a is required for the initiation of dorsal–ventral retinal patterning and lens development. Dev. Biol. 2009, 333, 37–47. [Google Scholar] [CrossRef] [PubMed]
  8. Valdivia, L.E.; Lamb, D.B.; Horner, W.; Wierzbicki, C.; Tafessu, A.; Williams, A.M.; Gestri, G.; Krasnow, A.M.; Vleeshouwer-Neumann, T.S.; Givens, M.; et al. Antagonism between Gdf6a and retinoic acid pathways controls timing of retinal neurogenesis and growth of the eye in zebrafish. Development 2016, 143, 1087–1098. [Google Scholar] [CrossRef]
  9. Nadolski, N.J.; Balay, S.D.; Wong, C.X.; Waskiewicz, A.J.; Hocking, J.C. Abnormal cone and rod photoreceptor morphogenesis in gdf6a mutant zebrafish. Investig. Ophthalmol. Vis. Sci. 2020, 61, 9. [Google Scholar] [CrossRef]
  10. Duval, M.G.; Oel, A.P.; Allison, W.T. gdf6a is required for cone photoreceptor subtype differentiation and for the actions of tbx2b in determining rod versus cone photoreceptor fate. PLoS ONE 2017, 9, e92991. [Google Scholar] [CrossRef]
  11. Alvarez-Delfin, K.; Morris, A.C.; Snelson, C.D.; Gamse, J.T.; Gupta, T.; Marlow, F.L.; Mullins, M.C.; Burgess, H.A.; Granato, M.; Fadool, J.M. Tbx2b is required for ultraviolet photoreceptor cell specification during zebrafish retinal development. Proc. Natl. Acad. Sci. USA 2009, 106, 2023–2028. [Google Scholar] [CrossRef]
  12. DuVal, M.G.; Allison, W.T. Photoreceptor progenitors depend upon coordination of gdf6a, thrβ, and tbx2b to generate precise populations of cone photoreceptor subtypes. Investig. Ophthalmol. Vis. Sci. 2018, 59, 6089–6101. [Google Scholar] [CrossRef]
  13. Viets, K.; Eldred, K.C.; Johnston, R.J. Mechanisms of Photoreceptor Patterning in Vertebrates and Invertebrates. Trends Genet. 2016, 32, 638–659. [Google Scholar] [CrossRef] [PubMed]
  14. De Vito, P.; Incerpi, S.; Pedersen, J.Z.; Luly, P.; Davis, F.B.; Davis, P.J. Thyroid hormones as modulators of immune activities at the cellular level. Thyroid Off. J. Am. Thyroid Assoc. 2011, 21, 879–890. [Google Scholar] [CrossRef]
  15. Buzzard, J.J.; Morrison, J.R.; O’Bryan, M.K.; Song, Q.; Wreford, N.G. Developmental expression of thyroid hormone receptors in the rat testis. Biol. Reprod. 2000, 62, 664–669. [Google Scholar] [CrossRef] [PubMed]
  16. Cheng, S.Y. Multiple mechanisms for regulation of the transcriptional activity of thyroid hormone receptors. Rev. Endocr. Metab. Disord. 2000, 1, 9–18. [Google Scholar] [CrossRef]
  17. Harpavat, S.; Cepko, C.L. Thyroid hormone and retinal development: An emerging field. Thyroid Off. J. Am. Thyroid Assoc. 2003, 13, 1013–1019. [Google Scholar] [CrossRef] [PubMed]
  18. Gan, K.J.; Novales Flamarique, I. Thyroid hormone accelerates opsin expression during early photoreceptor differentiation and induces opsin switching in differentiated TRα-expressing cones of the salmonid retina. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 2010, 239, 2700–2713. [Google Scholar] [CrossRef]
  19. Yanagi, Y.; Takezawa, S.-I.; Kato, S. Distinct functions of photoreceptor cell–specific nuclear receptor, thyroid hormone receptor β2 and crx in cone photoreceptor development. Investig. Ophthalmol. Vis. Sci. 2002, 43, 3489–3494. [Google Scholar]
  20. Deveau, C.; Jiao, X.; Suzuki, S.C.; Krishnakumar, A.; Yoshimatsu, T.; Hejtmancik, J.F.; Nelson, R.F. Thyroid hormone receptor beta mutations alter photoreceptor development and function in Danio rerio (zebrafish). PLoS Genet. 2020, 16, e1008869. [Google Scholar] [CrossRef]
  21. Krispin, S.; Stratman, A.N.; Melick, C.H.; Stan, R.V.; Malinverno, M.; Gleklen, J.; Castranova, D.; Dejana, E.; Weinstein, B.M. Growth differentiation factor 6 promotes vascular stability by restraining vascular endothelial growth factor signaling. Arterioscler. Thromb. Vasc. Biol. 2018, 38, 353–362. [Google Scholar] [CrossRef] [PubMed]
  22. Asai-Coakwell, M.; French, C.R.; Berry, K.M.; Ye, M.; Koss, R.; Somerville, M.; Mueller, R.; van Heyningen, V.; Waskiewicz, A.J.; Lehmann, O.J. GDF6, a novel locus for a spectrum of ocular developmental anomalies. Am. J. Hum. Genet. 2007, 80, 306–315. [Google Scholar] [CrossRef] [PubMed]
  23. Asai-Coakwell, M.; March, L.; Dai, X.H.; DuVal, M.; Lopez, I.; French, C.R.; Famulski, J.; De Baere, E.; Francis, P.J.; Sundaresan, P.; et al. Contribution of growth differentiation factor 6-dependent cell survival to early-onset retinal dystrophies. Hum. Mol. Genet. 2013, 22, 1432–1442. [Google Scholar] [CrossRef]
  24. Yasuo, I.; Satoshi, M. Thyroid hormone induces metamorphosis of flounder larvae. Gen. Comp. Endocrinol. 1985, 60, 450–454. [Google Scholar]
  25. Deeb, S.S.; Bisset, D.; Pavlova, M.N.; Chen, D.-G. Regulation of retinal gene expression by thyroid hormone and it receptors during mouse development. Investig. Ophthalmol. Vis. Sci. 2011, 52, 54. [Google Scholar]
  26. den Hollander, A.I.; Biyanwila, J.; Kovach, P.; Bardakjian, T.; Traboulsi, E.I.; Ragge, N.K.; Schneider, A.; Malicki, J. Genetic defects of GDF6 in the zebrafish out of sight mutant and in human eye developmental anomalies. BMC Genet. 2010, 11, 102. [Google Scholar] [CrossRef]
  27. Gosse, N.J.; Baier, H. An essential role for Radar (Gdf6a) in inducing dorsal fate in the zebrafish retina. Proc. Natl. Acad. Sci. USA 2009, 106, 2236–2241. [Google Scholar] [CrossRef]
  28. Hocking, J.C.; Famulski, J.K.; Yoon, K.H.; Widen, S.A.; Bernstein, C.S.; Koch, S.; Weiss, O.; FORGE Canada Consortium; Agarwala, S.; Inbal, A.; et al. Morphogenetic defects underlie Superior Coloboma, a newly identified closure disorder of the dorsal eye. PLoS Genet. 2018, 14, e1007246. [Google Scholar] [CrossRef]
Ijms 25 00023 g001
Figure 1. Amino acid sequence analysis and phylogenetic tree of the gdf6a in Paralichthys olivaceus. (A) Amino acid sequence analysis of gdf6a. The red horizontal line indicates the signal peptide region, the black box indicates the transmembrane region, and the dashed line indicates the TGFB structural domain. (B) Comparison of amino acid sequences of multi-species gdf6a, the red dots represent the flounder in this study. (C) The phylogenetic tree of gdf6a. The amino acid sequences of gdf6a used for multiple sequence comparison and construction of phylogenetic trees were extracted from the NCBI database with the following accession numbers: Paralichthys olivaceus (XP_019946621.1); Hippoglossus hippoglossus (XP_034467272.1); Toxotes jaculatrix (XP_040900667.1); Epinephelus fuscoguttatus (XP_049440314.1); Plectropomus leopardus (XP_042346426.1); Lates calcarifer (XP_018538633.1); Danio rerio (NP_571062.1); Homo sapiens (NP_001001557.1); Xenopus laevis (NP_001083833.1); Mus musculus (NP_038554.1).
Figure 1. Amino acid sequence analysis and phylogenetic tree of the gdf6a in Paralichthys olivaceus. (A) Amino acid sequence analysis of gdf6a. The red horizontal line indicates the signal peptide region, the black box indicates the transmembrane region, and the dashed line indicates the TGFB structural domain. (B) Comparison of amino acid sequences of multi-species gdf6a, the red dots represent the flounder in this study. (C) The phylogenetic tree of gdf6a. The amino acid sequences of gdf6a used for multiple sequence comparison and construction of phylogenetic trees were extracted from the NCBI database with the following accession numbers: Paralichthys olivaceus (XP_019946621.1); Hippoglossus hippoglossus (XP_034467272.1); Toxotes jaculatrix (XP_040900667.1); Epinephelus fuscoguttatus (XP_049440314.1); Plectropomus leopardus (XP_042346426.1); Lates calcarifer (XP_018538633.1); Danio rerio (NP_571062.1); Homo sapiens (NP_001001557.1); Xenopus laevis (NP_001083833.1); Mus musculus (NP_038554.1).
Ijms 25 00023 g001
Ijms 25 00023 g002
Figure 2. Tissue expression profile and temporal expression of gdf6a gene in flounder. (A) Expression levels of gdf6a in adult flounder tissues. (B) Expression levels of gdf6a in the eyes during flounder metamorphosis. All data are expressed using the mean ± standard deviation; different letters indicate significant differences between data (p < 0.05).
Figure 2. Tissue expression profile and temporal expression of gdf6a gene in flounder. (A) Expression levels of gdf6a in adult flounder tissues. (B) Expression levels of gdf6a in the eyes during flounder metamorphosis. All data are expressed using the mean ± standard deviation; different letters indicate significant differences between data (p < 0.05).
Ijms 25 00023 g002
Ijms 25 00023 g003
Figure 3. Expression levels of gdf6a in the eyes of TH and TU-treated and rescue groups of flounder. (A) Expression levels of gdf6a in the eyes of exogenous TH and TU-treated flounder during metamorphosis. (B) Expression levels of gdf6a in flounder eyes of the rescue group. NC group: cultured in normal seawater; TH group: cultured seawater supplemented with 0.1 mg/L of exogenous thyroid hormone (T3); TU group: cultured seawater supplemented with 30 mg/L of exogenous thiourea (TU). TU-treated flounders at 36 dph were transferred to normal seawater (TU + NC) and TH-added seawater (TU + TH) to continue rearing until 40 dph. All data are expressed using the mean ± standard deviation, where an asterisk indicates a significant difference from the contemporaneous NC group (A) or 36 dph-TU group (B) (p < 0.05).
Figure 3. Expression levels of gdf6a in the eyes of TH and TU-treated and rescue groups of flounder. (A) Expression levels of gdf6a in the eyes of exogenous TH and TU-treated flounder during metamorphosis. (B) Expression levels of gdf6a in flounder eyes of the rescue group. NC group: cultured in normal seawater; TH group: cultured seawater supplemented with 0.1 mg/L of exogenous thyroid hormone (T3); TU group: cultured seawater supplemented with 30 mg/L of exogenous thiourea (TU). TU-treated flounders at 36 dph were transferred to normal seawater (TU + NC) and TH-added seawater (TU + TH) to continue rearing until 40 dph. All data are expressed using the mean ± standard deviation, where an asterisk indicates a significant difference from the contemporaneous NC group (A) or 36 dph-TU group (B) (p < 0.05).
Ijms 25 00023 g003
Ijms 25 00023 g004
Figure 4. Localization of the gdf6a of flounder in 293T cells (20×). The pEGFP-N1 and pEGFP-gdf6a indicated that 293T cells were transfected with pEGFP-N1 and pEGFP-gdf6a, respectively. EGFP: enhanced green fluorescent protein; DAPI: nuclear stain.
Figure 4. Localization of the gdf6a of flounder in 293T cells (20×). The pEGFP-N1 and pEGFP-gdf6a indicated that 293T cells were transfected with pEGFP-N1 and pEGFP-gdf6a, respectively. EGFP: enhanced green fluorescent protein; DAPI: nuclear stain.
Ijms 25 00023 g004
Ijms 25 00023 g005
Figure 5. Analysis of the Dual-Luciferase results of gdf6a in flounder. (A) Analysis of TRs binding sites in the promoter region of gdf6a. (B) Experimental component of the Dual-Luciferase reporter gene. (C–E) T3 regulates the Dual-Luciferase activity of gdf6a via TRs. (F) Regulation of tbx2b of the Dual-Luciferase activity by gdf6a. Note: gdf6apro and tbx2bpro represented the recombinant plasmid of gdf6a and tbx2b promoter region; N1 represented pEGFP-N1 empty plasmids; TRαA, TRαB, TRβ, and Gdf6a represented over-expressed plasmids of corresponding genes, respectively. All data are expressed using the mean ± standard deviation, and significant differences from the promoter activity group are indicated by asterisks: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Figure 5. Analysis of the Dual-Luciferase results of gdf6a in flounder. (A) Analysis of TRs binding sites in the promoter region of gdf6a. (B) Experimental component of the Dual-Luciferase reporter gene. (C–E) T3 regulates the Dual-Luciferase activity of gdf6a via TRs. (F) Regulation of tbx2b of the Dual-Luciferase activity by gdf6a. Note: gdf6apro and tbx2bpro represented the recombinant plasmid of gdf6a and tbx2b promoter region; N1 represented pEGFP-N1 empty plasmids; TRαA, TRαB, TRβ, and Gdf6a represented over-expressed plasmids of corresponding genes, respectively. All data are expressed using the mean ± standard deviation, and significant differences from the promoter activity group are indicated by asterisks: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Ijms 25 00023 g005
Table 1. Designed primers used in the experiment.
Table 1. Designed primers used in the experiment.
Primer Name 1Primer Sequence (5′–3′) 2Application
RT-gdf6a-FCTGCGAGGGGGTGTGCGAqRT-PCR
RT-gdf6a-RGCGGGGTGCTGTTGGGGTqRT-PCR
18S-FGGTCTGTGATGCCCTTAGATGTCqRT-PCR
18S-RAGTGGGGTTCAGCGGGTTACqRT-PCR
pEGFP-Gdf6a-FTCGAGCTCAAGCTTCGAATTCATGGACGCATCTCGAGTGGTASubcellular localization
pEGFP-Gdf6a-RGTACCGTCGACTGCAGAATTCCTACCTGCACCCGCACTSubcellular localization
gdf6apro-FGCGTGCTAGCCCGGGCTCGAGTGCAGTGATGGCTCTCCATGGPromoter amplification
gdf6apro-RACTTAGATCGCAGATCTCGAGCGGAGAGCTGCTACTTTTGCGPromoter amplification
tbx2bpro-FATCTGCGATCTAAGTAAGCTTTTCCCCGACACAAAGCATAGGPromoter amplification
tbx2bpro-RCAGTACCGGAATGCCAAGCTTAGCCGCTCTCTCTCCCTCTGPromoter amplification
1 F: forward primers. R: reverse primers. 2 Primers were designed with Primer Premier 5.0.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shi, Y.; Qiu, J.; Li, X.; Lin, Y.; Li, W.; Hou, J.; Fu, Y. Role of Thyroid Hormone in Dynamic Variation of gdf6a Gene during Metamorphosis of Paralichthys olivaceus. Int. J. Mol. Sci. 2024, 25, 23. https://doi.org/10.3390/ijms25010023

AMA Style

Shi Y, Qiu J, Li X, Lin Y, Li W, Hou J, Fu Y. Role of Thyroid Hormone in Dynamic Variation of gdf6a Gene during Metamorphosis of Paralichthys olivaceus. International Journal of Molecular Sciences. 2024; 25(1):23. https://doi.org/10.3390/ijms25010023

Chicago/Turabian Style

Shi, Yaxin, Junqiang Qiu, Xike Li, Yue Lin, Wenjuan Li, Jilun Hou, and Yuanshuai Fu. 2024. "Role of Thyroid Hormone in Dynamic Variation of gdf6a Gene during Metamorphosis of Paralichthys olivaceus" International Journal of Molecular Sciences 25, no. 1: 23. https://doi.org/10.3390/ijms25010023

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop