Hepatoprotective Effect of Oyster Peptide on Alcohol-Induced Liver Disease in Mice
Abstract
:1. Introduction
2. Results and Discussion
2.1. Characterization of the Structure of Oyster Peptide (OP)
2.1.1. Particle Size Distribution and Zeta Potential Measurement
2.1.2. Fourier Transform Infrared (FTIR) Analysis
2.1.3. Circular Dichroism
2.1.4. SEM Analysis
2.2. OP Groups Attenuated the Alcohol-Induced Liver Injury
2.3. Effects of OP on Serum Aminotransferase Activities in Mice
2.4. Effects of OP on TG
2.5. Effects of OP on Alcohol-Induced Oxidative Stress in Mice
2.6. Effects of OP on Alcohol-Induced Inflammatory Response in Mice
3. Material and Methods
3.1. Materials for Animal Experiment
3.2. Chemicals and Reagents
3.3. Determination of Particle Size, Polydispersity Index and Zeta Potential
3.4. FTIR Analysis
3.5. Circular Dichroism
3.6. Scanning Electron Microscope (SEM) Analysis
3.7. Animal and Treatment
3.8. Serum Analysis
3.9. Liver Tissue Analysis
3.10. Liver Histological Analysis
3.11. RNA Extraction and Real-Time PCR (RT-PCR)
3.12. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yu, Y.; Wang, L.; Wang, Y.; Lin, D.; Liu, J. Hepatoprotective Effect of Albumin Peptides from Corn Germ Meal on Chronic Alcohol-Induced Liver Injury in Mice. J. Food Sci. 2017, 82, 2997–3004. [Google Scholar] [CrossRef]
- Kong, L.-Z.; Chandimali, N.; Han, Y.-H.; Lee, D.-H.; Kim, J.-S.; Kim, S.-U.; Kim, T.-D.; Jeong, D.K.; Sun, H.-N.; Lee, D.S.; et al. Pathogenesis, Early Diagnosis, and Therapeutic Management of Alcoholic Liver Disease. Int. J. Mol. Sci. 2019, 20, 2712. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, H.; Xiao, P.; Zhang, F.; Liu, T.; Gao, Y. Epidemic characteristics of alcohol-related liver disease in Asia from 2000 to 2020: A systematic review and meta-analysis. Liver Int. 2022, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Jepsen, P.; Younossi, Z.M. The global burden of cirrhosis: A review of disability-adjusted life-years lost and unmet needs. J. Hepatol. 2021, 75, S3–S13. [Google Scholar] [CrossRef] [PubMed]
- Dang, K.; Hirode, G.; Singal, A.K.; Sundaram, V.; Wong, R.J. Alcoholic Liver Disease Epidemiology in the United States: A Retrospective Analysis of 3 US Databases. Am. J. Gastroenterol. 2020, 115, 96–104. [Google Scholar] [CrossRef]
- Osaki, K.; Shimizu, Y.; Yamamoto, T.; Miyake, F.; Kondo, S.; Yamaguchi, H. Improvement of liver function by the administration of oyster extract as a dietary supplement to habitual alcohol drinkers: A pilot study. Exp. Ther. Med. 2015, 10, 705–710. [Google Scholar] [CrossRef] [Green Version]
- Ge, X.; Antoine, D.J.; Lu, Y.; Arriazu, E.; Leung, T.-M.; Klepper, A.L.; Branch, A.D.; Fiel, M.I.; Nieto, N. High Mobility Group Box-1 (HMGB1) Participates in the Pathogenesis of Alcoholic Liver Disease (ALD). J. Biol. Chem. 2014, 289, 22672–22691. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.-S.; Jung, K.-H.; Hong, S.-W.; Park, I.-S.; Lee, C.; Han, H.-K.; Lee, D.-H.; Hong, S.-S. Morin protects acute liver damage by carbon tetrachloride (CCl(4)) in rat. Arch. Pharmacal Res. 2008, 31, 1160–1165. [Google Scholar] [CrossRef]
- Bansal, S.; Srinivasan, S.; Anandasadagopan, S.; Chowdhury, A.R.; Selvaraj, V.; Kalyanaraman, B.; Joseph, J.; Avadhani, N.G. Additive Effects of Mitochondrion-targeted Cytochrome CYP2E1 and Alcohol Toxicity on Cytochrome c Oxidase Function and Stability of Respirosome Complexes. J. Biol. Chem. 2012, 287, 15284–15297. [Google Scholar] [CrossRef] [Green Version]
- Song, X.; Shen, Q.; Liu, M.; Zhang, C.; Zhang, L.; Ren, Z.; Wang, W.; Dong, Y.; Wang, X.; Zhang, J.; et al. Antioxidant and hepatoprotective effects of intracellular mycelium polysaccharides from Pleurotus geesteranus against alcoholic liver diseases. Int. J. Biol. Macromol. 2018, 114, 979–988. [Google Scholar] [CrossRef]
- Rosato, V.; Abenavoli, L.; Federico, A.; Masarone, M.; Persico, M. Pharmacotherapy of alcoholic liver disease in clinical practice. Int. J. Clin. Pract. 2016, 70, 119–131. [Google Scholar] [CrossRef]
- Pessione, F.; Ramond, M.J.; Peters, L.; Pham, B.N.; Batel, P.; Rueff, B.; Valla, D.C. Five-year survival predictive factors in patients with excessive alcohol intake and cirrhosis. Effect of alcoholic hepatitis, smoking and abstinence. Liver Int. 2003, 23, 45–53. [Google Scholar] [CrossRef]
- Addolorato, G.; Leggio, L. Safety and Efficacy of Baclofen in the Treatment of Alcohol-Dependent Patients. Curr. Pharm. Des. 2010, 16, 2113–2117. [Google Scholar] [CrossRef]
- Xie, Y.; Hao, H.P.; Wang, H.; Guo, C.; Kang, A.; Wang, G.J. Reversing effects of lignans on CCl4-induced hepatic CYP450 down regulation by attenuating oxidative stress. J. Ethnopharmacol. 2014, 155, 213–221. [Google Scholar] [CrossRef]
- Onishi, Y.; Kimura, H.; Hori, T.; Kishi, S.; Kamei, H.; Kurata, N.; Tsuboi, C.; Yamaguchi, N.; Takahashi, M.; Sunada, S.; et al. Risk of alcohol use relapse after liver transplantation for alcoholic liver disease. World J. Gastroenterol. 2017, 23, 869–875. [Google Scholar] [CrossRef]
- McClain, C.J.; Rios, C.D.; Condon, S.; Marsano, L.S. Malnutrition and Alcohol-Associated Hepatitis. Clin. Liver Dis. 2021, 25, 557–570. [Google Scholar] [CrossRef]
- Mo, Q.; Zhou, G.; Xie, B.; Ma, B.; Zang, X.; Chen, Y.; Cheng, L.; Zhou, J.H.; Wang, Y. Evaluation of the hepatoprotective effect of Yigan mingmu oral liquid against acute alcohol-induced liver injury in rats. BMC Complement. Med. Ther. 2020, 20, 32. [Google Scholar] [CrossRef]
- Stickel, F.; Hoehn, B.; Schuppan, D.; Seitz, H.K. Review article: Nutritional therapy in alcoholic liver disease. Aliment. Pharm. Ther. 2003, 18, 357–373. [Google Scholar] [CrossRef]
- Muto, Y.; Sato, S.; Watanabe, A.; Moriwaki, H.; Suzuki, K.; Kato, A.; Kato, M.; Nakamura, T.; Higuchi, K.; Nishiguchi, S.; et al. Effects of oral branched-chain amino acid granules on event-free survival in patients with liver cirrhosis. Clin. Gastroenterol. Hepatol. 2005, 3, 705–713. [Google Scholar] [CrossRef]
- Moriwaki, H.; Miwa, Y.; Tajika, M.; Kato, M.; Fukushima, H.; Shiraki, M. Branched-chain amino acids as a protein-and energy-source in liver cirrhosis. Biochem. Biophys. Res. Commun. 2004, 313, 405–409. [Google Scholar] [CrossRef]
- Wang, Q.; Li, W.; He, Y.; Ren, D.; Kow, F.; Song, L.; Yu, X. Novel antioxidative peptides from the protein hydrolysate of oysters (Crassostrea talienwhanensis). Food Chem. 2014, 145, 991–996. [Google Scholar] [CrossRef]
- Wang, X.; Yu, H.; Xing, R.; Liu, S.; Chen, X.; Li, P. Optimization of Oyster (Crassostrea talienwhanensis) Protein Hydrolysates Using Response Surface Methodology. Molecules 2020, 25, 2844. [Google Scholar] [CrossRef]
- Xu, T.; Xie, J.; Zhu, B.; Liu, X.; Wu, X. Allograft Inflammatory Factor 1 Functions as a Pro-Inflammatory Cytokine in the Oyster, Crassostrea ariakensis. PLoS ONE 2014, 9, e95859. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Hu, J.; Cui, J.; Bai, X.; Du, Y.; Miyaguchi, Y.; Lin, B. Purification and identification of a ACE inhibitory peptide from oyster proteins hydrolysate and the antihypertensive effect of hydrolysate in spontaneously hypertensive rats. Food Chem. 2008, 111, 302–308. [Google Scholar] [CrossRef]
- Wang, X.; Yu, H.; Xing, R.; Liu, S.; Chen, X.; Li, P. Effect and mechanism of oyster hydrolytic peptides on spatial learning and memory in mice. RSC Adv. 2018, 8, 6125–6135. [Google Scholar] [CrossRef] [Green Version]
- Shu, Y.; Liang, S.; Qi, W.; Rong, P.; Han, Q.; Zhang, Z. Protection of zinc-rich oyster powder against alcohol-induced liver injury in mice. Sci. Technol. Food Ind. 2016, 37, 339–343. [Google Scholar]
- Song, T.; Xiong, Z.; Shi, T.; Yuan, L.; Gao, R. Effect of glutamic acid on the preparation and characterization of Pickering emulsions stabilized by zein. Food Chem. 2022, 366, 130598. [Google Scholar] [CrossRef]
- Muley, A.B.; Pandit, A.B.; Singhal, R.S.; Dalvi, S.G. Production of biologically active peptides by hydrolysis of whey protein isolates using hydrodynamic cavitation. Ultrason. Sonochem. 2021, 71, 105385. [Google Scholar] [CrossRef] [PubMed]
- Fang, J.; Lu, J.; Zhang, Y.; Wang, J.; Wang, S.; Fan, H.; Zhang, J.; Dai, W.; Gao, J.; Yu, H. Structural properties, antioxidant and immune activities of low molecular weight peptides from soybean dregs (Okara). Food Chem. 2021, 12, 100175. [Google Scholar] [CrossRef] [PubMed]
- Arteel, G.E. New role of plasminogen activator inhibitor-1 in alcohol-induced liver injury. J. Gastroenterol. Hepatol. 2008, 23, S54–S59. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, F.; Liu, Y.; Bi, C.; Zhang, B. Nostoc sphaeroids Kutz powder ameliorates diet-induced hyperlipidemia in C57BL/6j mice. Food Nutr. Res. 2019, 63, 1–10. [Google Scholar] [CrossRef]
- Sagaram, M.; Parthasarathy, R.; Condon, S.L.; Closson, C.F.; Kong, M.; Schwandt, M.L.; Jophlin, L.L.; Feng, W.; Barve, A.J.; Vatsalya, V. Theragnostic Efficacy of K18 Response in Alcohol Use Disorder with Clinically Significant Fibrosis Using Gut-Liver Axis. Int. J. Mol. Sci. 2022, 23, 5852. [Google Scholar] [CrossRef]
- Kumar Rajagopal, S.K.; Manickam, P.; Periyasamy, V.; Namasivayam, N. Activity of Cassia auriculata leaf extract in rats with alcoholic liver injury. J. Nutr. Biochem. 2003, 14, 452–458. [Google Scholar] [CrossRef]
- Hou, Z.; Qin, P.; Ren, G. Effect of Anthocyanin-Rich Extract from Black Rice (Oryza sativa L. Japonica) on Chronically Alcohol-Induced Liver Damage in Rats. J. Agric. Food Chem. 2010, 58, 3191–3196. [Google Scholar] [CrossRef]
- Kim, E.; Yang, J.; Lee, H.; Park, J.-R.; Hong, S.-H.; Woo, H.-M.; Lee, S.; Seo, I.B.; Ryu, S.-M.; Cho, S.-J.; et al. γ-Glutamyl Transferase as an Early and Sensitive Marker in Ethanol-Induced Liver Injury of Rats. Transpl. Proc. 2014, 46, 1180–1185. [Google Scholar] [CrossRef]
- Paunovic, M.G.; Matic, M.M.; Stankovic, V.D.; Milosevic, M.D.; Jevtic, V.V.; Trifunovic, S.R.; Ognjanovic, B.I. Evaluation of Toxic Effects of Novel Platinum (IV) Complexes in Female Rat Liver: Potential Protective Role of Resveratrol. Cell Biochem. Biophys. 2021, 79, 141–152. [Google Scholar] [CrossRef]
- Arteel, G.E. Oxidants and antioxidants in alcohol-induced liver disease. Gastroenterology 2003, 124, 778–790. [Google Scholar] [CrossRef]
- Dey, A.; Cederbaum, A.I. Alcohol and oxidative liver injury. Hepatology 2006, 43, S63–S74. [Google Scholar] [CrossRef]
- Liu, S.-Y.; Tsai, I.T.; Hsu, Y.-C. Alcohol-Related Liver Disease: Basic Mechanisms and Clinical Perspectives. Int. J. Mol. Sci. 2021, 22, 5170. [Google Scholar] [CrossRef]
- Zhang, X.; Wang, L.; Wang, R.; Luo, X.; Li, Y.; Chen, Z. Protective effects of rice dreg protein hydrolysates against hydrogen peroxide-induced oxidative stress in HepG-2 cells. Food Funct. 2016, 7, 1429–1437. [Google Scholar] [CrossRef]
- Zhang, Z.; Su, G.; Zhou, F.; Lin, L.; Liu, X.; Zhao, M. Alcalase-hydrolyzed oyster (Crassostrea rivularis) meat enhances antioxidant and aphrodisiac activities in normal male mice. Food Res. Int. 2019, 120, 178–187. [Google Scholar] [CrossRef]
- Wu, K.C.; Liu, J.; Klaassen, C.D. Role of Nrf2 in preventing ethanol-induced oxidative stress and lipid accumulation. Toxicol. Appl. Pharm. 2012, 262, 321–329. [Google Scholar] [CrossRef]
- Klaassen, C.D.; Reisman, S.A. Nrf2 the rescue: Effects of the antioxidative/electrophilic response on the liver. Toxicol. Appl. Pharm. 2010, 244, 57–65. [Google Scholar] [CrossRef] [Green Version]
- Yang, H.; Xiang, S.; Kazi, A.; Sebti, S.M. The GTPase KRAS suppresses the p53 tumor suppressor by activating the NRF2-regulated antioxidant defense system in cancer cells. J. Biol. Chem. 2020, 295, 3055–3063. [Google Scholar] [CrossRef]
- Farombi, E.O.; Shrotriya, S.; Na, H.-K.; Kim, S.-H.; Surh, Y.-J. Curcumin attenuates dimethylnitrosamine-induced liver injury in rats through Nrf2-mediated induction of heme oxygenase-1. Food Chem. Toxicol. 2008, 46, 1279–1287. [Google Scholar] [CrossRef]
- Guo, X.; Shin, V.Y.; Cho, C.H. Modulation of heme oxygenase in tissue injury and its implication in protection against gastrointestinal diseases. Life Sci. 2001, 69, 3113–3119. [Google Scholar] [CrossRef]
- Kim, S.; Sohn, I.; Ahn, J.I.; Lee, K.H.; Lee, Y.S.; Lee, Y.S. Hepatic gene expression profiles in a long-term high-fat diet-induced obesity mouse model. Gene 2004, 340, 99–109. [Google Scholar] [CrossRef]
- Yang, Y.M.; Cho, Y.E.; Hwang, S. Crosstalk between Oxidative Stress and Inflammatory Liver Injury in the Pathogenesis of Alcoholic Liver Disease. Int. J. Mol. Sci. 2022, 23, 774. [Google Scholar] [CrossRef]
- Park, H.-Y.; Choi, H.-D.; Eom, H.; Choi, I. Enzymatic modification enhances the protective activity of citrus flavonoids against alcohol-induced liver disease. Food Chem. 2013, 139, 231–240. [Google Scholar] [CrossRef]
- Nowak, A.J.; Relja, B. The Impact of Acute or Chronic Alcohol Intake on the NF-kappa B Signaling Pathway in Alcohol-Related Liver Disease. Int. J. Mol. Sci. 2020, 21, 9407. [Google Scholar] [CrossRef]
- Ribeiro, P.S.; Cortez-Pinto, H.; Sola, S.; Castro, R.E.; Ramalho, R.M.; Baptista, A.; Moura, M.C.; Camilo, M.E.; Rodrigues, C.M.P. Hepatocyte apoptosis, expression of death receptors, and activation of NF-kappa B in the liver of nonalcoholic and alcoholic steatohepatitis patients. Am. J. Gastroenterol. 2004, 99, 1708–1717. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Groups | ROS (U/mL) | SOD (U/mgprot) | GSH (nmol/g prot) | MDA (nmol/mg) |
---|---|---|---|---|
Control | 49.96 ± 3.04 c | 136.16 ± 11.75 a | 550.75 ± 39.00 a | 0.631 ± 0.148 b |
Model | 82.10 ± 4.18 a | 77.43 ± 7.93 c | 344.32 ± 21.61 b | 1.117 ± 0.250 a |
Positive | 63.48 ± 6.97 b | 98.69 ± 11.62 bc | 416.48 ± 39.34 ab | 0.749 ± 0.166 b |
OP-L | 55.88 ± 6.81 bc | 84.73 ± 10.95 bc | 498.84 ± 47.62 a | 0.759 ± 0.271 b |
OP-M | 57.63 ± 8.74 bc | 93.41 ± 12.47 bc | 463.19 ± 16.37 ab | 0.684 ± 0.072 b |
OP-H | 52.24 ± 3.20 c | 108.50 ± 11.17 ab | 416.84 ± 31.93 ab | 0.520 ± 0.098 b |
Groups | IL-1β (ng/L) | IL-6 (ng/L) | TNF-α (ng/L) |
---|---|---|---|
Control | 22.50 ± 3.79 b | 7.56 ± 1.40 ab | 194.40 ± 25.27 ab |
Model | 37.19 ± 4.00 a | 9.62 ± 1.14 a | 243.72 ± 13.66 a |
Positive | 31.80 ± 3.07 ab | 6.79 ± 1.23 b | 160.93 ± 17.57 b |
OP-L | 20.58 ± 1.94 b | 8.13 ± 1.29 ab | 129.45 ± 11.60 b |
OP-M | 19.57 ± 3.11 b | 8.52 ± 1.34 ab | 136.86 ± 11.31 b |
OP-H | 18.49 ± 1.79 b | 6.76 ± 1.92 b | 141.00 ± 13.08 b |
No. | Sequence | Mass (Da) | Length | Parental Protein | Position |
---|---|---|---|---|---|
1 | LAGELHQEQENYK | 1557.74 | 13 | K1QTC1 | 745–757 |
2 | AIDTIINQK | 1014.57 | 9 | K1R6Z7 | 223–231 |
3 | DSYVGDEAQSK | 1197.52 | 11 | Q8TA69; C4NY62 | 52–62 |
4 | PGTTEDEPVK | 1071.51 | 10 | K1Q5P0 | 498–507 |
5 | ETVIDTIQK | 1045.57 | 9 | K1RHA0 | 148–156 |
6 | DLESQLK | 831.43 | 7 | K1QRU8 | 989–995 |
7 | NAETELGETSQR | 1333.61 | 12 | K1QTC1 | 681–692 |
8 | EYDESGPSIVHR | 1387.64 | 12 | Q8TA69; C4NY62 | 362–373 |
9 | DSDLEGHPTPR | 1222.56 | 11 | K1RBC9 | 173–183 |
10 | HDNPGDLGDLH | 1188.52 | 11 | K1PY89; K1QLW5 | 128–138 |
11 | AQCEMEPNH | 1114.42 | 9 | K1PY89; K1QLW5 | 47–55 |
12 | ESAGIHETT | 943.42 | 9 | Q8TA69 | 271–279 |
13 | NTVLSGGTT | 848.42 | 9 | Q8TA69 | 297–305 |
Primer | Sequence (5′–3′) | Lengths of Primers (bp) | Lengths of Products (bp) |
---|---|---|---|
Nrf2-F | CAGTGCTCCTATGCGTGAA | 19 | 109 |
Nrf2-R | GCGGCTTGAATGTTTGTC | 18 | |
HO-1-F | ACAGATGGCGTCACTTCG | 18 | 128 |
HO-1-R | TGAGGACCCACTGGAGGA | 18 | |
NQO1-F | CTTTAGGGTCGTCTTGGC | 18 | 102 |
NQO1-R | CAATCAGGGCTCTTCTCG | 18 | |
NF-kB1-F | AGCTTATGCCGAACTTCTCG | 20 | 176 |
NF-kB1-R | GACTCCGGGATGGAATGTAA | 20 | |
TNF-α-F | ACTGGCGTGTTCATCCGTTCT | 21 | 215 |
TNF-α-R | CGCAATCCAGGCCACTACTTC | 21 | |
IL-6-F | AGTTGTGCAATGGCAATTCTG | 21 | 223 |
IL-6-R | AGGACTCTGGCTTTGTCTTTC | 21 | |
β-Actin-F | CTGTCCCTGTATGCCTCTG | 19 | 218 |
β-Actin-R | ATGTCACGCACGATTTCC | 18 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Yu, H.; Xing, R.; Li, P. Hepatoprotective Effect of Oyster Peptide on Alcohol-Induced Liver Disease in Mice. Int. J. Mol. Sci. 2022, 23, 8081. https://doi.org/10.3390/ijms23158081
Wang X, Yu H, Xing R, Li P. Hepatoprotective Effect of Oyster Peptide on Alcohol-Induced Liver Disease in Mice. International Journal of Molecular Sciences. 2022; 23(15):8081. https://doi.org/10.3390/ijms23158081
Chicago/Turabian StyleWang, Xueqin, Huahua Yu, Ronge Xing, and Pengcheng Li. 2022. "Hepatoprotective Effect of Oyster Peptide on Alcohol-Induced Liver Disease in Mice" International Journal of Molecular Sciences 23, no. 15: 8081. https://doi.org/10.3390/ijms23158081