Metformin Inhibits Lipid Droplets Fusion and Growth via Reduction in Cidec and Its Regulatory Factors in Rat Adipose-Derived Stem Cells
Abstract
:1. Introduction
2. Results
2.1. Metformin Decreases Lipid Accumulation in Both Ing-ADSCs and Epi-ADSCs Cultures
2.2. Metformin Decreases Adipogenic Genes and Lipogenic Enzymes Expression in ADSCs Differentiation
2.3. Metformin Inhibits Lipid Droplets Fusion and Growth in ADSCs Differentiation
2.4. Cidec, Perilipin1 and Rab8a Expression Are Decreased in ADSCs after Metformin Treatments
2.5. Metformin Inhibits Cidec, Perilipin1, and Rab8a Expression Partly via Activation of AMPK Signaling in ADSCs
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Materials
4.3. Isolation and Differentiation of Adipose-Derived Stem Cells
4.4. Cell Viability Assay
4.5. Oil Red O and Bodipy Staining
4.6. Triglyceride Measurement
4.7. Quantitative Real-Time PCR
4.8. Immunofluorescent Staining
4.9. Immunoblotting
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Chooi, Y.C.; Ding, C.; Magkos, F. The epidemiology of obesity. Metab. Clin. Exp. 2019, 92, 6–10. [Google Scholar] [CrossRef] [Green Version]
- Bluher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [CrossRef] [PubMed]
- Ng, A.C.T.; Delgado, V.; Borlaug, B.A.; Bax, J.J. Diabesity: The combined burden of obesity and diabetes on heart disease and the role of imaging. Nat. Rev. Cardiol 2021, 18, 291–304. [Google Scholar] [CrossRef] [PubMed]
- Czernichow, S.; Kengne, A.P.; Stamatakis, E.; Hamer, M.; Batty, G.D. Body mass index, waist circumference and waist-hip ratio: Which is the better discriminator of cardiovascular disease mortality risk?: Evidence from an individual-participant meta-analysis of 82 864 participants from nine cohort studies. Obes. Rev. 2011, 12, 680–687. [Google Scholar] [CrossRef] [PubMed]
- Anderson, A.S.; Martin, R.M.; Renehan, A.G.; Cade, J.; Copson, E.R.; Cross, A.J.; Grimmett, C.; Keaver, L.; King, A.; Riboli, E.; et al. Cancer survivorship, excess body fatness and weight-loss intervention-where are we in 2020? Br. J. Cancer 2021, 124, 1057–1065. [Google Scholar] [CrossRef] [PubMed]
- O’Connell, F.; O’Sullivan, J. Help or hindrance: The obesity paradox in cancer treatment response. Cancer Lett. 2021, 522, 269–280. [Google Scholar] [CrossRef] [PubMed]
- Tak, Y.J.; Lee, S.Y. Long-Term Efficacy and Safety of Anti-Obesity Treatment: Where Do We Stand? Curr. Obes. Rep. 2021, 10, 14–30. [Google Scholar] [CrossRef]
- Zeng, Q.; Li, N.; Pan, X.F.; Chen, L.; Pan, A. Clinical management and treatment of obesity in China. Lancet Diabetes Endocrinol. 2021, 9, 393–405. [Google Scholar] [CrossRef]
- Yumuk, V.; Tsigos, C.; Fried, M.; Schindler, K.; Busetto, L.; Micic, D.; Toplak, H.; Obesity Management Task Force of the European Association for the Study of, O. European Guidelines for Obesity Management in Adults. Obes. Facts 2015, 8, 402–424. [Google Scholar] [CrossRef]
- Jensen, M.D.; Ryan, D.H.; Apovian, C.M.; Ard, J.D.; Comuzzie, A.G.; Donato, K.A.; Hu, F.B.; Hubbard, V.S.; Jakicic, J.M.; Kushner, R.F.; et al. 2013 AHA/ACC/TOS guideline for the management of overweight and obesity in adults: A report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines and The Obesity Society. Circulation 2014, 129 (Suppl. S2), S102–S138. [Google Scholar] [CrossRef] [Green Version]
- Dragano, N.R.V.; Ferno, J.; Dieguez, C.; Lopez, M.; Milbank, E. Recent Updates on Obesity Treatments: Available Drugs and Future Directions. Neuroscience 2020, 437, 215–239. [Google Scholar] [CrossRef]
- Klonoff, D.C.; Bassock, S.; Engels, E.; Frederiksen, M.; Marber, M.; Qvist, M.; Sparre, T.; Snitker, S. Semaglutide single-dose pen-injector: Post hoc analysis of summative usability testing for weight management. Diabetes Obes. Metab. 2021, 23, 2590–2594. [Google Scholar] [CrossRef] [PubMed]
- American Diabetes, A. Standards of Medical Care in Diabetes-2019 Abridged for Primary Care Providers. Clin. Diabetes 2019, 37, 11–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yerevanian, A.; Soukas, A.A. Metformin: Mechanisms in Human Obesity and Weight Loss. Curr. Obes. Rep. 2019, 8, 156–164. [Google Scholar] [CrossRef]
- Desilets, A.R.; Dhakal-Karki, S.; Dunican, K.C. Role of metformin for weight management in patients without type 2 diabetes. Ann. Pharmacother. 2008, 42, 817–826. [Google Scholar] [CrossRef]
- Diabetes Prevention Program Research, G. Long-term safety, tolerability, and weight loss associated with metformin in the Diabetes Prevention Program Outcomes Study. Diabetes Care 2012, 35, 731–737. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaplanian, M.; Philippe, C.; Eid, S.A.; Hackl, M.T.; Metz, M.; Beghini, M.; Luca, A.C.; Kautzky-Willer, A.; Scherer, T.; Furnsinn, C. Deciphering metformin action in obese mice: A critical re-evaluation of established protocols. Metab. Clin. Exp. 2022, 128, 154956. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Aylor, K.W.; Chai, W.; Barrett, E.J.; Liu, Z. Metformin prevents endothelial oxidative stress and microvascular insulin resistance during obesity development in male rats. Am. J. Physiol. Endocrinol. Metab. 2022, 322, E293–E306. [Google Scholar] [CrossRef]
- Garvey, W.T.; Mechanick, J.I.; Brett, E.M.; Garber, A.J.; Hurley, D.L.; Jastreboff, A.M.; Nadolsky, K.; Pessah-Pollack, R.; Plodkowski, R.; Reviewers of the, A.A.C.E.O.C.P.G. American Association of Clinical Endocrinologists and American College of Endocrinology Comprehensive Clinical Practice Guidelines for Medical Care of Patients with Obesity. Endocr. Pract. 2016, 22 (Suppl. S3), 1–203. [Google Scholar] [CrossRef] [Green Version]
- Malin, S.K.; Kashyap, S.R. Effects of metformin on weight loss: Potential mechanisms. Curr. Opin. Endocrinol. Diabetes Obes. 2014, 21, 323–329. [Google Scholar] [CrossRef]
- Adeshirlarijaney, A.; Zou, J.; Tran, H.Q.; Chassaing, B.; Gewirtz, A.T. Amelioration of metabolic syndrome by metformin associates with reduced indices of low-grade inflammation independently of the gut microbiota. Am. J. Physiol. Endocrinol. Metab. 2019, 317, E1121–E1130. [Google Scholar] [CrossRef] [PubMed]
- Coll, A.P.; Chen, M.; Taskar, P.; Rimmington, D.; Patel, S.; Tadross, J.A.; Cimino, I.; Yang, M.; Welsh, P.; Virtue, S.; et al. GDF15 mediates the effects of metformin on body weight and energy balance. Nature 2020, 578, 444–448. [Google Scholar] [CrossRef]
- Kleinert, M.; Müller, T.D. Teaching an old dog new tricks: Metformin induces body-weight loss via GDF15. Nat. Metab. 2019, 1, 1171–1172. [Google Scholar] [CrossRef] [PubMed]
- Day, E.A.; Ford, R.J.; Smith, B.K.; Mohammadi-Shemirani, P.; Morrow, M.R.; Gutgesell, R.M.; Lu, R.; Raphenya, A.R.; Kabiri, M.; McArthur, A.G.; et al. Metformin-induced increases in GDF15 are important for suppressing appetite and promoting weight loss. Nat. Metab. 2019, 1, 1202–1208. [Google Scholar] [CrossRef] [Green Version]
- Tang, Q.Q.; Lane, M.D. Adipogenesis: From stem cell to adipocyte. Annu. Rev. Biochem. 2012, 81, 715–736. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lefterova, M.I.; Lazar, M.A. New developments in adipogenesis. Trends Endocrinol. Metab. 2009, 20, 107–114. [Google Scholar] [CrossRef]
- Rosen, E.D.; MacDougald, O.A. Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell Biol. 2006, 7, 885–896. [Google Scholar] [CrossRef]
- Jakab, J.; Miskic, B.; Miksic, S.; Juranic, B.; Cosic, V.; Schwarz, D.; Vcev, A. Adipogenesis as a Potential Anti-Obesity Target: A Review of Pharmacological Treatment and Natural Products. Diabetes Metab. Syndr. Obes. 2021, 14, 67–83. [Google Scholar] [CrossRef]
- Haider, N.; Larose, L. Harnessing adipogenesis to prevent obesity. Adipocyte 2019, 8, 98–104. [Google Scholar] [CrossRef] [Green Version]
- Ying, T.; Simmons, R.A. The Role of Adipocyte Precursors in Development and Obesity. Front. Endocrinol. 2020, 11, 613606. [Google Scholar] [CrossRef]
- Wang, Q.A.; Tao, C.; Gupta, R.K.; Scherer, P.E. Tracking adipogenesis during white adipose tissue development, expansion and regeneration. Nat. Med. 2013, 19, 1338–1344. [Google Scholar] [CrossRef] [PubMed]
- Spalding, K.L.; Arner, E.; Westermark, P.O.; Bernard, S.; Buchholz, B.A.; Bergmann, O.; Blomqvist, L.; Hoffstedt, J.; Naslund, E.; Britton, T.; et al. Dynamics of fat cell turnover in humans. Nature 2008, 453, 783–787. [Google Scholar] [CrossRef]
- Jeffery, E.; Church, C.D.; Holtrup, B.; Colman, L.; Rodeheffer, M.S. Rapid depot-specific activation of adipocyte precursor cells at the onset of obesity. Nat. Cell Biol. 2015, 17, 376–385. [Google Scholar] [CrossRef]
- Chen, F.J.; Yin, Y.; Chua, B.T.; Li, P. CIDE family proteins control lipid homeostasis and the development of metabolic diseases. Traffic 2020, 21, 94–105. [Google Scholar] [CrossRef] [PubMed]
- Su, L.; Zhou, L.; Chen, F.J.; Wang, H.; Qian, H.; Sheng, Y.; Zhu, Y.; Yu, H.; Gong, X.; Cai, L.; et al. Cideb controls sterol-regulated ER export of SREBP/SCAP by promoting cargo loading at ER exit sites. EMBO J. 2019, 38, e100156. [Google Scholar] [CrossRef]
- Zhou, L.; Yu, M.; Arshad, M.; Wang, W.; Lu, Y.; Gong, J.; Gu, Y.; Li, P.; Xu, L. Coordination Among Lipid Droplets, Peroxisomes, and Mitochondria Regulates Energy Expenditure Through the CIDE-ATGL-PPARα Pathway in Adipocytes. Diabetes 2018, 67, 1935–1948. [Google Scholar] [CrossRef] [Green Version]
- Gao, G.; Chen, F.J.; Zhou, L.; Su, L.; Xu, D.; Xu, L.; Li, P. Control of lipid droplet fusion and growth by CIDE family proteins. Biochim. Biophys. Acta. Mol. Cell Biol. Lipids 2017, 1862, 1197–1204. [Google Scholar] [CrossRef]
- Sun, Z.; Gong, J.; Wu, H.; Xu, W.; Wu, L.; Xu, D.; Gao, J.; Wu, J.W.; Yang, H.; Yang, M.; et al. Perilipin1 promotes unilocular lipid droplet formation through the activation of Fsp27 in adipocytes. Nat. Commun. 2013, 4, 1594. [Google Scholar] [CrossRef] [Green Version]
- Ito, M.; Nagasawa, M.; Omae, N.; Ide, T.; Akasaka, Y.; Murakami, K. Differential regulation of CIDEA and CIDEC expression by insulin via Akt1/2- and JNK2-dependent pathways in human adipocytes. J. Lipid Res. 2011, 52, 1450–1460. [Google Scholar] [CrossRef] [Green Version]
- Gong, J.; Sun, Z.; Wu, L.; Xu, W.; Schieber, N.; Xu, D.; Shui, G.; Yang, H.; Parton, R.G.; Li, P. Fsp27 promotes lipid droplet growth by lipid exchange and transfer at lipid droplet contact sites. J. Cell Biol. 2011, 195, 953–963. [Google Scholar] [CrossRef]
- Chen, D.; Wang, Y.; Wu, K.; Wang, X. Dual Effects of Metformin on Adipogenic Differentiation of 3T3-L1 Preadipocyte in AMPK-Dependent and Independent Manners. Int. J. Mol. Sci. 2018, 19, 1547. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, S.R.; Lovejoy, J.C.; Greenway, F.; Ryan, D.; deJonge, L.; de la Bretonne, J.; Volafova, J.; Bray, G.A. Contributions of total body fat, abdominal subcutaneous adipose tissue compartments, and visceral adipose tissue to the metabolic complications of obesity. Metab. Clin. Exp. 2001, 50, 425–435. [Google Scholar] [CrossRef] [PubMed]
- Monzon, J.R.; Basile, R.; Heneghan, S.; Udupi, V.; Green, A. Lipolysis in adipocytes isolated from deep and superficial subcutaneous adipose tissue. Obes. Res. 2002, 10, 266–269. [Google Scholar] [CrossRef] [PubMed]
- Kelley, D.E.; Thaete, F.L.; Troost, F.; Huwe, T.; Goodpaster, B.H. Subdivisions of subcutaneous abdominal adipose tissue and insulin resistance. Am. J. Physiol. Endocrinol. Metab. 2000, 278, E941–E948. [Google Scholar] [CrossRef] [PubMed]
- Chau, Y.Y.; Bandiera, R.; Serrels, A.; Martinez-Estrada, O.M.; Qing, W.; Lee, M.; Slight, J.; Thornburn, A.; Berry, R.; McHaffie, S.; et al. Visceral and subcutaneous fat have different origins and evidence supports a mesothelial source. Nat. Cell Biol. 2014, 16, 367–375. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cawthorn, W.P.; Scheller, E.L.; MacDougald, O.A. Adipose tissue stem cells meet preadipocyte commitment: Going back to the future. J. Lipid Res. 2012, 53, 227–246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Macotela, Y.; Emanuelli, B.; Mori, M.A.; Gesta, S.; Schulz, T.J.; Tseng, Y.H.; Kahn, C.R. Intrinsic differences in adipocyte precursor cells from different white fat depots. Diabetes 2012, 61, 1691–1699. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tchkonia, T.; Giorgadze, N.; Pirtskhalava, T.; Tchoukalova, Y.; Karagiannides, I.; Forse, R.A.; DePonte, M.; Stevenson, M.; Guo, W.; Han, J.; et al. Fat depot origin affects adipogenesis in primary cultured and cloned human preadipocytes. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2002, 282, R1286–R1296. [Google Scholar] [CrossRef] [Green Version]
- Baglioni, S.; Cantini, G.; Poli, G.; Francalanci, M.; Squecco, R.; Di Franco, A.; Borgogni, E.; Frontera, S.; Nesi, G.; Liotta, F.; et al. Functional differences in visceral and subcutaneous fat pads originate from differences in the adipose stem cell. PLoS ONE 2012, 7, e36569. [Google Scholar] [CrossRef]
- Chen, T.; Zhang, Y.; Dong, Y.; Zhang, D.; Xia, L.; Sun, X.; Li, H.; Han, C.; Wang, H.; Xu, G. Mast cell and heparin promote adipogenesis in superficial fascia of rats. Biochim. Biophys. Acta. Mol. Cell Biol. Lipids 2021, 1866, 159024. [Google Scholar] [CrossRef]
- Zhang, Y.; Su, X.; Dong, Y.; Chen, T.; Zhang, Y.; Wu, B.; Li, H.; Sun, X.; Xia, L.; Zhang, D.; et al. Cytological and functional characteristics of fascia adipocytes in rats: A unique population of adipocytes. Biochim. Biophys. Acta. Mol. Cell Biol. Lipids 2020, 1865, 158585. [Google Scholar] [CrossRef] [PubMed]
- Alexandre, K.B.; Smit, A.M.; Gray, I.P.; Crowther, N.J. Metformin inhibits intracellular lipid accumulation in the murine pre-adipocyte cell line, 3T3-L1. Diabetes Obes. Metab. 2008, 10, 688–690. [Google Scholar] [PubMed]
- Moreno-Navarrete, J.M.; Ortega, F.J.; Rodríguez-Hermosa, J.I.; Sabater, M.; Pardo, G.; Ricart, W.; Fernández-Real, J.M. OCT1 Expression in adipocytes could contribute to increased metformin action in obese subjects. Diabetes 2011, 60, 168–176. [Google Scholar] [CrossRef] [Green Version]
- Anedda, A.; Rial, E.; González-Barroso, M.M. Metformin induces oxidative stress in white adipocytes and raises uncoupling protein 2 levels. J. Endocrinol. 2008, 199, 33–40. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.C.; Brooks, R.; Houskeeper, J.; Bremner, S.K.; Dunlop, J.; Viollet, B.; Logan, P.J.; Salt, I.P.; Ahmed, S.F.; Yarwood, S.J. Metformin suppresses adipogenesis through both AMP-activated protein kinase (AMPK)-dependent and AMPK-independent mechanisms. Mol. Cell. Endocrinol. 2017, 440, 57–68. [Google Scholar] [CrossRef]
- Herker, E.; Vieyres, G.; Beller, M.; Krahmer, N.; Bohnert, M. Lipid Droplet Contact Sites in Health and Disease. Trends Cell Biol. 2021, 31, 345–358. [Google Scholar] [CrossRef]
- Sztalryd, C.; Brasaemle, D.L. The perilipin family of lipid droplet proteins: Gatekeepers of intracellular lipolysis. Biochim. Biophys. Acta. Mol. Cell Biol. Lipids 2017, 1862, 1221–1232. [Google Scholar] [CrossRef]
- Xu, L.; Zhou, L.; Li, P. CIDE proteins and lipid metabolism. Arterioscler. Thromb. Vasc. Biol. 2012, 32, 1094–1098. [Google Scholar] [CrossRef] [Green Version]
- Gong, J.; Sun, Z.; Li, P. CIDE proteins and metabolic disorders. Curr. Opin. Lipidol. 2009, 20, 121–126. [Google Scholar] [CrossRef]
- Zhou, Z.; Yon Toh, S.; Chen, Z.; Guo, K.; Ng, C.P.; Ponniah, S.; Lin, S.C.; Hong, W.; Li, P. Cidea-deficient mice have lean phenotype and are resistant to obesity. Nat. Genet. 2003, 35, 49–56. [Google Scholar] [CrossRef]
- Puri, V.; Ranjit, S.; Konda, S.; Nicoloro, S.M.; Straubhaar, J.; Chawla, A.; Chouinard, M.; Lin, C.; Burkart, A.; Corvera, S.; et al. Cidea is associated with lipid droplets and insulin sensitivity in humans. Proc. Natl. Acad. Sci. USA 2008, 105, 7833–7838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brasaemle, D.L.; Dolios, G.; Shapiro, L.; Wang, R. Proteomic analysis of proteins associated with lipid droplets of basal and lipolytically stimulated 3T3-L1 adipocytes. J. Biol. Chem. 2004, 279, 46835–46842. [Google Scholar] [CrossRef] [Green Version]
- Nordstrom, E.A.; Ryden, M.; Backlund, E.C.; Dahlman, I.; Kaaman, M.; Blomqvist, L.; Cannon, B.; Nedergaard, J.; Arner, P. A human-specific role of cell death-inducing DFFA (DNA fragmentation factor-alpha)-like effector A (CIDEA) in adipocyte lipolysis and obesity. Diabetes 2005, 54, 1726–1734. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nishino, N.; Tamori, Y.; Tateya, S.; Kawaguchi, T.; Shibakusa, T.; Mizunoya, W.; Inoue, K.; Kitazawa, R.; Kitazawa, S.; Matsuki, Y.; et al. FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets. J. Clin. Investig. 2008, 118, 2808–2821. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Danesch, U.; Hoeck, W.; Ringold, G.M. Cloning and transcriptional regulation of a novel adipocyte-specific gene, FSP27. CAAT-enhancer-binding protein (C/EBP) and C/EBP-like proteins interact with sequences required for differentiation-dependent expression. J. Biol. Chem. 1992, 267, 7185–7193. [Google Scholar] [CrossRef]
- Nishimoto, Y.; Nakajima, S.; Tateya, S.; Saito, M.; Ogawa, W.; Tamori, Y. Cell death-inducing DNA fragmentation factor A-like effector A and fat-specific protein 27beta coordinately control lipid droplet size in brown adipocytes. J. Biol. Chem. 2017, 292, 10824–10834. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rubio-Cabezas, O.; Puri, V.; Murano, I.; Saudek, V.; Semple, R.K.; Dash, S.; Hyden, C.S.; Bottomley, W.; Vigouroux, C.; Magre, J.; et al. Partial lipodystrophy and insulin resistant diabetes in a patient with a homozygous nonsense mutation in CIDEC. EMBO Mol. Med. 2009, 1, 280–287. [Google Scholar] [CrossRef]
- Wu, L.; Xu, D.; Zhou, L.; Xie, B.; Yu, L.; Yang, H.; Huang, L.; Ye, J.; Deng, H.; Yuan, Y.A.; et al. Rab8a-AS160-MSS4 regulatory circuit controls lipid droplet fusion and growth. Dev. Cell 2014, 30, 378–393. [Google Scholar] [CrossRef] [Green Version]
- Auger, C.; Knuth, C.M.; Abdullahi, A.; Samadi, O.; Parousis, A.; Jeschke, M.G. Metformin prevents the pathological browning of subcutaneous white adipose tissue. Mol. Metab. 2019, 29, 12–23. [Google Scholar] [CrossRef]
- Luo, T.; Nocon, A.; Fry, J.; Sherban, A.; Rui, X.; Jiang, B.; Xu, X.J.; Han, J.; Yan, Y.; Yang, Q.; et al. AMPK Activation by Metformin Suppresses Abnormal Extracellular Matrix Remodeling in Adipose Tissue and Ameliorates Insulin Resistance in Obesity. Diabetes 2016, 65, 2295–2310. [Google Scholar] [CrossRef] [Green Version]
- Caton, P.W.; Kieswich, J.; Yaqoob, M.M.; Holness, M.J.; Sugden, M.C. Metformin opposes impaired AMPK and SIRT1 function and deleterious changes in core clock protein expression in white adipose tissue of genetically-obese db/db mice. Diabetes Obes. Metab. 2011, 13, 1097–1104. [Google Scholar] [CrossRef] [PubMed]
- Huypens, P.; Quartier, E.; Pipeleers, D.; Van de Casteele, M. Metformin reduces adiponectin protein expression and release in 3T3-L1 adipocytes involving activation of AMP activated protein kinase. Eur. J. Pharmacol. 2005, 518, 90–95. [Google Scholar] [CrossRef] [PubMed]
- Sharma, V.M.; Vestergaard, E.T.; Jessen, N.; Kolind-Thomsen, P.; Nellemann, B.; Nielsen, T.S.; Vendelbo, M.H.; Moller, N.; Sharma, R.; Lee, K.Y.; et al. Growth hormone acts along the PPARgamma-FSP27 axis to stimulate lipolysis in human adipocytes. Am. J. Physiol. Endocrinol. Metab. 2019, 316, E34–E42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharma, R.; Luong, Q.; Sharma, V.M.; Harberson, M.; Harper, B.; Colborn, A.; Berryman, D.E.; Jessen, N.; Jorgensen, J.O.L.; Kopchick, J.J.; et al. Growth hormone controls lipolysis by regulation of FSP27 expression. J. Endocrinol. 2018, 239, 289–301. [Google Scholar] [CrossRef] [PubMed]
- De la Rosa Rodriguez, M.A.; Kersten, S. Regulation of lipid droplet-associated proteins by peroxisome proliferator-activated receptors. Biochim. Biophys. Acta. Mol. Cell Biol. Lipids 2017, 1862, 1212–1220. [Google Scholar] [CrossRef]
- Kim, Y.J.; Cho, S.Y.; Yun, C.H.; Moon, Y.S.; Lee, T.R.; Kim, S.H. Transcriptional activation of Cidec by PPARgamma2 in adipocyte. Biochem. Biophys. Res. Commun. 2008, 377, 297–302. [Google Scholar] [CrossRef]
- Yu, S.; Matsusue, K.; Kashireddy, P.; Cao, W.Q.; Yeldandi, V.; Yeldandi, A.V.; Rao, M.S.; Gonzalez, F.J.; Reddy, J.K. Adipocyte-specific gene expression and adipogenic steatosis in the mouse liver due to peroxisome proliferator-activated receptor gamma1 (PPARgamma1) overexpression. J. Biol. Chem. 2003, 278, 498–505. [Google Scholar] [CrossRef] [Green Version]
- Cruciani, S.; Garroni, G.; Pala, R.; Cossu, M.L.; Ginesu, G.C.; Ventura, C.; Maioli, M. Metformin and Vitamin D Modulate Inflammation and Autophagy during Adipose-Derived Stem Cell Differentiation. Int. J. Mol. Sci. 2021, 22, 6686. [Google Scholar] [CrossRef]
- Qi, T.; Chen, Y.; Li, H.; Pei, Y.; Woo, S.L.; Guo, X.; Zhao, J.; Qian, X.; Awika, J.; Huo, Y.; et al. A role for PFKFB3/iPFK2 in metformin suppression of adipocyte inflammatory responses. J. Mol. Endocrinol. 2017, 59, 49–59. [Google Scholar] [CrossRef] [Green Version]
- Bharath, L.P.; Agrawal, M.; McCambridge, G.; Nicholas, D.A.; Hasturk, H.; Liu, J.; Jiang, K.; Liu, R.; Guo, Z.; Deeney, J.; et al. Metformin Enhances Autophagy and Normalizes Mitochondrial Function to Alleviate Aging-Associated Inflammation. Cell Metab. 2020, 32, 44–55. [Google Scholar] [CrossRef]
- Malekpour-Dehkordi, Z.; Teimourian, S.; Nourbakhsh, M.; Naghiaee, Y.; Sharifi, R.; Mohiti-Ardakani, J. Metformin reduces fibrosis factors in insulin resistant and hypertrophied adipocyte via integrin/ERK, collagen VI, apoptosis, and necrosis reduction. Life Sci. 2019, 233, 116682. [Google Scholar] [CrossRef] [PubMed]
- Lu, K.Y.; Primus Dass, K.T.; Lin, S.Z.; Tseng, Y.H.; Liu, S.P.; Harn, H.J. N-butylidenephthalide ameliorates high-fat diet-induced obesity in mice and promotes browning through adrenergic response/AMPK activation in mouse beige adipocytes. Biochim. Biophys. Acta. Mol. Cell Biol. Lipids 2021, 1866, 159033. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.; Nam, K.H.; Yi, S.A.; Park, J.W.; Han, J.W.; Lee, J. Ginsenoside Rg3 Induces Browning of 3T3-L1 Adipocytes by Activating AMPK Signaling. Nutrients 2020, 12, 427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagy, L.; Rauch, B.; Balla, N.; Ujlaki, G.; Kis, G.; Abdul-Rahman, O.; Kristóf, E.; Sipos, A.; Antal, M.; Tóth, A.; et al. Olaparib induces browning of in vitro cultures of human primary white adipocytes. Biochem. Pharmacol. 2019, 167, 76–85. [Google Scholar] [CrossRef]
- Hong, Y.; Lin, Y.; Si, Q.; Yang, L.; Dong, W.; Gu, X. Ginsenoside Rb2 Alleviates Obesity by Activation of Brown Fat and Induction of Browning of White Fat. Front. Endocrinol. 2019, 10, 153. [Google Scholar] [CrossRef] [Green Version]
- Imran, K.M.; Yoon, D.; Kim, Y.S. A pivotal role of AMPK signaling in medicarpin-mediated formation of brown and beige. BioFactors 2018, 44, 168–179. [Google Scholar] [CrossRef]
- Jeong, M.Y.; Park, J.; Youn, D.H.; Jung, Y.; Kang, J.; Lim, S.; Kang, M.W.; Kim, H.L.; So, H.S.; Park, R.; et al. Albiflorin ameliorates obesity by inducing thermogenic genes via AMPK and PI3K/AKT in vivo and in vitro. Metab. Clin. Exp. 2017, 73, 85–99. [Google Scholar] [CrossRef]
- Abdul-Rahman, O.; Kristóf, E.; Doan-Xuan, Q.M.; Vida, A.; Nagy, L.; Horváth, A.; Simon, J.; Maros, T.; Szentkirályi, I.; Palotás, L.; et al. AMP-Activated Kinase (AMPK) Activation by AICAR in Human White Adipocytes Derived from Pericardial White Adipose Tissue Stem Cells Induces a Partial Beige-Like Phenotype. PLoS ONE 2016, 11, e0157644. [Google Scholar] [CrossRef] [Green Version]
- Zhang, T.; Liu, J.; Tong, Q.; Lin, L. SIRT3 Acts as a Positive Autophagy Regulator to Promote Lipid Mobilization in Adipocytes via Activating AMPK. Int. J. Mol. Sci. 2020, 21, 372. [Google Scholar] [CrossRef] [Green Version]
- Ma, T.; Tian, X.; Zhang, B.; Li, M.; Wang, Y.; Yang, C.; Wu, J.; Wei, X.; Qu, Q.; Yu, Y.; et al. Low-dose metformin targets the lysosomal AMPK pathway through PEN2. Nature 2022, 603, 159–165. [Google Scholar] [CrossRef]
- Su, X.; Lyu, Y.; Wang, W.; Zhang, Y.; Li, D.; Wei, S.; Du, C.; Geng, B.; Sztalryd, C.; Xu, G. Fascia Origin of Adipose Cells. Stem. Cells 2016, 34, 1407–1419. [Google Scholar] [CrossRef] [PubMed]
- Luo, Z.; Ma, L.; Zhao, Z.; He, H.; Yang, D.; Feng, X.; Ma, S.; Chen, X.; Zhu, T.; Cao, T.; et al. TRPV1 activation improves exercise endurance and energy metabolism through PGC-1alpha upregulation in mice. Cell Res. 2012, 22, 551–564. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, M.; Wang, H.; Li, X.; Li, N.; Xu, G.; Meng, Q. PLIN1 deficiency affects testicular gene expression at the meiotic stage in the first wave of spermatogenesis. Gene 2014, 543, 212–219. [Google Scholar] [CrossRef] [PubMed]
Genes | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
---|---|---|
Pparγ | TCTTAACTGTCGGATCCAC | CAAACCTGATGGCATTGTGA |
Cebpa | AGATAAAGCCAAACAGCGCAAC | CCTAGAGATCCAGCGACCCT |
Fabp4 | CCGAGATTTCCTTCAAACTGG | ATGCCCTTTCGTAAACTCT |
Adipoq | GTCACTGTCCCCAATGTTCC | TTTTCCTGATACTGGTCGT |
Acc | ACTTTAACCGTGAAGGGCTA | CCATCCACAATATAAGCACCA |
Fasn | CCATTTCCATTGCCCTTAGCC | GTAACACATGCTGCTCAAACGA |
Dgat2 | ATAGCTGCTCTCTACTTCACC | AGTCTCGAAAATAGCGCCACA |
Cidec | AGCCCTACCAAGAGATACAGT | CGTCGATCTTCTTAGTTGGCTT |
Perilipin1 | CCATGTCCCTATCCGATGCC | ATGTCTCGGTTTTGTCATCCAG |
Rab8a | CTCTAACCCTTCCCCGATG | ATGACTATTGCTGGTACGTT |
β-actin | ATCCGTAAAGACCTCTATGCC | GCTCAGTAACAGTCCGCCTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, L.; Jia, X.; Fang, D.; Cheng, Y.; Zhai, Z.; Deng, W.; Du, B.; Lu, T.; Wang, L.; Yang, C.; et al. Metformin Inhibits Lipid Droplets Fusion and Growth via Reduction in Cidec and Its Regulatory Factors in Rat Adipose-Derived Stem Cells. Int. J. Mol. Sci. 2022, 23, 5986. https://doi.org/10.3390/ijms23115986
Yang L, Jia X, Fang D, Cheng Y, Zhai Z, Deng W, Du B, Lu T, Wang L, Yang C, et al. Metformin Inhibits Lipid Droplets Fusion and Growth via Reduction in Cidec and Its Regulatory Factors in Rat Adipose-Derived Stem Cells. International Journal of Molecular Sciences. 2022; 23(11):5986. https://doi.org/10.3390/ijms23115986
Chicago/Turabian StyleYang, Lijing, Xiaowei Jia, Dongliang Fang, Yuan Cheng, Zhaoyi Zhai, Wenyang Deng, Baopu Du, Tao Lu, Lulu Wang, Chun Yang, and et al. 2022. "Metformin Inhibits Lipid Droplets Fusion and Growth via Reduction in Cidec and Its Regulatory Factors in Rat Adipose-Derived Stem Cells" International Journal of Molecular Sciences 23, no. 11: 5986. https://doi.org/10.3390/ijms23115986