Next Article in Journal
Predicting Genetic Disorder and Types of Disorder Using Chain Classifier Approach
Next Article in Special Issue
Effect of CUX1 on the Proliferation of Hu Sheep Dermal Papilla Cells and on the Wnt/β-Catenin Signaling Pathway
Previous Article in Journal
Non-Syndromic Hearing Loss in a Romanian Population: Carrier Status and Frequent Variants in the GJB2 Gene
Previous Article in Special Issue
Runs of Homozygosity Revealed Reproductive Traits of Hu Sheep
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 14
Issue 1
10.3390/genes14010070
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Lentivirus Susceptibility in Brazilian and US Sheep with TMEM154 Mutations

by
Camila Souza Rodrigues
1,
Danielle Assis de Faria
1,
Thaísa Sant’Anna Lacerda
1,
Samuel Rezende Paiva
2,*,
Alexandre Rodrigues Caetano
2,
Harvey Blackburn
3 and
Concepta McManus
4
1
Faculdade de Agronomia e Medicina Veterinária, Instituto Central de Ciências, Campus Darcy Ribeiro, Universidade de Brasília, Asa Norte, Brasilia 70910-900, DF, Brazil
2
Embrapa Recursos Genéticos e Biotecnologia, Final W5 Norte, Brasilia 70770-917, DF, Brazil
3
USDA-ARS—Agricultural Genetic Resources Preservation Research, 1111 South Mason Street, Fort Collins, CO 805214500, USA
4
Departamento de Ciências Fisiológicas, Instituto de Biologia, Campus Darcy Ribeiro, Universidade de Brasilia, Asa Norte, Brasilia 70910-900, DF, Brazil
*
Author to whom correspondence should be addressed.
Genes 2023, 14(1), 70; https://doi.org/10.3390/genes14010070
Submission received: 4 November 2022 / Revised: 13 December 2022 / Accepted: 22 December 2022 / Published: 26 December 2022
(This article belongs to the Special Issue Advances in Sheep Molecular Genetics and Breeding)
Browse Figure
Review Reports Versions Notes

Abstract

:
Small ruminant lentiviruses (SRLVs) affect sheep and goats worldwide. The major gene related to SRLV infections is the Transmembrane Protein Gene 154 (TMEM154). We estimated the haplotype frequencies of TMEM154 in the USA (USDA-ARS) and Brazil (Embrapa) Gene Banks by using two different SNP genotyping methodologies, FluidigmTM and KASPTM. We also genotyped the ZNF389_ss748775100 deletion variant in Brazilian flocks. A total of 1040 blood samples and 112 semen samples from 15 Brazilian breeds were genotyped with Fluidigm for the SNP ZNF389_ss748775100 and 12 TMEM154 SNPs. A total of 484 blood samples from the Santa Inês breed and 188 semen samples from 14 North American sheep breeds were genotyped with KASP for 6 TMEM154 SNPs. All the Brazilian samples had the “I/I” genotype for the ZNF389_ss748775100 mutation. There were 25 TMEM154 haplotypes distributed across the Brazilian breeds, and 4 haplotypes in the US breeds. Haplotypes associated with susceptibility were present in almost all breeds, which suggests that genetic testing can help to improve herd health and productivity by selecting non-susceptible animals as founders of the next generations. Fluidigm and KASP are reliable assays when compared with Beadchip arrays. Further studies are necessary to understand the unknown role of TMEM154 mutations, host–pathogen interaction and new genes associated with the clinical condition.

1. Introduction

Maedi-visna virus (MVV) and caprine arthritis encephalitis virus (CAEV) are small ruminant lentiviruses (SRLVs) that belong to the genus Lentivirus in the Retroviridae family. They are distributed worldwide, causing significant economic losses in many countries [1]. Infections in sheep include interstitial pneumonia with dyspnea, indurative mastitis and cachexia, persisting for the lifetime of the host and causing chronic inflammation [2]. Seroconversion in MVV-infected sheep occurs over weeks to months, and, such as other diseases caused by lentiviruses, no effective treatment or vaccine is available [3]. Infected animals show progressive weight loss, low milk yield and a reduced production rate that can lead to premature culling [4].
Iceland was successful in ridding local sheep breeds of maedi-visna (MV) or Ovine Progressive Pneumonia (OPP) after an effort that lasted more than three decades [5]. There are no reports of MVV in Australia or New Zealand, despite problems with CAEV in goats from both countries [6,7]. Within the UK, MV has reduced lamb production by up to 40% in commercial flocks, whereas in the United States, studies have shown that nearly a quarter of the sheep herd is infected with the disease [8,9]. In Brazil, the condition is widespread in most of the states investigated, affecting flocks from the northeast [10,11,12,13] to the southeast region of the country [14,15,16,17].
Previous studies reported the occurrence of multiple candidate loci associated with a resistance/susceptibility to MV, such as ZNF389 [18], CCR5 [19], TLR9 [20], ovar-DRB1 [21,22], DPPA2/DPPA4 and SYTL3 [23]. A previous study has reported that breed-specific differences can influence a higher or lower susceptibility to lentiviruses in small ruminants [24]. In a Genome-wide association study (GWAS), the deletion variant of ZNF389 was linked with the proviral concentration of ovine Lentivirus (OvLV) found in some of the most common sheep breeds of the US [23]. Subsequently, another study indicated that insertion homozygotes had less than half the adjusted mean proviral concentration when compared with other genotypes [18].
Heaton et al. [25] identified a major gene related to OPP susceptibility, the transmembrane protein gene 154 (TMEM154). According to the authors, animals that have the ancestral haplotype (designated haplotype 3), which encodes glutamate (E) at position 35 and asparagine (N) at position 70, and the designated haplotype 2, which encodes isoleucine (I) at position 70 of the TMEM protein, are highly susceptible to MV. Conversely, those with haplotype 1, homozygous for the mutation encoding lysine (K) at position 35, are considered less susceptible to the infection.
After identifying the positive association between TMEM154 and lentivirus susceptibility, a linkage disequilibrium (LD) between TMEM154_E35K locus and SNP OAR17_5388531 (Illumina® Ovine SNP50 Beadchip) was observed [26]. The LD between these two loci assign that the allele “C” at SNP OAR17_5388531 is associated with a higher susceptibility to the infection. Other papers confirmed this association in sheep from Turkey [27], Germany [28], Iran [29] and Spain [30].
Although a link between the effects of TMEM154 on MV is often reported, the role of some TMEM154 mutations needs to be further investigated. Additionally, other studies are necessary to fully understand the impact of other co-receptors in the occurrence of the disease. The use of TMEM154 as a proxy can make the genomic selection of animals with favorable haplotypes possible and help reduce the economic losses caused by MV [26].
The selection of animals with favorable haplotypes can also improve the quality of germplasm (e.g., semen and embryos) stored at gene banks. Ex situ collections, such as the Brazilian Animal Germplasm Biobank (BBGA) and the American germplasm collection managed by the US National Germplasm Program (NAGP), are valuable tools that, allied with in situ conservation, can help in the conservation of Animal Genetic Resources [31]. Therefore, genotyping samples kept at gene banks are crucial to guarantee the predominance of favorable haplotypes against MV. This can be an important strategy to optimize the quality of the material stored and ensure that genetic variability is maintained [32].
This study aimed at estimating the haplotype frequencies of the TMEM154 gene and genotyping the ZNF389_ss748775100 deletion, related to lentivirus susceptibility, in the USA (USDA-ARS) and Brazil (Embrapa) animal genetic resources gene banks by using two different SNP genotyping methodologies, FluidigmTM and KASPTM.

2. Materials and Methods

2.1. Animal Samples

The present study used 1040 blood samples from the sheep of 15 Brazilian breeds, kept in conservation centers of the Brazilian Agricultural Research Corporation (Embrapa) distributed across the country. The main criteria for sample selection were the biological material and breed availability in our National Gene Bank and the Embrapa Conservation Nucleus. Within breeds, the criterion was regional sampling. The breeds used in the study were: Santa Inês, Morada Nova, Crioula Lanada, Rabo Largo, Somali, Bergamasca, Corriedale, Ile de France, Pantaneiro, Dorper, Damara, Suffolk, Hampshire, Texel and Barriga Negra. Semen samples (N = 112) from these breeds kept at the Brazilian Animal Germplasm Biobank (BBGA) were also included in the study (Table 1). Additionally, we used 484 blood samples spotted on the FTA (Flinders Technology Associates) cards of the Santa Inês breed, belonging to a herd kept by a Conservation Nuclei at Embrapa Tabuleiros Costeiros (CPATC) and, finally, 188 animal samples of 14 North American breeds: Barbados Blackbelly, Black Welsh Mountain, Bluefaced Leicester, Hampshire, Hog Island, Katahdin, Leicester Longwool, Lincoln, Navajo Churro, Polypay, Rambouillet, Romanov, St. Croix and Suffolk kept at the National Center for Genetic Resources Preservation (NCGRP) (Table 1).
Semen samples were acquired from artificial insemination centers either by the American National Animal Germplasm Program or Brazilian Animal Germplasm Network as an effort to conserve genetic resources.
DNA extraction was performed using the Puregene purification protocol (Gentra Puregene® Kit, QIAGEN, USA) for blood and semen samples. The DNA of the blood-spotted FTATM cards was extracted using the GenSolve™ DNA Recovery Kit (GenTegra, USA) according to the manufacturer’s instructions. A DNA quality check of the Brazilian sheep samples was performed in two ways. Initially, 1% agarose gel was used, stained with ethidium bromide, using lambda standards of 200 ng/µg, 100 ng/µg and 50 ng/µg for comparison. In addition, the samples were analyzed in a NanoDrop Thermo Scientific spectrophotometer (NanoDropTM 8000. Thermo Fisher Scientific, 2010. https://www.thermofisher.com/ accessed on 12 July 2015). The DNA obtained from the North American sheep was quantified by spectrophotometry only.

2.2. Genotyping Methodologies

We used two genotyping methodologies in the present study: KASP™ (LGC Genomics, Hoddesdon, UK) and Fluidigm EP1™ system (Fluidigm, San Francisco, CA, USA). After a quality and quantity check, 90 µg of DNA was used for genotyping the Brazilian breeds, except for the Santa Inês samples from the CPATC. Genotyping data were generated according to standard protocols provided by Fluidigm for use with an EP1 platform. Each sample underwent pre-amplification with a set of Locus-Specific Primer (LSP) and Specific Target Amplification (STA) oligonucleotides for the assayed SNPs. Diluted amplified product was loaded into twelve 96.96 Dynamic Array™ IFCs (Fluidigm, San Francisco, CA, USA) with a ROX reference dye, amplification mixture, assays containing the Allele-Specific Primers (ASP) and LSP oligonucleotides for each SNP, according to the manufacturer’s instructions at Embrapa Genetic Resources and Biotechnology (Brasilia, Brazil). Briefly, Fluidigm® SNP Type™ assays were designed for 12 selected SNPs with a Fluidigm D3™ assay web-based tool, according to the manufacturer’s instructions and rules described at [https://d3.fluidigm.com/account/login accessed on 12 July 2015]. Endpoint fluorescence image data were acquired on the EP1 Fluidigm imager, and the genotype calls were obtained by the Fluidigm SNP Genotyping Analysis Software.
The North American breeds and the Santa Inês samples from the CPATC were genotyped by KASP, using 10 ηg of DNA per sample in a 96-well plate format. The reaction and the components used in the KASP methodology are described at [http://www.lgcgenomics.com/genotyping/kasp-genotyping-reagents/ accessed on 12 July 2015]. Oligonucleotides were designed with the Kraken™ software system according to the manufacturer’s instructions (LGC Genomics, Hoddesdon, UK).
The SNPs OAR17_5388531 (rs414338245), TMEM154_N70I (rs427737740), TMEM154_E35K (rs408593969), TMEM154_I102T, TMEM154_A13V-Fl2 and TMEM154_T25I were genotyped by both the KASP and Fluidigm methodologies. The SNP ZNF389_ss748775100 and SNPs TMEM154_D33N (rs429882112), TMEM154_E31Q_v2, TMEM154_I74F (rs410216979), TMEM154_L14H, TMEM154_T44M (rs420489630) and TMEM154_E84Y were genotyped only by the Fluidigm methodology. The ZNF389 deletion variant NC_019477.1: g.29500068_29500069delAT ovine chromosome 20, NCBI dbSNP ss748775100) was genotyped with CGAATGGATCTTCAAGGCTTA and CAGCTTTTCCATGCAGAGTC as amplification primers, designed according to White et al. [18] and observing the specific rules of the Fluidigm assay. The flanking sequences of the TMEM154 SNPs were designed according to Heaton et al. [26], observing each methodology’s rules which are provided in Supplementary Table S1.
Genotypes from the locus OAR17_5388531 within Illumina® Ovine SNP50 and Illumina® Ovine 600K were used to determine genotype reproducibility among methodologies. We were able to access 14 and 7 common animals between Fluidigm and Illumina® Ovine SNP50 and Illumina® Ovine 600K, respectively (Table S2). Furthermore, 7 and 14 samples were used to compare KASP and Illumina® Ovine SNP50 and Illumina® Ovine 600K, respectively (Table S3). Additionally, the locus TMEM154_E35K was accessed in 10 common animals between Fluidigm and Illumina® Ovine 600K BeadChip (Table S4). Finally, to compare both methodologies used in this study, we used 3 SNPs (TMEM154_E35K, TMEM154_N70I and TMEM154_I102T) in 27 samples (Table S5). The Friedman test [33] was applied to determine whether the differences in the genotypes across the methodologies were statistically significant.

2.3. Data Analysis

Clustering was used to define the genotype classes for each SNP for both methods and was processed using GenomeStudio (Illumina Inc., San Diego, CA, USA). The confidence threshold for each genotype was >0.90 for both methodologies. Samples, in batches of 96, underwent quality control using SNP & Variation Suite v8.9.1—SVS (Golden Helix, Bozeman, MT, www.goldenhelix.com accessed on 15 November 2019) [34], eliminating samples with a call rate < 0.80 and markers with a call rate < 0.75. The linkage disequilibrium (LD) between the TMEM154_E35K and OAR17_5388531 SNPs using r2 statistics [34] was also estimated using SVS v 8.9.1 (Golden Helix, Bozeman, MT, USA) [26]. Allele and haplotype frequencies were estimated by GenAlEx 6.5 [35] and Arlequin 3.5.2.2 [36]. Monomorphic SNPs were not included in the haplotype analysis. Chi-square test (p < 0.05) [37] was performed to determine whether the differences in allele frequencies across populations of the Santa Inês breed were statistically significant (Table S6).

3. Results

3.1. Quality Control and Linkage Disequilibrium (LD)

All SNPs and samples passed the quality control filters for the KASP methodology. From the 6 SNPs genotyped, 3 were monomorphic in all breeds (TMEM154_I102T, TMEM154_A13V and TMEM154_T25I). After the quality control of the Fluidigm methodology, 845 samples with a call rate >0.80 remained. The SNPs OAR17_5388531, TMEM154_A13V-Fl2, TMEM154_D33N, TMEM154_E31Q_v2, TMEM154_E35K, TMEM154_I74F, TMEM154_N70I, TMEM154_T44M and TMEM154_E84Y successfully passed quality control. The SNPs (TMEM154_L14H and TMEM154_T25I) with a call rate <0.75 were excluded from the analysis. The SNP TMEM154_I102T was monomorphic, presenting the allele “T” in all breeds genotyped and was not included in the haplotype analysis. The locus ZNF389_ss748775100 was also monomorphic in all populations genotyped in this study, with all breeds homozygous for the “I/I” genotype. The r2 measure between the TMEM154_E35K and OAR17_5388531 alleles across all populations were 0.96 and 0.93 on Fluidigm and KASP, respectively, indicating a strong LD between the allele “C” of the locus OAR17_5388531 and the allele “G” of the SNP TMEM154_E35K.

3.2. Allele Frequency of Locus OAR17_5388531 in Brazilian and North American Sheep

The frequency of the ‘‘C’’ allele of the SNP OAR17_5388531 ranged from 0.0% in the Hog Island breed to 100% in the Katahdin and Damara breeds (Figure 1). Breeds with a higher frequency of the “C” allele have higher frequencies of TMEM154 E35 (highly susceptible haplotypes 2 and 3) and, consequently, are animals that are more prone to develop the disease. Alternatively, breeds with a low frequency of the C allele have a higher frequency of TMEM154 K35 (less-susceptible haplotype 1), and, therefore, are animals that are less susceptible to OPP.

3.3. Distribution of TMEM154 Haplotypes in Brazilian and North American Sheep

The nine SNPs in the TMEM154 gene (OAR17_5388531, TMEM154_A13V-Fl2, TMEM154_D33N, TMEM154_E31Q_v2, TMEM154_E35K, TMEM154_I74F, TMEM154_N70I, TMEM154_T44M and TMEM154_E84Y) generated 25 different haplotypes for the Brazilian sheep. The populations with the highest and lowest number of haplotypes were the BBGA and Damara, with 12 and 1, respectively. Among these haplotypes, the most common was ‘‘AQNETNFEI’’ (highly susceptible) (20%), occurring in 13 of the 16 breeds, followed by ‘‘AQDKTNFEI’’ (susceptible) (16%), which occurred in 13 breeds. The rarest haplotypes were “AQNETIFYΔI” (3%), found only in the Dorper breed, followed by ‘‘AQDKMNFEI’’ and AQNEMIIEI’’, both with a 1% frequency in the BBGA samples. Other rare haplotypes were ‘‘AQDEMNFEI’’ and ‘‘AQNKMNFEI’’, with a 1% frequency and present only in the Bergamasca breed. Furthermore, the haplotypes ‘‘AQNETNIYΔI’’ (1%) and ‘‘AQNEMNIYΔI’’ (1%) were unique to the Pantaneiro sheep. Finally, the haplotype ‘‘AQDKTIFYΔI’’ (1%) was detected only in the Rabo Largo breed, and the haplotypes ‘‘AQDETNIEI’’ (1%) and ‘‘AQDETIIEI’’ (1%), were exclusive to the Santa Inês (Table 2).
The 6 SNPs genotyped with the KASP methodology (OAR17_5388531, TMEM154_N70I, TMEM154_E35K, TMEM154_I102T, TMEM154_A13V and TMEM154_T25I) generated 4 haplotypes among the US breeds and the Santa Inês from the Embrapa Tabuleiros Costeiros (CPATC) (Table 3). The most common haplotype found was “KNIT” (less susceptible) (30%), present in 13 populations out of the 15 populations analyzed in this study, followed by “ENIT” (highly susceptible) (9%), present in 11 populations. The less common haplotype was “KIIT” (less susceptible) (3%), found only in the Bluefaced Leicester and Hampshire.

3.4. Data Comparison among Genotyping Platforms

The locus OAR17_5388531 was genotyped on 14 common animals on both Fluidigm and Illumina® Ovine SNP50. The reproducibility of the genotypes between methodologies was 100% (Table S2), with all 28 alleles identical. The same result was obtained when we compared seven animals genotyped with Ilumina® Ovine 600K BeadChip and Fluidigm (Table S2). Another locus between Ilumina® Ovine 600K BeadChip and Fluidigm was used to compare the repeatability of the genotypes between 10 common animals (TMEM154_E35K), and, once again, a total of 20 alleles were the same between the methodologies (Table S4).
Regarding KASP and Illumina® Ovine SNP50, we used seven samples and the locus OAR17_5388531 as a reference. The results were the same as above, with a repeatability of 100% for the 14 alleles. For the same locus, using Ilumina® Ovine 600K BeadChip and 14 samples (Table S3), 28 alleles were identical.
Finally, comparing the two genotyping methodologies used here, KASP and Fluidigm, 27 common animals and 3 loci were analyzed: TMEM154_E35K, TMEM154_N70I and TMEM154_I102T (Table S5). Following the pattern found in the previous analysis, the comparison between Fluidigm and KASP points to a repeatability of 100% on all 3 loci genotyped, as all 54 alleles were identical in the 27 common animals genotyped by both methodologies.

3.5. Differences in Allele Frequencies among Santa Inês Populations

For some loci, a difference in the allele frequency was observed according to the geographic region of origin of the Santa Inês flock. The TMEM154_N70I locus have, in general, the allele “A” as the most frequent allele. However, the Empresa Baiana de Desenvolvimento Agricola (EBDA-BA) and the Embrapa Meio Norte-PI (CPAMN) populations have “T” as their highest frequency allele with frequencies of 0.75 and 0.63, respectively (χ2, p > 0.05) (Table S6). Similar patterns occur for the locus TMEM154_I74F where the BBGA, CNPC and CPATC have the allele “A” as the most frequent. On the other hand, the UnB-DF and CPAMN presented the allele “T” as the most frequent (χ2, p < 0.05). Furthermore, the EBDA-BA has a frequency of 0.5 for each allele. For some loci, e.g., TMEM154_A13V-Fl2 and TMEM154_E31Q_v2, we observed rare alleles with low frequencies in single populations: the CNPC (0.02, allele “T”) and CPAMN (0.04, allele “C”), respectively (Table S6). Ultimately, the locus TMEM154_D33N has frequencies around 0.15 for the allele “G” in most Santa Inês populations (Table S6). Still, for the UnB-DF and CNPC, the frequencies were 0.44 and 0.33, respectively (χ2, p < 0.05).

4. Discussion

The KASP method was 100% successful, as all designed SNPs were converted into primers and genotyped, and none of the SNPs or samples were eliminated by call rate in this methodology. For the Fluidigm methodology, we designed 13 assays and performed 12 different runs with 96.96 plates, in which each run has to be considered a separate event. Analysis of the entire dataset resulted in the elimination of 2 of the 13 SNPs (TMEM154_L14H and TMEM154_T25I) as they showed call rates <0.75 in 11 of the 12 plates genotyped. The quality filter for samples eliminated 307 samples with a call rate <0.80 in this methodology. This may be due to the high confidence threshold set up for each genotype, >0.90, increasing the accuracy of the results. It is important to mention that the SNP TMEM154_I102T was monomorphic in all breeds genotyped across both methodologies.
The data obtained from Fluidigm and KASP matched 100% with the results from the 50k and HD panels. Additionally, we did not find any differences in the genotypes between the two methodologies, indicating that both Fluidigm and KASP can be reliable alternatives for fast, customized and cost-effective genotyping. Furthermore, it is important to reinforce that the KASP methodology was 100% successful, with no samples or loci eliminated by call rate. However, samples and markers eliminated by call rate (<0.75) in the Fluidigm methodology can be explained by the higher confidence call, and each 96.96 plate genotyped represents a different PCR reaction, considered an independent genotyping event.
Haplotypes encoding (E) glutamate at position 35 of TMEM154 are considered highly susceptible to OPP. In contrast, haplotypes encoding (K) lysine at the same position are considered less susceptible [25]. The high LD we found between the loci OAR17_5388531 and TMEM154_E35K was expected and is in accordance with the results obtained by a previous study [26]. Mainly, we observed a higher frequency of the allele “C” in the breeds genotyped in this study. The highest frequency (100%) was found in the Damara, and the lowest (0.19%) in the Crioula Lanada. The Santa Inês breed is raised across Brazil. Nevertheless, we did not observe a difference in the allele frequencies for the locus OAR17_5388531 among the populations, with a high frequency of the “C” allele in all populations analyzed. A high value of r2 indicates that the SNP OAR17_5388531 can estimate highly susceptible TMEM154 alleles in all the studied populations. OAR17_5388531 can be used as a surrogate to relate the “C” allele with susceptibility, easing the genotyping process for breeders that have already performed it using Illumina® Ovine SNP50 BeadChip or Illumina® Ovine 600K BeadChip. Breed populations with a higher occurrence of the “C” allele are predicted to have a higher frequency of K35 animals, which is associated with a lower susceptibility to the disease [26].
It is expected that distinct Santa Inês populations within the county present differences in allele frequencies, as demonstrated by previous authors with neutral markers [38]. The hypotheses can be raised that geographic distances affect the gene flow and level of admixture of the Santa Inês breed within certain populations [39,40]. For example, Santa Inês belonging to the UnB-DF herd seem to be crossbred with Bergamasca. This was proposed previously, where it was observed that Santa Inês animals from the center-west and southwest are genetically closer to Bergamasca than in other regions [38,39,40,41,42]. We did not find any significant allelic frequency differences among the BBGA, CNPC and CPATC Santa Inês populations. Two facts may explain this: (i) the BBGA is composed mainly of samples that come from the CNPC and CPATC flocks and (ii) both flocks are close geographically speaking, so there is an exchange of germplasm material between them. The same result could be expected for the Morada Nova breed. Despite the large number of animals of this breed, these are concentrated in the northeast region of the country [43], close to the CNPC conservation nuclei.
The selection of animals with favorable haplotypes is crucial to ensure the quality and the genetic variability of the germplasm stored in biobanks. Therefore, results such as those found here, where a single population of a breed has a rare allele or differences in allele frequencies, can aid in the long-term conservation of breed diversity and function as an important resource for breeders.
The TMEM154_I102T variant was observed for the first time in the Santa Inês breed, during resequencing by a previous study [26]. The authors identified the polymorphism in a single animal as a compound heterozygote for this locus. The animal was also heterozygous for the TMEM154_N70I variant. However, in our study, none of the populations presents heterozygous animals for the TMEM154_I102T locus. The TMEM154_N70I locus in the Santa Inês breed has a frequency of 0.6% for the allele “A” and 0.4% for the allele “T”. For the Santa Inês from the CPATC, the frequency was 0.7% for the allele “A” and 0.3% for the allele “T”, indicating heterozygous animals in the flocks. Overall, the allele “T” of the TMEM154_N70I locus has a total frequency of 5.9% in Brazilian sheep and 23.7% in North American sheep. Heaton et al. [26] called the variant TMEM154_I102T based on two reads of nine with high-quality scores, but, here, we could not reproduce the rare genotype found by the authors in any of the Brazilian breeds. We used this variant to test the reproducibility and check if this was an exclusive mutation of the Santa Inês breed.
Heaton et al. [26] defined haplotypes 1 (less susceptible), 2 (susceptible) and 3 (highly susceptible) in the Santa Inês breed. These authors also identified haplotypes 1 and 3 in the Crioula Lanada and Morada Nova breeds, as per the data obtained in the present study. Additionally, haplotype 6, considered rare, was previously observed in the Suffolk breed but not observed in the present study [26]. This might be due to the relatively low sample size used here. This reservation also applies to the following breeds: Bluefaced Leicester, Hog Island, Katahdin and Leicester Longwool, since their sample size is ≤2. Murphy et al. [44] confirmed that animals with diplotype “1”, “1” of the K35 variant of TMEM154 had a reduced incidence of OPP infection, which leads to an improvement in productivity. Furthermore, the author suggests that the selection of sheep with the TMEM154 haplotype “1” in flocks with a high frequency of haplotype “3”, can be a cost-effective alternative to reduce the economic damage caused by OPP. However, further investigation is required to understand the effect of other TMEM154 mutations on the susceptibility to the disease and whether these effects can be extended to multiple breeds.
SRLVs present high genetic variability, contributing to the evolution of multiple viral strains worldwide [45]. MVV-like and CAEV-like strains of SRLVs were primarily considered strictly host-specific for sheep and goats, respectively. However, recent investigations indicated that cross-species transmission events are possible in sheep and goats from Brazilian mixed flocks [46,47]. Ramirez et al. [30] suggest that selection based on TMEM154 is suitable for specific SRLVs strains and ovine breeds. Nonetheless, the same authors propose that generalization to the whole genetic spectrum of Lentiviruses, ovine breeds and epidemiological situation across the globe may need further validation.
Molaee et al. [29] indicate that the association of the SNP TMEM154_E35K with a susceptibility to the disease must be undertaken carefully as, in the Merinoland breed, a high number of KK (less-susceptible genotype) sheep was positive for SRLV. Therefore, follow-up breed-specific studies can be useful to detect new TMEM154 variants associated with the development of MV, as well as to understand the unknown role of already identified markers. Furthermore, other genes such as Ovine-DRB1 can be associated with a susceptibility to MV, implying that studies aimed at understanding other genetic factors involved in the occurrence of SRLVs are crucial [48].
White et al. [18] established an association between the deletion variant ZNF389_ss748775100 and higher proviral concentrations in Rambouillet, Polypay and Columbia sheep from Idaho, US. Conversely, in our study, no breeds genotyped presented the deletion allele, as all populations were homozygous for the insertion “I/I”. According to White et al. [18], animals with this genotype had less than half the adjusted mean proviral concentrations, which could possibly indicate an association with susceptibility to the virus.
Although ZNF389 has been previously associated with MV, further investigation is required to understand the functional importance of this genomic region. Zinc finger proteins (ZFPs) are characteristic DNA binding domains that can be found in a variety of transcription factors [49]. White et al. [18] implicate that ZNF389 plays a biological role related to ovine lentivirus proviral concentration in sheep. The same authors propose that one or more zinc finger genes located in this region can act as a transcriptional regulator of host genes, such as TRIM5a, limiting the proviral replication of the virus [18,50].
The results obtained in this study can be of paramount importance for the Brazilian and American gene banks. For instance, investigation of the ZNF389_ss748775100 deletion variant genotypes, the TMEM154 haplotypes and their frequencies in the breeds can help to select animals with favorable alleles and haplotypes. Nevertheless, gene banks should store all genotypes to facilitate future work on susceptibility and resistance. Consequently, these methodologies can be reliable resources for breeders if MV becomes a threat, thus aiding in the conservation of breed diversity.

5. Conclusions

Overall, haplotypes associated with a lower susceptibility risk to OPP are common in both Brazilian and North American sheep. This suggests an opportunity to reduce Lentivirus susceptibility in multiple sheep breeds using genomic selection. There is a significant difference in the allele frequencies of the TMEM154 mutations among different Santa Inês populations, resulting from the genetic subdivision previously observed in the breed. Contrary to the insertion allele, the ZNF389_ss748775100 deletion variant is associated with higher proviral concentrations in sheep. However, we did not detect the deletion variant in any of the breeds here.
Genetic variability is crucial to ensure the quality of the material stored in conservation centers and gene banks. The results found here of the TMEM154 haplotypes and their frequency suggest a range of genetic variability has been captured by the gene banks. A few breeds showed a lack of variability, which was likely due to a small sample size. Finally, the comparison of the results obtained from the Fluidigm and KASP assays with more robust technologies, such as the 50k and the HD panels, indicate that these methodologies are reliable. Therefore, they can be useful, cost-effective tools to improve genomic selection programs. Further validation is still necessary to understand the unknown role of some of the TMEM154 mutations and the role of other genetic factors associated with the disease.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes14010070/s1. Table S1: Flanking sequences of the TMEM154 SNPs; Table S2: Comparison of 14 and 7 common animals genotypes between Fluidigm and Illumina® Ovine SNP50 and Illumina® Ovine 600K, respectively, on locus OAR17_5388531.1; Table S3: Comparison of 7 and 14 common animals genotypes between KASP and Illumina® Ovine SNP50 and Illumina® Ovine 600K, respectively, on locus OAR17_5388531.1; Table S4: Comparison of 10 common animals genotypes between Fluidigm and Ilumina® Ovine 600K on locus TMEM154_E35K; Table S5: Comparison of 27 common animals genotypes between Fluidigm and KASP on loci TMEM154_E35K, TMEM154_N70I and TMEM154_I102T; Table S6: Chi-square test (p < 0.05) was performed to determine if the differences in the allele frequencies across populations of the Santa Inês breed were statistically significant.

Author Contributions

Conceptualization, S.R.P., A.R.C., C.M. and H.B.; formal analysis, C.S.R., D.A.d.F. and C.M.; methodology, C.S.R., T.S.L., A.R.C. and D.A.d.F.; data curation, C.S.R. and D.A.d.F.; writing—original draft preparation, C.S.R.; writing—review and editing, D.A.d.F., A.R.C., C.M., S.R.P. and H.B.; supervision, S.R.P., A.R.C. and C.M.; project administration, A.R.C.; funding acquisition, A.R.C. and S.R.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Fundação de Apoio à Pesquisa do Distrito Federal—FAPDF. Project number: 0193.001203/2016.

Institutional Review Board Statement

The animal welfare guidelines were approved by the Institutional Animal Care and Use Committee Guidelines of the Embrapa ethics committee (process numbers: CEUA-CPATC 5.05.04.00-2; 06122016.0014; 11102016.0010; CEUA-CNPC 008/2015; 13072016.0006).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data available on request due to restrictions.

Acknowledgments

The authors acknowledge the Coordination for the Improvement of Higher-Level Personnel (CAPES), Brazil; and the Brazilian National Council for Scientific and Technological Development (CNPq), Brazil.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the study design, data collection and analysis, decision to publish or preparation of the manuscript.

References

  1. Kalogianni, A.I.; Bossis, I.; Ekateriniadou, L.V.; Gelasakis, A.I. Etiology, Epizootiology and Control of Maedi-Visna in Dairy Sheep: A Review. Animals 2020, 10, 616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Clawson, M.L.; Redden, R.; Schuller, G.; Heaton, M.P.; Workman, A.; Chitko-McKown, C.G.; Smith, T.P.; Leymaster, K.A. Genetic subgroup of small ruminant lentiviruses that infects sheep homozygous for TMEM154 frameshift deletion mutation A4Δ53. Vet. Res. 2015, 46, 22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Dohoo, I.R.; Heaney, D.P.; Stevenson, R.G.; Samagh, B.S.; Rhodes, C.S. The effects of maedi-visna virus infection on productivity in ewes. Prev. Vet. Med. 1987, 4, 471–484. [Google Scholar] [CrossRef]
  4. Keen, J.E.; Hungerford, L.L.; Littledike, E.T.; Wittum, T.E.; Kwang, J. Effect of ewe ovine lentivirus infection on ewe and lamb productivity. Prev. Vet. Med. 1997, 30, 155–169. [Google Scholar] [CrossRef]
  5. Pétursson, G. Experience with Visna virus in Iceland. Ann. N. Y. Acad. Sci. 1994, 724, 43–49. [Google Scholar] [CrossRef]
  6. Greenwood, P.L.; North, R.N.; Kirkland, P.D. Prevalence, spread and control of caprine arthritis-encephalitis virus in dairy goat herds in New South Wales. Aust. Vet. J. 1995, 72, 341–345. [Google Scholar] [CrossRef]
  7. Motha, M.X.; Ralston, J.C. Evaluation of ELISA for detection of antibodies to CAEV in milk. Vet. Microbiol. 1994, 38, 359–367. [Google Scholar] [CrossRef]
  8. Benavides, J.; Fuertes, M.; García-Pariente, C.; Otaola, J.; Delgado, L.; Giraldez, J.; García Marín, J.F.; Carmen Ferreras, M.; Pérez, V. Impact of maedi-visna in intensively managed dairy sheep. Vet. J. 2013, 197, 607–612. [Google Scholar] [CrossRef]
  9. USDA. Ovine Progressive Pneumonia: Awareness, Management, and Seroprevalence; Animal and Plant Health Inspection Service VS, Centers for Epidemiology and Animal Health: Fort Collins, CO, USA, 2003.
  10. Da Costa, L.S.P.; de Lima, P.P.; Callados, A.K.C.; do Nascimento, S.A.; de Castro, R.S. Lentivírus de pequenos ruminantes em ovinos Santa Inês: Isolamento, identificação pela PCR e inquérito sorológico no estado de Pernambuco. Arq. Inst. Biol. 2007, 74, 11–16. [Google Scholar] [CrossRef]
  11. Souza, T.S.; Costa, J.N.; Martinez, P.; Pinheiro, R.R. Estudo sorológico da Maedi-Visna pelo método de imunodifusão em gel de ágar em rebanhos ovinos de Juazeiro, Bahia, Brasil. Rev. Bras. Saúde Prod. An. 2007, 8, 276–282. [Google Scholar]
  12. Alves, S.M. Seroepidemiological study of maedi-visna in sheep in Ceara, Rio Grande do Norte, Paraíba, and Sergipe States. Semin. Cienc. Agrar. 2018, 39, 2017–2028. [Google Scholar] [CrossRef]
  13. Martinez, P.M.; Costa, J.N.; Souza, T.S.; Lima, C.C.V.; Costa Neto, A.O.; Pinheiro, R.R. Prevalência sorológica da Maedi-Visna em rebanhos ovinos damicrorregião de Juazeiro-Bahia por meio do teste de imunodifusão em gel de ágar. Cienc. Anim. Bras. 2011, 12, 322–329. [Google Scholar]
  14. Fernandes, L.G.; Freitas, F.J.C.; Lima, J.M. Ocorrência de caprinos e ovinos soropositivos para lentivírus provenientes de exposições agropecuárias do Rio Grande do Norte. In Proceedings of the Congresso Brasileiro de Medicina Veterinária, Florianópolis, Brazil, 1–4 November 2011. [Google Scholar]
  15. Dorneles, E.M.S.; Guimarães, A.S.; Gouveia, A.M.G.; Coura, F.M.; Carmo, F.B.; Pauletti, R.B.; Azevedo, V.; Lilenbaum, W.; Vitor, R.W.A.; Pinheiro, R.R. Seroprevalence of Brucella ovis-epididymitis, smooth-Brucella, leptospirosis, toxoplasmosis, and Maedi-Visna in sheep slaughtered in Minas Gerais State, Brazil. Braz. J. Vet. Res. Anim. Sci. 2020, 57, e164278. [Google Scholar] [CrossRef]
  16. Lombardi, A.L.; Nogueira, A.H.C.; Feres, F.C.; Paulo, H.P.; Castro, R.S.; Feitosa, F.L.F.; Cadioli, F.A.; Peiró, J.R.; Perri, S.H.V.; Lima, V.F.M. Soroprevalência de Maedi-Visna em ovinos na região de Araçatuba, SP. Arq. Bras. Med. Vet. Zootec. 2009, 61, 1434–1437. [Google Scholar] [CrossRef]
  17. Barioni, G.; Pereira, L.V.; Beltrame, M.A.V.; Tesoline, P.; Gumieiro, M.V. Soroprevalência de Maedi-Visna em ovinos da raça Santa Inês nos municípios da grande Vitória–ES. Cienc. Anim. Bras. 2009, 1, 579–584. [Google Scholar]
  18. White, S.N.; Mousel, M.R.; Reynolds, J.O.; Herrmann-Hoesing, L.M.; Knowles, D.P. Deletion variant near ZNF389 is associated with control of ovine lentivirus in multiple sheep flocks. Anim. Genet. 2014, 45, 297–300. [Google Scholar] [CrossRef] [Green Version]
  19. White, S.N.; Mousel, M.R.; Reynolds, J.O.; Lewis, G.S.; Herrmann-Hoesing, L.M. Common promoter deletion is associated with 3.9-fold differential transcription of ovine CCR5 and reduced proviral level of ovine progressive pneumonia virus. Anim. Genet. 2009, 40, 583–589. [Google Scholar] [CrossRef]
  20. Sarafidou, T.; Stamatis, C.; Kalozoumi, G.; Spyrou, V.; Fthenakis, G.C.; Billinis, C.; Mamuris, Z. Toll Like Receptor 9 (TLR9) polymorphism G520R in sheep is associated with seropositivity for small ruminant lentivirus. PLoS ONE 2013, 8, e63901. [Google Scholar] [CrossRef]
  21. Herrmann-Hoesing, L.; White, S.N.; Mousel, M.R.; Lewis, G.S.; Knowles, D.P. Ovine progressive pneumonia provirus levels associate with breed and Ovar-DRB1. Immunogenetics 2008, 60, 749–758. [Google Scholar] [CrossRef]
  22. Larruskain, A.; Minguijón, E.; García-Etxebarria, K.; Moreno, B.; Arostegui, I.; Juste, R.A.; Jugo, B.M. MHC class II DRB1 gene polymorphism in the pathogenesis of Maedi–Visna and pulmonary adenocarcinoma viral diseases in sheep. Immunogenetics 2010, 62, 75–83. [Google Scholar] [CrossRef]
  23. White, S.N.; Mousel, M.R.; Herrmann-Hoesing, L.M.; Reynolds, J.O.; Leymaster, K.A.; Neibergs, H.L.; Lewis, G.S.; Knowles, D.P. Genome-Wide Association Identifies Multiple Genomic Regions Associated with Susceptibility to and Control of Ovine Lentivirus. PLoS ONE 2012, 7, e47829. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Cutlip, R.C.; Lehmkuhl, H.D. Eradication of ovine progressive pneumonia from sheep flocks. J. Am. Vet. Med. Assoc. 1986, 188, 1026–1027. [Google Scholar] [PubMed]
  25. Heaton, M.P.; Clawson, M.L.; Chitko-Mckown, C.G.; Leymaster, K.A.; Smith, T.P.; Harhay, G.P.; White, S.N.; Herrmann-Hoesing, L.M.; Mousel, M.R.; Lewis, G.S.; et al. Reduced lentivirus susceptibility in sheep with TMEM154 mutations. PLoS Genet. 2012, 8, e1002467. [Google Scholar] [CrossRef] [PubMed]
  26. Heaton, M.P.; Kalbfleisch, T.S.; Petrik, D.T.; Simpson, B.; Kijas, J.W.; Clawson, M.L.; Chitko-McKown, C.G.; Harhay, G.P.; Leymaster, K.A. Genetic testing for TMEM154 mutations associated with lentivirus susceptibility in sheep. PLoS ONE 2013, 8, 55490. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Yaman, Y.; Keleş, M.; Aymaz, R.; Sevim, S.; Sezenler, T.; Önaldı, A.T.; Kaptan, C.; Başkurt, A.; Koncagül, S.; Öner, Y.; et al. Association of TMEM154 variants with visna/Maedi virus infection in Turkish sheep. Small Rumin. Res. 2019, 177, 61–67. [Google Scholar] [CrossRef]
  28. Molaee, V.; Eltanany, M.; Luhken, G. First survey on association of TMEM154 and CCR5 variants with serological maedi–visna status of sheep in German flocks. Vet. Res. 2018, 49, 36. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Molaee, V.; Otarod, V.; Abdollahi, D.; Luhken, G. Lentivirus susceptibility in Iranian and German sheep assessed by determination of TMEM154 E35K. Animals 2019, 9, 685. [Google Scholar] [CrossRef] [Green Version]
  30. Ramírez, H.; Echeverría, I.; Benito, A.A.; Glaria, I.; Benavides, J.; Pérez, V.; Andrés, D.; Reina, R. Accurate Diagnosis of Small Ruminant Lentivirus Infection Is Needed for Selection of Resistant Sheep through TMEM154 E35K Genotyping. Pathogens 2021, 10, 83. [Google Scholar] [CrossRef] [PubMed]
  31. Paiva, S.R.; McManus, C.M.; Blackburn, H. Conservation of animal genetic resources—A new tact. Livest. Sci. 2016, 193, 32–38. [Google Scholar] [CrossRef]
  32. Zomerdijk, F.; Hiemstra, S.J.; d’Arbaumont, M.; Tixier-Boichard, M.; Boettcher, P. Quality Management Practices of Gene Banks for Livestock: A Global Review. Biopreserv. Biobank. 2020, 18, 244–253. [Google Scholar] [CrossRef]
  33. Friedman, M. The use of ranks to avoid the assumption of normality implicit in the analysis of variance. J. Am. Stat. Assoc. 1937, 32, 675–701. [Google Scholar] [CrossRef]
  34. SNP & Variation Suite™, (Version 8.x) [Software]; Golden Helix, Inc.: Bozeman, MT, USA. Available online: http://www.goldenhelix.com(accessed on 15 November 2019).
  35. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Excoffier, L.; Lischer, H.E. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
  37. Pearson, K. On the criterion that a given system of deviations from the probable in the case of a correlated system of variables is such that it can be reasonably supposed to have arisen from random sampling. Lond. Edinb. Dublin Philos. Mag. J. Sci. 1900, 50, 157–175. [Google Scholar] [CrossRef] [Green Version]
  38. Paiva, S.R.; Silvério, V.C.; Egito, A.A.; McManus, C.; Faria, D.A.; Mariante, A.S.; Castro, S.R.; Albuquerque, M.S.M.; Dergam, J.A. Genetic variability of the Brazilian hair sheep breeds. Pesqui. Agropecu. Bras. 2005, 40, 887–893. [Google Scholar] [CrossRef] [Green Version]
  39. Paim, T.P.; Paiva, S.R.; de Toledo, N.M.; Yamaghishi, M.B.; Carneiro, P.L.S.; Facó, O.; de Araújo, A.M.; Azevedo, H.C.; Caetano, A.R.; Braga, R.M.; et al. Origin and population structure of Brazilian hair sheep breeds. Anim Genet. 2021, 52, 492–504. [Google Scholar] [CrossRef] [PubMed]
  40. McManus, C.; Paiva, S.R.; Caetano, A.R.; Hermuche, P.; Guimarães, R.F.; Carvalho, O.A., Jr.; Braga, R.; Carneiro, P.L.S.; Ferrugem-Moraes, J.; De Souza, C.J.H.; et al. Landscape genetics of sheep in Brazil using SNP markers. Small Rumin. Res. 2020, 192, 106239. [Google Scholar] [CrossRef]
  41. McManus, C.; Paiva, S.R.; Araújo, R.O. Genetics and breeding of sheep in Brazil. Ver. Bras. Zootec. 2010, 39, 236–246. [Google Scholar] [CrossRef]
  42. Carneiro, H.; Louvandini, H.; Paiva, S.R.; Macedo, F.; Mernies, B.; McManus, C. Morphological characterization of sheep breeds in Brazil, Uruguay and Colombia. Small Rumin. Res. 2010, 94, 58–65. [Google Scholar] [CrossRef]
  43. McManus, C.; Facó, O.; Shiotsuki, L.; de Paula Rolo, J.L.J.; Peripolli, V. Pedigree analysis of Brazilian Morada Nova hair sheep. Small Rumin. Res. 2019, 170, 37–42. [Google Scholar] [CrossRef]
  44. Murphy, T.W.; Chitko-McKown, C.G.; Heaton, M.P.; Freking, B.A. Effect of TMEM154 E35K variant (haplotypes 1 and 3) on the incidence of ovine lentivirus infection and ewe productivity during lifetime exposure. J. Anim. Sci. 2021, 99, skab304. [Google Scholar] [CrossRef] [PubMed]
  45. Pasick, J. Maedi–Visna virus and caprine arthritis–encephalitis virus: Distinct species or quasispecies and its implications for laboratory diagnosis. Can. J. Vet. Res. 1998, 62, 241–244. [Google Scholar] [PubMed]
  46. Minardi da Cruz, J.S.; Singh, D.; Lamara, A.; Chebloune, Y. Small ruminant lentiviruses (SRLVs) break the species barrier to acquire new host range. Viruses 2013, 5, 1867–1884. [Google Scholar] [CrossRef] [PubMed]
  47. Braz, G.F.; Heinemann, M.B.; Reis, J.K.P.; Teixeira, B.M.; Cruz, J.C.M.; Rajão, D.S.; Oliveira, F.G.; Alves, F.; Castro, R.S.; Leite, R.C.; et al. Genetic and antigenic characterization of Brazilian SRLV strains: Natural small ruminant interspecies transmission from mixed herds. Infect. Genet. Evol. 2022, 103, 105322. [Google Scholar] [CrossRef] [PubMed]
  48. Yaman, Y.; Bay, V.; Aymaz, R. A novel 2 bp deletion variant in Ovine-DRB1 gene is associated with increased Visna/maedi susceptibility in Turkish sheep. Sci. Rep. 2021, 11, 14435. [Google Scholar] [CrossRef]
  49. Laity, J.H.; Lee, B.M.; Wright, P.E. Zinc finger proteins: New insights into structural and functional diversity. Curr. Opin. Struct. Biol. 2001, 11, 39–46. [Google Scholar] [CrossRef]
  50. Jáuregui, P.; Crespo, H.; Glaria, I.; Luján, L.; Contreras, A.; de Andrés Rosati, S.D.; Amorena, B.; Towers, G.J.; Reina, R. Ovine TRIM5α can restrict visna/maedi virus. J. Virol. 2012, 86, 9504–9509. [Google Scholar] [CrossRef]
Genes 14 00070 g001 550
Figure 1. Frequency of the allele “C” at the locus OAR17_5388531 in Brazilian and North American sheep breeds. The “C” allele is in LD with the “G” allele in the codon 35 (GAA) of the TMEM154 gene. KT—Katahdin; BDAM—Brazilian Damara; SUF—Suffolk; BW—Black Welsh Mountain; BSO—Brazilian Somali; BMN—Brazilian Morada Nova; RA—Rambouillet; PO—Polypay; SC—St. Croix; BTEX—Brazilian Texel; RN—Romanov; BSI—Brazilian Santa Inês; BRL—Brazilian Rabo Largo; BBGA—Brazilian Animal Germplasm Biobank; BSI-CPATC – Brazilian Santa Inês-CPATC; BDOR—Brazilian Dorper; BPT—Brazilian Pantaneiro; BBA—Brazilian Bergamasca; BBN—Brazilian Barriga Negra; BL—Bluefaced Leicester; LL—Leicester Longwool; BB—Barbados Blackbelly; BSUF—Brazilian Suffolk; NA—Navajo Churro; BHA—Brazilian Hampshire; BCR—Brazilian Corriedale; BIF—Brazilian Ile de France; LI—Lincoln; BCL—Brazilian Crioula Lanada; HA—Hampshire; HI—Hog Island.
Figure 1. Frequency of the allele “C” at the locus OAR17_5388531 in Brazilian and North American sheep breeds. The “C” allele is in LD with the “G” allele in the codon 35 (GAA) of the TMEM154 gene. KT—Katahdin; BDAM—Brazilian Damara; SUF—Suffolk; BW—Black Welsh Mountain; BSO—Brazilian Somali; BMN—Brazilian Morada Nova; RA—Rambouillet; PO—Polypay; SC—St. Croix; BTEX—Brazilian Texel; RN—Romanov; BSI—Brazilian Santa Inês; BRL—Brazilian Rabo Largo; BBGA—Brazilian Animal Germplasm Biobank; BSI-CPATC – Brazilian Santa Inês-CPATC; BDOR—Brazilian Dorper; BPT—Brazilian Pantaneiro; BBA—Brazilian Bergamasca; BBN—Brazilian Barriga Negra; BL—Bluefaced Leicester; LL—Leicester Longwool; BB—Barbados Blackbelly; BSUF—Brazilian Suffolk; NA—Navajo Churro; BHA—Brazilian Hampshire; BCR—Brazilian Corriedale; BIF—Brazilian Ile de France; LI—Lincoln; BCL—Brazilian Crioula Lanada; HA—Hampshire; HI—Hog Island.
Genes 14 00070 g001
Table
Table 1. Methodology and number of samples used in the present study according to sheep breed and country of origin.
Table 1. Methodology and number of samples used in the present study according to sheep breed and country of origin.
Breed CodeBreed/GroupCountrynGenotyping Methodology
BBGABrazilian Animal Germplasm Biobank Brazil88Fluidigm
BBNBrazilian Barriga Negra Brazil43Fluidigm
BBABrazilian BergamascaBrazil39Fluidigm
BCRBrazilian CorriedaleBrazil29Fluidigm
BCLBrazilian Crioula Lanada Brazil44Fluidigm
BDAMBrazilian Damara Brazil10Fluidigm
BDORBrazilian Dorper Brazil18Fluidigm
BHABrazilian Hampshire Brazil14Fluidigm
BIFBrazilian Ile de France Brazil39Fluidigm
BMNBrazilian Morada Nova Brazil129Fluidigm
BPTBrazilian Pantaneiro Brazil46Fluidigm
BRLBrazilian Rabo LargoBrazil34Fluidigm
BSIBrazilian Santa Inês Brazil233Fluidigm
BSOBrazilian Somali Brazil37Fluidigm
BSUFBrazilian SuffolkBrazil28Fluidigm
BTEXBrazilian Texel Brazil14Fluidigm
BSIBrazilian Santa Inês-CPATCBrazil484KASP
BBBarbados BlackbellyUSA10KASP
BWBlack Welsh MountainUSA20KASP
BLBluefaced LeicesterUSA1KASP
HAHampshireUSA8KASP
HIHog IslandUSA1KASP
KTKatahdinUSA1KASP
LLLeicester LongwoolUSA2KASP
LILincolnUSA8KASP
NANavajo ChurroUSA17KASP
POPolypayUSA17KASP
RARambouilletUSA70KASP
RNRomanovUSA8KASP
SCSt. CroixUSA23KASP
SUFSuffolkUSA2KASP
Table
Table 2. TMEM154 haplotype frequencies of Brazilian sheep generated by 9 SNPs with the Fluidigm methodology.
Table 2. TMEM154 haplotype frequencies of Brazilian sheep generated by 9 SNPs with the Fluidigm methodology.
Breed/Group 1H1 2H2H3H4H5H6H7H8H9H10H11H12H13H14H15H16H17H18H19H20H21H22H23H24H25Missing Data
BBGA0.170.0630.0110.0110.330.1190.0910.0110.0170.0110.0060.011 0.148
BBN0.1630.14 0.2090.1630.0580.0230.023 0.0120.093 0.116
BBA0.0280.216 0.0880.13 0.115 0.0380.0130.0130.026 0.333
BCR0.2470.424 0.010.128 0.034 0.034 0.122
BCL0.5910.034 0.034 0.1020.011 0.227
BDAM 0.8 0.2
BDOR 0.222 0.278 0.111 0.0280.028 0.333
BHA0.070.250.071 0.04 0.040.04 0.489
BIF0.060.244 0.103 0.026 0.026 0.543
BMN0.030.007 0.7860.0080.039 0.023 0.106
BPT0.391 0.315 0.087 0.12 0.0110.011 0.065
BRL0.1470.115 0.1030.252 0.027 0.011 0.344
BSI0.1150.029 0.210.0760.1730.057 0.0060.011 0.018 0.0080.0080.29
BSO 0.0140.4730.0140.162 0.014 0.324
BSUF0.3570.250.036 0.054 0.089 0.054 0.018 0.143
BTEX 0.143 0.107 0.107 0.036 0.036 0.571
1 Breeds/Groups: BBGA—Brazilian Animal Germplasm Bank; BBN—Brazilian Barriga Negra; BBA—Brazilian Bergamasca; BCR—Brazilian Corriedale; BCL—Brazilian Crioula Lanada; BDAM—Brazilian Damara; BDOR—Brazilian Dorper; BHA—Brazilian Hampshire; BIF—Brazilian Ile de France; BMN—Brazilian Morada Nova; BPT—Brazilian Pantaneiro; BRL—Brazilian Rabo Largo; BSI—Brazilian Santa Inês; BSO—Brazilian Somali; BSUF—Brazilian Suffolk; BTEX—Brazilian Texel. 2 Haplogroups: HN—AQNKTNIEI; HO—AQDKTIFEI; HP—AQDEMNFEI; HQ—AQNKMNFEI; HR—AQNEMIFEI; HS—AQNETNFYΔI—HT—AQNETIFYΔI; HU—AQNETNIYΔI; HV—AQNEMNIYΔI; HW—AQDKTIFYΔI; HX—AQDETNIEI; HY—AQDETIIEI.
Table
Table 3. TMEM154 haplotype frequencies of North American breeds and Brazilian Santa Inês generated by 6 SNPs with the KASP methodology.
Table 3. TMEM154 haplotype frequencies of North American breeds and Brazilian Santa Inês generated by 6 SNPs with the KASP methodology.
Breed 1H1 2H2H3H4
BB0.9000.100
BW0.6000.2000.200
BL 0.500 0.500
HA0.125 0.6250.250
HI1.000
KT1.000
LL1.000
LI1.000
NA0.8520.0580.088
PO0.9700.029
RA0.6020.1910.191
RN 1.000
SC0.5620.1250.187
SUF0.6080.0860.304
BSI (CPATC)0.1490.5180.275
1 Breeds: BB—Barbados Blackbelly; BW—Black Welsh Mountain; BL—Bluefaced Leicester; HA—Hampshire; HI—Hog Island; KT—Katahdin; LL—Leicester Longwool; LI—Lincoln; NA—Navajo Churro; PO—Polypay; RA—Rambouillet; RN—Romanov; SC—St. Croix; SUF—Suffolk; BSI—Brazilian Santa Inês (CPATC). 2 Haplogroups: H1—K N I T; H2—E N I T; H3—E I I T; H4—K I I T.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Rodrigues, C.S.; de Faria, D.A.; Lacerda, T.S.; Paiva, S.R.; Caetano, A.R.; Blackburn, H.; McManus, C. Lentivirus Susceptibility in Brazilian and US Sheep with TMEM154 Mutations. Genes 2023, 14, 70. https://doi.org/10.3390/genes14010070

AMA Style

Rodrigues CS, de Faria DA, Lacerda TS, Paiva SR, Caetano AR, Blackburn H, McManus C. Lentivirus Susceptibility in Brazilian and US Sheep with TMEM154 Mutations. Genes. 2023; 14(1):70. https://doi.org/10.3390/genes14010070

Chicago/Turabian Style

Rodrigues, Camila Souza, Danielle Assis de Faria, Thaísa Sant’Anna Lacerda, Samuel Rezende Paiva, Alexandre Rodrigues Caetano, Harvey Blackburn, and Concepta McManus. 2023. "Lentivirus Susceptibility in Brazilian and US Sheep with TMEM154 Mutations" Genes 14, no. 1: 70. https://doi.org/10.3390/genes14010070

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop