The Evaluation of Vascular Endothelial Growth Factor A (VEGFA) and VEGFR2 Receptor as Prognostic Biomarkers in Bladder Cancer
Abstract
:1. Introduction
2. Material and Methods
2.1. Population Study
2.2. DNA and RNA Extraction
2.3. Evaluation of VEGFA Mutational Status
2.4. Gene Expression Study
2.5. Statistical Analysis
3. Results
3.1. Characteristics of the Study Population
3.2. Distribution of Genotype and Allelic Frequencies of VEGFA Polymorphisms
3.3. Association of VEGFA Polymorphisms and Clinico-Pathological Features of BC Patients
3.4. The Relationship between the VEGFA Expression and Clinico-pathological Parameters of BC Patients
3.5. Association between the VEGFA Genotypes and VEGFA mRNA Expression in BC
3.6. The Relationship between VEGF Receptor (VEGFR1/R2) Expressions and Clinical Pathological Features of BC Patients
3.7. The Evaluation of VEGFA, VEGR1, and VEGFR2 Expressions as a Prognosis Survival Biomarker in BC
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Babjuk, M.; Burger, M.; Zigeuner, R.; Shariat, S.F.; van Rhijn, B.W.G.; Compérat, E.; Sylvester, R.J.; Kaasinen, E.; Böhle, A.; Palou Redorta, J.; et al. EAU Guidelines on Non-Muscle-Invasive Urothelial Carcinoma of the Bladder: Update 2013. Eur. Urol. 2013, 64, 639–653. [Google Scholar] [CrossRef] [PubMed]
- Rouprêt, M.; Neuzillet, Y.; Masson-Lecomte, A.; Colin, P.; Compérat, E.; Dubosq, F.; Houédé, N.; Larré, S.; Pignot, G.; Puech, P.; et al. Recommandations en onco-urologie 2016–2018 du CCAFU: Tumeurs de la vessie. Progrès Urol. 2016, 27, S67–S91. [Google Scholar] [CrossRef] [PubMed]
- Bolenz, C.; Lotan, Y. Molecular Biomarkers for Urothelial Carcinoma of the Bladder: Challenges in Clinical Use. Nat. Clin. Pract. Urol. 2008, 5, 676–685. [Google Scholar] [CrossRef]
- Zaravinos, A.; Volanis, D.; Lambrou, G.I.; Delakas, D.; Spandidos, D.A. Role of the Angiogenic Components, VEGFA, FGF2, OPN and RHOC, in Urothelial Cell Carcinoma of the Urinary Bladder. Oncol. Rep. 2012, 28, 1159–1166. [Google Scholar] [CrossRef]
- Chen, C.-H.; Ho, C.-H.; Huang, S.K.-H.; Shen, C.-H.; Wu, C.-C.; Wang, Y.-H. Association between VEGF Gene Promoter Polymorphisms and Bladder Cancer: An Updated Meta-Analysis. Cytokine 2020, 131, 155112. [Google Scholar] [CrossRef]
- Skirnisdottir, I.; Seidal, T.; Åkerud, H. The Relationship of the Angiogenesis Regulators VEGF-A, VEGF-R1 and VEGF-R2 to P53 Status and Prognostic Factors in Epithelial Ovarian Carcinoma in FIGO-Stages I–II. Int. J. Oncol. 2016, 48, 998–1006. [Google Scholar] [CrossRef]
- Chen, J.-B.; Zhang, M.; Cui, Y.; Liu, P.-H.; Qi, Y.-W.; Li, C.; Cheng, X.; Ren, W.-B.; Li, Q.-Q.; Liu, L.-F.; et al. Association Between 12 Polymorphisms of VEGF/Hypoxia/Angiogenesis Pathway Genes and Risk of Urogenital Carcinomas: A Meta-Analysis Based on Case-Control Studies. Front. Physiol. 2018, 9, 715. [Google Scholar] [CrossRef]
- Chen, J.; Sun, M.; Zhou, M.; Lu, R. Associations between I/D Polymorphism in the ACE Gene and Lung Cancer: An Updated Systematic Review and a Meta-Analysis. BMC Cancer 2021, 21, 158. [Google Scholar] [CrossRef]
- Siregar, G.P. Vascular Endothelial Growth Factor Polymorphism in Bladder Cancer: A Review. Open Access Maced. J. Med. Sci. 2020, 8, 31–36. [Google Scholar] [CrossRef]
- Kopparapu, P.K.; Boorjian, S.A.; Robinson, B.D.; Downes, M.; Gudas, L.J.; Mongan, N.P.; Persson, J.L. Expression of VEGF and Its Receptors VEGFR1/VEGFR2 Is Associated with Invasiveness of Bladder Cancer. Anticancer Res. 2013, 33, 2381–2390. [Google Scholar] [PubMed]
- van Rhijn, B.W.G.; Hentschel, A.E.; Bründl, J.; Compérat, E.M.; Hernández, V.; Čapoun, O.; Bruins, H.M.; Cohen, D.; Rouprêt, M.; Shariat, S.F.; et al. Prognostic Value of the WHO1973 and WHO2004/2016 Classification Systems for Grade in Primary Ta/T1 Non–Muscle-Invasive Bladder Cancer: A Multicenter European Association of Urology Non–Muscle-Invasive Bladder Cancer Guidelines Panel Study. Eur. Urol. Oncol. 2021, 4, 182–191. [Google Scholar] [CrossRef] [PubMed]
- Sambrook, J.; Fritsch, E.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press, Cold Spring Harbor: New York, NY, USA, 1989. [Google Scholar]
- Kim, Y.-J.; Chung, W.C.; Jun, K.-H.; Chin, H.-M. Genetic Polymorphisms of Vascular Endothelial Growth Factor (VEGF) Associated with Gastric Cancer Recurrence after Curative Resection with Adjuvant Chemotherapy. BMC Cancer 2019, 19, 483. [Google Scholar] [CrossRef]
- Dobruch, J.; Daneshmand, S.; Fisch, M.; Lotan, Y.; Noon, A.P.; Resnick, M.J.; Shariat, S.F.; Zlotta, A.R.; Boorjian, S.A. Gender and Bladder Cancer: A Collaborative Review of Etiology, Biology, and Outcomes. Eur. Urol. 2016, 69, 300–310. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Yang, Y.; Liu, L.; Liu, X. Association between Five Polymorphisms in Vascular Endothelial Growth Factor Gene and Urinary Bladder Cancer Risk: A Systematic Review and Meta-Analysis Involving 6671 Subjects. Gene 2019, 698, 186–197. [Google Scholar] [CrossRef] [PubMed]
- Zhai, R.; Liu, G.; Asomaning, K.; Su, L.; Kulke, M.H.; Heist, R.S.; Nishioka, N.S.; Lynch, T.J.; Wain, J.C.; Lin, X.; et al. Genetic Polymorphisms of VEGF, Interactions with Cigarette Smoking Exposure and Esophageal Adenocarcinoma Risk. Carcinogenesis 2008, 29, 2330–2334. [Google Scholar] [CrossRef]
- Fukuda, H.; Tsuchiya, N.; Narita, S.; Kumazawa, T.; Horikawa, Y.; Inoue, T.; Saito, M.; Yuasa, T.; Matsuura, S.; Satoh, S.; et al. Clinical Implication of Vascular Endothelial Growth Factor T-460C Polymorphism in the Risk and Progression of Prostate Cancer. Oncol. Rep. 2007, 18, 1155–1163. [Google Scholar] [PubMed]
- Jaiswal, P.K.; Tripathi, N.; Shukla, A.; Mittal, R.D. Association of Single Nucleotide Polymorphisms in Vascular Endothelial Growth Factor Gene with Bladder Cancer Risk. Med. Oncol. 2013, 30, 509. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.-J.; Jeong, P.; Quan, C.; Kim, J.; Bae, S.-C.; Yoon, S.J.; Kang, J.-W.; Lee, S.-C.; Wee, J.J.; Kim, W.-J. Genotypes of TNF-Alpha, VEGF, HOGG1, GSTM1, and GSTT1: Useful Determinants for Clinical Outcome of Bladder Cancer. Urology 2005, 65, 70–75. [Google Scholar] [CrossRef]
- Ben Wafi, S.; Kallel, A.; Ben Fradj, M.K.; Sallemi, A.; Ben Rhouma, S.; Ben Halima, M.; Sanhaji, H.; Nouira, Y.; Jemaa, R.; Feki, M. Haplotype-based Association of Vascular Endothelial Growth Factor Gene Polymorphisms with Urothelial Bladder Cancer Risk in Tunisian Population. J. Clin. Lab. Anal. 2018, 32, e22610. [Google Scholar] [CrossRef]
- Yuan, Q.; Zuo, X.; Jia, J. Association between Promoter Polymorphisms of Vascular Endothelial Growth Factor Gene and Sporadic Alzheimer’s Disease among Northern Chinese Han. Neurosci. Lett. 2009, 457, 133–136. [Google Scholar] [CrossRef] [PubMed]
- Inoue, K.; Slaton, J.W.; Karashima, T.; Yoshikawa, C.; Shuin, T.; Sweeney, P.; Millikan, R.; Dinney, C.P. The Prognostic Value of Angiogenesis Factor Expression for Predicting Recurrence and Metastasis of Bladder Cancer after Neoadjuvant Chemotherapy and Radical Cystectomy. Clin. Cancer Res. 2000, 6, 4866–4873. [Google Scholar] [PubMed]
- Poyet, C.; Thomas, L.; Benoit, T.M.; Delmo, D.A.; Luberto, L.; Banzola, I.; Günthart, M.S.; Sais, G.; Eberli, D.; Sulser, T.; et al. Implication of Vascular Endothelial Growth Factor A and C in Revealing Diagnostic Lymphangiogenic Markers in Node-Positive Bladder Cancer. Oncotarget 2017, 8, 21871–21883. [Google Scholar] [CrossRef] [PubMed]
Analysis | Forward Primer 5′–3′ | Reverse Primer 5′–3′ |
---|---|---|
VEGFA mutational status | ||
rs833061 rs699947 and rs35569394 | TGTGCAGACGGCAGTCACTA | CCCGCTACCAGCCGACTTT |
ATAAGGGCCTTAGGACACCA | GCTACTTCTCCAGGCTCACA | |
VEGFA and VEGFR1/R2 expression analyses | ||
B2M expression | GAGGCTATCCAGCGTACTCCA | CGGCAGGCATACTCATCTTTT |
VEGFA expression | AGGGCAGAATCATCACGAAGT | AGGGTCTCGATTGGATGGCA |
VEGFR1 expression | GAAAACGCATAATCTGGGACAGT | GCGTGGTGTGCTTATTTGGA |
VEGFR2 expression | GTGATCGGAAATGACACTGGAG | CATGTTGGTCACTAACAGAAGCA |
Parameter | Total Cases | Percentage (%) |
---|---|---|
Gender | ||
Male | 68 | 97.1 |
Female | 2 | 2.9 |
Age | ||
<50 | 1 | 1.4 |
50–70 | 44 | 62.9 |
>70 | 25 | 35.7 |
Smoking | ||
Yes | 28 | 40 |
No | 42 | 60 |
Stage | ||
≤PT1 | 52 | 74.3 |
>PT1 | 18 | 25.7 |
Grade | ||
Low grade | 27 | 38.6 |
High grade | 43 | 61.4 |
Recurrence | ||
Yes | 12 | 23.1 |
No | 40 | 76.9 |
Progression | ||
Yes | 5 | 9.6 |
No | 47 | 90.4 |
Genotypes | −460 T/C | Genotypes | −2578 C/A | Genotypes | −2549 I/D | |||
---|---|---|---|---|---|---|---|---|
N | % | N | % | N | % | |||
CC | 36 | 51.4 | AA | 22 | 31.4 | II | 23 | 32.9 |
CT | 15 | 27.2 | AC | 29 | 41.4 | ID | 25 | 35.7 |
TT | 19 | 21.4 | CC | 19 | 27.2 | DD | 22 | 31.4 |
Alleles | −460 T/C | Alleles | −2578 C/A | Alleles | −2549 I/D | |||
N | % | N | % | N | % | |||
C | 87 | 62.1 | A | 73 | 52.1 | I | 71 | 50.7 |
T | 53 | 37.9 | C | 67 | 47.9 | D | 69 | 49.3 |
Variable | Disease-Free Survival | Overall Survival | ||||||
---|---|---|---|---|---|---|---|---|
Univariate | Multivariate | Univariate | Multivariate | |||||
HR (95% CI) | p-Value | HR (95% CI) | p-Value | HR (95% CI) | p-Value | HR (95% CI) | p-Value | |
VEGFA expression | 1.72 (1.03–2.88) | 0.01 | 1.74 (1.038–2.93) | 0.02 | 1.83 (1.1–3.1) | 0.009 | 1.87 (1.12–3.14) | 0.001 |
VEGFR1 expression | 1.18 (0.70–1.99) | 0.53 | - | - | 1.2 (0.71–2.03) | 0.49 | - | - |
VEGFR2 expression | 0.70 (0.39–1.27) | 0.24 | - | - | 0.69 (0.38–1.24) | 0.21 | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
El Azzouzi, M.; El Ahanidi, H.; Hafidi Alaoui, C.; Chaoui, I.; Benbacer, L.; Tetou, M.; Hassan, I.; Bensaid, M.; Oukabli, M.; Ameur, A.; et al. The Evaluation of Vascular Endothelial Growth Factor A (VEGFA) and VEGFR2 Receptor as Prognostic Biomarkers in Bladder Cancer. Diagnostics 2023, 13, 1471. https://doi.org/10.3390/diagnostics13081471
El Azzouzi M, El Ahanidi H, Hafidi Alaoui C, Chaoui I, Benbacer L, Tetou M, Hassan I, Bensaid M, Oukabli M, Ameur A, et al. The Evaluation of Vascular Endothelial Growth Factor A (VEGFA) and VEGFR2 Receptor as Prognostic Biomarkers in Bladder Cancer. Diagnostics. 2023; 13(8):1471. https://doi.org/10.3390/diagnostics13081471
Chicago/Turabian StyleEl Azzouzi, Meryem, Hajar El Ahanidi, Chaimae Hafidi Alaoui, Imane Chaoui, Laila Benbacer, Mohammed Tetou, Ilias Hassan, Mounia Bensaid, Mohamed Oukabli, Ahmed Ameur, and et al. 2023. "The Evaluation of Vascular Endothelial Growth Factor A (VEGFA) and VEGFR2 Receptor as Prognostic Biomarkers in Bladder Cancer" Diagnostics 13, no. 8: 1471. https://doi.org/10.3390/diagnostics13081471