Association between the Polymorphisms of fads2a and fads2b and Poly-Unsaturated Fatty Acids in Common Carp (Cyprinus carpio)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Sampling
2.3. RNA Extraction, cDNA Synthesis, Sequencing, and Genotyping
2.4. Genetic Diversities of Common Carp fads2a and fads2b
2.5. Measuring the Contents of 12 PUFAs in Common Carp
2.6. PUFA Content Comparison
2.7. Associations of Polymorphisms in fads2a and fads2b with the Contents of 12 PUFAs
3. Results
3.1. Genotyping Common Carp fads2a and fads2b
3.2. Genetic Diversities of fads2a and fads2b
3.3. Diversities of PUFA Contents in Common Carp
3.4. Three cSNPs Associated with the PUFA Contents
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gow, R.V.; Hibbeln, J.R. Omega-3 fatty acid and nutrient deficits in adverse neurodevelopment and childhood behaviors. Child Adolesc. Psychiatr. Clin. N. Am. 2014, 23, 555–590. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Katalin Nagy, I.-D.T. Importance of Fatty Acids in Physiopathology of Human Body; IntechOpen: London, UK, 2017. [Google Scholar] [CrossRef] [Green Version]
- Lands, B. Highly unsaturated fatty acids (HUFA) mediate and monitor food’s impact on health. Prostaglandins Other Lipid Mediat. 2017, 133, 4–10. [Google Scholar] [CrossRef]
- Rennison, J.H.; Van Wagoner, D.R. Impact of dietary fatty acids on cardiac arrhythmogenesis. Circ. Arrhythm. Electrophysiol. 2009, 2, 460–469. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monroig, O.; Rotllant, J.; Sanchez, E.; Cerda-Reverter, J.M.; Tocher, D.R. Expression of long-chain polyunsaturated fatty acid (LC-PUFA) biosynthesis genes during zebrafish Danio rerio early embryogenesis. Biochim. Biophys. Acta 2009, 1791, 1093–1101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monroig, Ó.; Tocher, D.R.; Hontoria, F.; Navarro, J.C. Functional characterisation of a Fads2 fatty acyl desaturase with Δ6/Δ8 activity and an Elovl5 with C16, C18 and C20 elongase activity in the anadromous teleost meagre (Argyrosomus regius). Aquaculture 2013, 412, 14–22. [Google Scholar] [CrossRef]
- Hastings, N.; Agaba, M.; Tocher, D.R.; Leaver, M.J.; Dick, J.R.; Sargent, J.R.; Teale, A.J. A vertebrate fatty acid desaturase with Delta 5 and Delta 6 activities. Proc. Natl. Acad. Sci. USA 2001, 98, 14304–14309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monroig, O.; Tocher, D.R.; Navarro, J.C. Biosynthesis of polyunsaturated fatty acids in marine invertebrates: Recent advances in molecular mechanisms. Mar. Drugs 2013, 11, 3998–4018. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monroig, O.; Zheng, X.; Morais, S.; Leaver, M.J.; Taggart, J.B.; Tocher, D.R. Multiple genes for functional 6 fatty acyl desaturases (Fad) in Atlantic salmon (Salmo salar L.): Gene and cDNA characterization, functional expression, tissue distribution and nutritional regulation. Biochim. Biophys. Acta 2010, 1801, 1072–1081. [Google Scholar] [CrossRef]
- Agaba, M.; Tocher, D.R.; Dickson, C.A.; Dick, J.R.; Teale, A.J. Zebrafish cDNA encoding multifunctional Fatty Acid elongase involved in production of eicosapentaenoic (20:5n-3) and docosahexaenoic (22:6n-3) acids. Mar. Biotechnol 2004, 6, 251–261. [Google Scholar] [CrossRef]
- Castro, L.F.C.; Tocher, D.R.; Monroig, O. Long-chain polyunsaturated fatty acid biosynthesis in chordates: Insights into the evolution of Fads and Elovl gene repertoire. Prog. Lipid Res. 2016, 62, 25–40. [Google Scholar] [CrossRef]
- Monroig, O.; Li, Y.; Tocher, D.R. Delta-8 desaturation activity varies among fatty acyl desaturases of teleost fish: High activity in delta-6 desaturases of marine species. Comp. Biochem. Physiol. Part B 2011, 159, 206–213. [Google Scholar] [CrossRef]
- Oboh, A.; Kabeya, N.; Carmona-Antonanzas, G.; Castro, L.F.C.; Dick, J.R.; Tocher, D.R.; Monroig, O. Two alternative pathways for docosahexaenoic acid (DHA, 22:6n-3) biosynthesis are widespread among teleost fish. Sci. Rep. 2017, 7, 3889. [Google Scholar] [CrossRef] [PubMed]
- Zheng, X.; Seiliez, I.; Hastings, N.; Tocher, D.R.; Panserat, S.; Dickson, C.A.; Bergot, P.; Teale, A.J. Characterization and comparison of fatty acyl Delta6 desaturase cDNAs from freshwater and marine teleost fish species. Comp. Biochem. Physiol. Part B 2004, 139, 269–279. [Google Scholar] [CrossRef]
- Ferosekhan, S.; Turkmen, S.; Xu, H.; Afonso, J.M.; Zamorano, M.J.; Kaushik, S.; Izquierdo, M. The relationship between the expression of fatty acyl desaturase 2 (Fads2) gene in peripheral blood cells (pbcs) and liver in gilthead seabream, sparus aurata broodstock fed a low n-3 lc-pufa diet. Life 2020, 10, 117. [Google Scholar] [CrossRef]
- Ganguly, S.; Mitra, T.; Mahanty, A.; Mohanty, S.; Mohanty, B.P. A comparative metabolomics study on anadromous clupeid Tenualosa ilisha for better understanding the influence of habitat on nutritional composition. Metabolomics 2020, 16, 30. [Google Scholar] [CrossRef] [PubMed]
- Gol, S.; Pena, R.N.; Rothschild, M.F.; Tor, M.; Estany, J. A polymorphism in the fatty acid desaturase-2 gene is associated with the arachidonic acid metabolism in pigs. Sci. Rep. 2018, 8, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Proskura, W.S.; Liput, M.; Zaborski, D.; Sobek, Z.; Yu, Y.H.; Cheng, Y.H.; Dybus, A. The effect of polymorphism in the FADS2 gene on the fatty acid composition of bovine milk. Arch. Anim. Breed. 2019, 62, 547–555. [Google Scholar] [CrossRef] [PubMed]
- Renaville, B.; Tulli, F.; Bruno, M.; Tibaldi, E.; Messina, M. Fatty acid desaturase 2 (FADS2) insertion/deletion polymorphism impact on muscle fatty acid profile in European grayling (Thymallus thymallus). Br. J. Nutr. 2013, 110, 1559–1564. [Google Scholar] [CrossRef] [Green Version]
- Schaeffer, L.; Gohlke, H.; Müller, M.; Heid, I.M.; Palmer, L.J.; Kompauer, I.; Demmelmair, H.; Illig, T.; Koletzko, B.; Heinrich, J. Common genetic variants of the FADS1 FADS2 gene cluster and their reconstructed haplotypes are associated with the fatty acid composition in phospholipids. Hum. Mol. Genet. 2006, 15, 1745–1756. [Google Scholar] [CrossRef]
- Xu, P.; Zhang, X.; Wang, X.; Li, J.; Liu, G.; Kuang, Y.; Xu, J.; Zheng, X.; Ren, L.; Wang, G.; et al. Genome sequence and genetic diversity of the common carp, Cyprinus carpio. Nat. Genet. 2014, 46, 1212–1219. [Google Scholar] [CrossRef] [Green Version]
- Xu, P.; Xu, J.; Liu, G.; Chen, L.; Zhou, Z.; Peng, W.; Jiang, Y.; Zhao, Z.; Jia, Z.; Sun, Y.; et al. The allotetraploid origin and asymmetrical genome evolution of the common carp Cyprinus carpio. Nat. Commun. 2019, 10, 4625. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ren, H.T.; Zhang, G.Q.; Li, J.L.; Tang, Y.K.; Li, H.X.; Yu, J.H.; Xu, P. Two Delta6-desaturase-like genes in common carp (Cyprinus carpio var. Jian): Structure characterization, mRNA expression, temperature and nutritional regulation. Gene 2013, 525, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Qin, Z.; Chang-yi, Q.; Jian-xin, F. Analysis of Fatty Acid Content in Edible Tissues of HuangheCommon Carp and Songpu Mirror Carp. Acta Agric. Jiangxi 2015, 27, 85–87. [Google Scholar] [CrossRef]
- Exadactylos, A.; Arvanitoyannis, I. Aquaculture Biotechnology for enhanced fish production for human consumption. Microb. Biotechnol. Agric. Aquac. 2006, 2, 453–510. [Google Scholar]
- Kavouras, M.; Malandrakis, E.; Danis, T.; Blom, E.; Anastassiadis, K.; Panagiota, P.; Exadactylos, A. Hox Genes Polymorphism Depicts Developmental Disruption of Common Sole Eggs. Open Life Sci. 2019, 14, 549–563. [Google Scholar] [CrossRef]
- Martsikalis, P.V.; Gkafas, G.; Palaiokostas, C.; Exadactylos, A. Genomics Era on Breeding Aquaculture Stocks. In Organic Aquaculture; Springer: Cham, Switzerland, 2019. [Google Scholar] [CrossRef]
- Weckx, S.; Del-Favero, J.; Rademakers, R.; Claes, L.; Cruts, M.; De Jonghe, P.; Van Broeckhoven, C.; De Rijk, P. novoSNP, a novel computational tool for sequence variation discovery. Genome Res. 2005, 15, 436–442. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bradbury, P.; Zhang, Z.; Kroon, D.; Casstevens, T.; Ramdoss, Y.; Buckler, E. TASSEL: Software for association mapping of complex traits in diverse samples. Bioinformatics 2007, 23, 2633–2635. [Google Scholar] [CrossRef]
- Alexander, D.H.; Novembre, J.; Lange, K. Fast model-based estimation of ancestry in unrelated individuals. Genome Res. 2009, 19, 1655–1664. [Google Scholar] [CrossRef] [Green Version]
- Francis, R.M. pophelper: An R package and web app to analyse and visualize population structure. Mol. Ecol. Resour. 2017, 17, 27–32. [Google Scholar] [CrossRef] [Green Version]
- Dereeper, A.; Nicolas, S.; Le Cunff, L.; Bacilieri, R.; Doligez, A.; Peros, J.P.; Ruiz, M.; This, P. SNiPlay: A web-based tool for detection, management and analysis of SNPs. Application to grapevine diversity projects. BMC Bioinform. 2011, 12, 134. [Google Scholar] [CrossRef] [Green Version]
- Nagy, S.; Poczai, P.; Cernák, I.; Gorji, A.M.; Hegedűs, G.; Taller, J. PICcalc: An online program to calculate polymorphic information content for molecular genetic studies. Biochem. Genet. 2012, 50, 670–672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Monroig, O.; Zhang, L.; Wang, S.; Zheng, X.; Dick, J.R.; You, C.; Tocher, D.R. Vertebrate fatty acyl desaturase with Delta4 activity. Proc. Natl. Acad. Sci. USA 2010, 107, 16840–16845. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
- Liu, C.; Zhou, Y.; Zhang, X.; Zhang, J.; Zhou, Z.; Weng, J.; Li, X.; Wang, Z. Natural variation in the THICK TASSEL DWARF1 (TD1) gene in the regulation of maize (Zea mays L.) ear-related traits. Breed. Sci. 2019, 69, 323–331. [Google Scholar] [CrossRef] [Green Version]
- Quan, M.; Xiao, L.; Lu, W.; Liu, X.; Song, F.; Si, J.; Du, Q.; Zhang, D. Association Genetics in Populus Reveal the Allelic Interactions of Pto-MIR167a and Its Targets in Wood Formation. Front. Plant Sci. 2018, 9, 744. [Google Scholar] [CrossRef]
- Ur Rehman, S.; Wang, J.; Chang, X.; Zhang, X.; Mao, X.; Jing, R. A wheat protein kinase gene TaSnRK2.9-5A associated with yield contributing traits. Appl. Genet. 2019, 132, 907–919. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Purcell, S.; Neale, B.; Todd-Brown, K.; Thomas, L.; Ferreira, M.A.; Bender, D.; Maller, J.; Sklar, P.; de Bakker, P.I.; Daly, M.J.; et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 2007, 81, 559–575. [Google Scholar] [CrossRef] [Green Version]
- Shin, J.-H.; Blay, S.; McNeney, B.; Graham, J. LDheatmap: An R Function for Graphical Display of Pairwise Linkage Disequilibria between Single Nucleotide Polymorphisms. J. Stat. Softw. 2006, 16, 9. [Google Scholar] [CrossRef] [Green Version]
- Exadactylos, A. Nutrigenomics in Aquaculture Research. Fish. Aquac. J. 2014, 5, e107. [Google Scholar] [CrossRef] [Green Version]
- Psofakis, P.; Karapanagiotidis, I.; Malandrakis, E.; Golomazou, E.; Exadactylos, A.; Mente, E. Effect of fishmeal replacement by hydrolyzed feather meal on growth performance, proximate composition, digestive enzyme activity, haematological parameters and growth-related gene expression of gilthead seabream (Sparus aurata). Aquaculture 2020, 521, 735006. [Google Scholar] [CrossRef]
- Yoshizaki, G.; Kiron, V.; Satoh, S.; Takeuchi, T. Expression of masu salmon Delta 5-desaturase-like gene elevated EPA and DHA biosynthesis in zebrafish. Mar. Biotechnol. 2007, 9, 92–100. [Google Scholar] [CrossRef]
- He, Z.; Zhang, R.; Jiang, F.; Zhang, H.; Zhao, A.; Xu, B.; Jin, L.; Wang, T.; Jia, W.; Jia, W.; et al. FADS1-FADS2 genetic polymorphisms are associated with fatty acid metabolism through changes in DNA methylation and gene expression. Clin. Epigenet. 2018, 10, 113. [Google Scholar] [CrossRef] [PubMed]
- Walle, P.; Mannisto, V.; de Mello, V.D.; Vaittinen, M.; Perfilyev, A.; Hanhineva, K.; Ling, C.; Pihlajamaki, J. Liver DNA methylation of FADS2 associates with FADS2 genotype. Clin. Epigenet. 2019, 11, 10, Correction in 2019, 11, 47, doi:10.1186/s13148-019-0625-1. [Google Scholar] [CrossRef]
- Gardiner-Garden, M.; Frommer, M. CpG islands in vertebrate genomes. J. Mol. Biol. 1987, 196, 261–282. [Google Scholar] [CrossRef]
- Exadactylos, A.; Malandrakis, E.; Panagiota, P.; Geffen, A. The development of size variation in Dover sole, Solea solea and turbot, Scophthalmus maximus: Genetic variability between different geographical and among year class farmed strains. Aquac. Res. 2013, 44, 1912–1925. [Google Scholar] [CrossRef]
- Steer, C.D.; Hibbeln, J.R.; Golding, J.; Davey Smith, G. Polyunsaturated fatty acid levels in blood during pregnancy, at birth and at 7 years: Their associations with two common FADS2 polymorphisms. Hum. Mol. Genet. 2012, 21, 1504–1512. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer Sequence (5′-3′) | Accession No. | Tm | Amplification Length (bp) |
---|---|---|---|---|
fads2a | F: CAGAGTTTGATCAGTTATGGGCG | MK852165 | 56 °C | 1348 |
R: TTTGTTGAGGTACGCATCCAGC | ||||
fads2b | F: ATGGGTGGCGGAGGACAGCAG | MK852166 | 62 °C | 1324 |
R: GTACGCATCCAGCCAGATTTCTCC |
dbSNP | Position/Exon | Ref/Alt | Ho | He | PIC | MAF | Genotype | Frequencies of Genotypes | Amino Acid Change |
---|---|---|---|---|---|---|---|---|---|
Fads2a.288 | 288/2 | G/T | 0.1 | 0.09 | 0.09 | 0.05 | GG | 0.9 | |
AG | 0.1 | ||||||||
Fads2a.408 | 408/3 | T/C | 0.26 | 0.25 | 0.22 | 0.15 | TT | 0.72 | |
CC | 0.02 | ||||||||
CT | 0.26 | ||||||||
Fads2a.502 | 502/3 | A/G | 0.51 | 0.4 | 0.32 | 0.28 | AA | 0.46 | M-L |
CC | 0.03 | ||||||||
AC | 0.51 | ||||||||
Fads2a.561 | 561/4 | C/A | 0.3 | 0.29 | 0.25 | 0.18 | GG | 0.67 | |
CC | 0.03 | ||||||||
CG | 0.3 | ||||||||
Fads2a.624 | 624/5 | G/A | 0.43 | 0.32 | 0.27 | 0.2 | GG | 0.55 | |
AA | 0.02 | ||||||||
AG | 0.43 | ||||||||
Fads2b.128 | 128/1 | T/G | 0.19 | 0.17 | 0.15 | 0.09 | TT | 0.81 | V-G |
GT | 0.19 | ||||||||
Fads2b.169 | 169/1 | C/A | 0.3 | 0.33 | 0.28 | 0.21 | CC | 0.64 | Y-H |
AA | 0.06 | ||||||||
AC | 0.3 | ||||||||
Fads2b.222 | 222/2 | G/A | 0.15 | 0.45 | 0.35 | 0.33 | AA | 0.59 | |
GG | 0.26 | ||||||||
AG | 0.15 | ||||||||
Fads2b.235 | 235/2 | A/C | 0.16 | 0.44 | 0.34 | 0.33 | CC | 0.59 | |
AA | 0.25 | ||||||||
AC | 0.16 | ||||||||
Fads2b.288 | 288/2 | A/G | 0.34 | 0.5 | 0.37 | 0.47 | AA | 0.36 | L-M |
GG | 0.3 | ||||||||
AG | 0.34 | ||||||||
Fads2b.291 | 291/2 | T/C | 0.38 | 0.48 | 0.36 | 0.4 | TT | 0.41 | I-L |
CC | 0.21 | ||||||||
CT | 0.38 | ||||||||
Fads2b.357 | 357/3 | T/C | 0.35 | 0.49 | 0.37 | 0.45 | TT | 0.37 | |
CC | 0.28 | ||||||||
CT | 0.35 | ||||||||
Fads2b.552 | 552/4 | T/C | 0.13 | 0.13 | 0.12 | 0.07 | TT | 0.86 | H-Q |
CC | 0.01 | ||||||||
CT | 0.13 | ||||||||
Fads2b.751 | 751/6 | G/A | 0.1 | 0.1 | 0.1 | 0.05 | GG | 0.9 | V-I |
AG | 0.1 | ||||||||
Fads2b.916 | 916/8 | T/C | 0.02 | 0.34 | 0.28 | 0.22 | TT | 0.77 | |
CC | 0.21 | ||||||||
CT | 0.02 | ||||||||
Fads2b.1197 | 1197/11 | C/T | 0.08 | 0.07 | 0.07 | 0.04 | CC | 0.92 | |
CT | 0.08 |
n-3 PUFA | Composition (%) | n-6 PUFA | Composition (%) |
---|---|---|---|
18:3n-3 | 0.98 ± 0.88 | 18:2n-6 | 24.33 ± 11.03 |
18:4n-3 | 0.1 ± 0.19 | 18:3n-6 | 6.36 ± 6.75 |
20:3n-3 | 0.32 ± 0.48 | 20:3n-6 | 2.85 ± 1.74 |
20:4n-3 | 0.29 ± 0.15 | 20:4n-6 | 8.17 ± 4.96 |
20:5n-3 | 3.39 ± 2.21 | 22:4n-6 | 0.67 ± 0.39 |
22:5n-3 | 1.69 ± 0.99 | 22:5n-6 | 2.37 ± 1.84 |
Total | 6.76 ± 3.58 | Total | 44.68 ± 16.81 |
Trait | SNP | MLM (PCA + K) | ANOVA | |||
---|---|---|---|---|---|---|
PUFA | ID | p Value | Marker R2 (%) | Genotype | FDR p Value | |
MM | Mm | |||||
Fads2a | ||||||
C20:3n-6 | fads2a.624 | 2.50 × 10−2 | 4.4 | 3.26 ± 2.35 | 2.18 ± 1.12 | 3.7 × 10−3 |
Fads2b | ||||||
C18:3n-3 | fads2b.751 | 1.0 × 10−2 | 5 | 0.9 ± 0.72 | 1.85 ± 1.39 | 2.1 × 10−4 |
C20:3n-3 | fads2b.751 | 2.7 × 10−6 | 13 | 0.25 ± 0.12 | 0.42 ± 0.19 | 4.2 × 10−6 |
C20:4n-3 | fads2b.751 | 3.2 × 10−5 | 11 | 0.29 ± 0.12 | 0.47 ± 0.22 | 1.4 × 10−5 |
C22:5n-3 | fads2b.751 | 2.0 × 10−5 | 11 | 1.67 ± 0.93 | 2.47 ± 1.19 | 4.7 × 10−4 |
C20:3n-3 | fads2b.1197 | 1.7 × 10−3 | 4.3 | 0.25 ± 0.12 | 0.47 ± 0.18 | 1.9 × 10−7 |
C20:4n-3 | fads2b.1197 | 8.5 × 10−4 | 5 | 0.29 ± 0.13 | 0.52 ± 0.21 | 4.5 × 10−7 |
C22:5n-3 | fads2b.1197 | 4.7 × 10−4 | 5 | 1.66 ± 0.88 | 2.81 ± 1.43 | 2.1 × 10−6 |
C20:3n-6 | fads2b.751 | 2.7 × 10−5 | 11 | 2.78 ± 1.44 | 4.69 ± 2.47 | 2.2 × 10−6 |
C22:4n-6 | Fads2b.751 | 3.1 × 10−4 | 7 | 0.68 ± 0.36 | 0.95 ± 0.45 | 6.9 × 10−4 |
C22:5n-6 | Fads2b.751 | 2.7 × 10−3 | 9 | 2.28 ± 1.59 | 4.08 ± 2.5 | 9.9 × 10−6 |
C18:2n-6 | Fads2b.1197 | 2.5 × 10−3 | 4 | 24.19 ± 7.83 | 37.28 ± 20.34 | 6.4 × 10−3 |
C20:3n-6 | Fads2b.1197 | 2.0 × 10−3 | 4 | 2.79 ± 1.44 | 5.17 ± 2.52 | 1.2 × 10−6 |
C22:5n-6 | Fads2b.1197 | 1.2 × 10−6 | 3 | 2.29 ± 1.58 | 4.59 ± 2.55 | 1.6 × 10−6 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Sun, X.-Q.; Ye, Y.-Q.; Wang, Q.; Li, Q.-S.; Zhao, R.; Wang, H.-W.; Li, J.-T. Association between the Polymorphisms of fads2a and fads2b and Poly-Unsaturated Fatty Acids in Common Carp (Cyprinus carpio). Animals 2021, 11, 1780. https://doi.org/10.3390/ani11061780
Zhang Y, Sun X-Q, Ye Y-Q, Wang Q, Li Q-S, Zhao R, Wang H-W, Li J-T. Association between the Polymorphisms of fads2a and fads2b and Poly-Unsaturated Fatty Acids in Common Carp (Cyprinus carpio). Animals. 2021; 11(6):1780. https://doi.org/10.3390/ani11061780
Chicago/Turabian StyleZhang, Yan, Xiao-Qing Sun, Yu-Qing Ye, Qi Wang, Qing-Song Li, Ran Zhao, Hong-Wei Wang, and Jiong-Tang Li. 2021. "Association between the Polymorphisms of fads2a and fads2b and Poly-Unsaturated Fatty Acids in Common Carp (Cyprinus carpio)" Animals 11, no. 6: 1780. https://doi.org/10.3390/ani11061780