Next Article in Journal
Pointing Out Some Issues Regarding Reproduction Management in Murciano-Granadina Goats
Next Article in Special Issue
Malpigmentation of Common Sole (Solea solea) during Metamorphosis Is Associated with Differential Synaptic-Related Gene Expression
Previous Article in Journal
The Impact of Dietary Curcumin on the Growth Performance, Intestinal Antibacterial Capacity, and Haemato-Biochemical Parameters of Gilthead Seabream (Sparus aurata)
Previous Article in Special Issue
A First Insight into the Gonad Transcriptome of Hong Kong Catfish (Clarias fuscus)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 11
Issue 6
10.3390/ani11061780
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Association between the Polymorphisms of fads2a and fads2b and Poly-Unsaturated Fatty Acids in Common Carp (Cyprinus carpio)

by
Yan Zhang
1,†,
Xiao-Qing Sun
1,†,
Yu-Qing Ye
2,
Qi Wang
1,
Qing-Song Li
2,
Ran Zhao
1,
Hong-Wei Wang
1 and
Jiong-Tang Li
1,*
1
Key Laboratory of Aquatic Genomics, Ministry of Agriculture and Rural Affairs, and Beijing Key Laboratory of Fishery Biotechnology, Chinese Academy of Fishery Sciences, Beijing 100141, China
2
National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai 201306, China
*
Author to whom correspondence should be addressed.
†
These two authors contributed to this work equally.
Animals 2021, 11(6), 1780; https://doi.org/10.3390/ani11061780
Submission received: 7 May 2021 / Revised: 6 June 2021 / Accepted: 7 June 2021 / Published: 15 June 2021
(This article belongs to the Special Issue Aquaculture Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Fishes are the major dietary source of polyunsaturated fatty acids (PUFAs) for humans. The limited availability of PUFAs derived from fish represents a critical bottleneck in food production systems, one that numerous research institutions and aqua-feed companies in this field are trying to overcome. This problem could be minimized by select-bred fish to be capable of more effectively producing endogenous PUFAs. Fatty acid desaturase 2 (fads2) is one of the rate-limiting enzymes in the synthesis of PUFAs. The common carp, one of the most important food and ornamental allo-tetraploid fish, encodes two fads2 genes (fads2a and fads2b). The PUFA contents among common carp individuals were numerous, suggesting that there might exist polymorphisms in fads2a and fads2b. However, selective breeding of common carp with high PUFA contents was hindered due to a lack of effective molecular markers. This study investigated the contents of PUFAs in common carp and identified polymorphisms in the CDS regions of fads2a and fads2b. The association study identified three cSNPs associated with the PUFA contents and suggested that fads2b might be the major gene responding for common carp PUFA contents. These cSNPs would be potential markers for future selection to improve the PUFA contents in common carp.

Abstract

Fatty acid desaturase 2 (fads2) is one of the rate-limiting enzymes in PUFAs biosynthesis. Compared with the diploid fish encoding one fads2, the allo-tetraploid common carp, one most important food fish, encodes two fads2 genes (fads2a and fads2b). The associations between the contents of different PUFAs and the polymorphisms of fads2a and fads2b have not been studied. The contents of 12 PUFAs in common carp individuals were measured, and the polymorphisms in the coding sequences of fads2a and fads2b were screened. We identified five coding single nucleotide polymorphisms (cSNPs) in fads2a and eleven cSNPs in fads2b. Using the mixed linear model and analysis of variance, a synonymous fads2a cSNP was significantly associated with the content of C20:3n-6. One non-synonymous fads2b cSNP (fads2b.751) and one synonymous fads2b cSNP (fads2b.1197) were associated with the contents of seven PUFAs and the contents of six PUFAs, respectively. The heterozygous genotypes in both loci were associated with higher contents than the homozygous genotypes. The fads2b.751 genotype explained more phenotype variation than the fads2b.1197 genotype. These two SNPs were distributed in one haplotype block and associated with the contents of five common PUFAs. These results suggested that fads2b might be the major gene responding to common carp PUFA contents and that fads.751 might be the main effect SNP. These cSNPs would be potential markers for future selection to improve the PUFA contents in common carp.

1. Introduction

Fish provide polyunsaturated fatty acids (PUFAs) for human. PUFAs are necessary for important biological functions in human, such as regulating lipid metabolism, stimulating growth and development, exerting anticancer and antiaging effects, enforcing immune-regulation, promoting cardiovascular health, and aiding weight loss [1,2,3]. PUFAs in the diet also help to elevate serum peroxides and antioxidant reserves and to lower plasma triglycerides, thus helping to ameliorate cardiovascular diseases [4].
Biosynthesis of PUFAs in fish involves desaturation and elongation of the precursor C18 FA [5,6]. The fatty acid desaturase 2 (fads2), an endoplasmic reticulum membrane-bound enzyme, introduces cis double bonds into fatty acyl chains at specific sites of PUFAs [7,8,9]. This gene is one of the rate-limiting enzymes in the PUFA biosynthesis process. Although most diploid fish encode only one fads2 gene, comparative analysis revealed that mutations in the protein sequences affect the substrate specificity (Δ4, Δ5, Δ6, and Δ8 activities) and conversion efficiency [10,11,12,13,14], leading to different types and contents of PUFAs among fish. Furthermore, single nucleotide polymorphisms (SNPs) of fads2 in human, mammals, and fish [15,16,17,18,19,20] are associated with omega-6 (n-6) and omega-3 (n-3) FA levels. Therefore, identifying mutants among fishes or polymorphisms among varieties in one fish would benefit the future breeding selection of fish having high contents of PUFAs.
The common carp (Cyprinus carpio) is cultured commercially worldwide, generating numerous geographical populations. Domestication has also accelerated the phenotypic diversity of the common carp [21]. This fish is able to convert dietary C18 FAs to PUFAs[6,11]. Due to its allo-tetraploiy [22], the common carp encodes one more fads2 gene than most diploid freshwater fish. Two fad cDNAs, fads2a and fads2b, were previously identified [23]. The PUFA contents among common carp individuals were numerous [24], suggesting that there might exist polymorphisms in fads2a and fads2b. Indeed, in common carp var. Jian, one intronic SNP in fads2a and one intronic SNP in fads2b were identified [23]. However, whether these two intronic SNPs were associated with the PUFA contents has not been studied. The question of whether there are polymorphisms in these two genes in other varieties and the association between polymorphisms and the PUFA contents also require studying. Furthermore, which of these two genes is the major gene responsible for PUFA biosynthesis is still unknown.
Genomic markers have been demonstrated to be efficient in the representation of the associated phenotypes and aquaculture breeding [25,26,27]. Selective breeding of common carp with high PUFA contents is hindered due to a lack of effective molecular markers. To answer the above questions and to develop SNP markers for selective breeding of PUFAs, in this study, we measure the PUFA contents and identified more polymorphisms in common carp fads2a and fads2b than before. The association between certain genotypes and the contents of multiple PUFAs in the common carp population are performed. Three significantly associated SNPs are useful in the molecular-assisted selection of high PUFA contents in common carp.

2. Materials and Methods

2.1. Ethics Statement

This study was conducted following the recommendations of the Care and Use of Animals for Scientific Purposes established by the Animal Care and Use Committee of the Chinese Academy of Fishery Sciences (ACUC-CAFS). Before collecting the tissues, all fishes were euthanized in MS222 solution.

2.2. Sampling

To increase the diversities of HUFA contents, in 2018, we collected the juvenile common carp including the var. Huanghe (HHC, at Donge, Shandong province, China), the var. Furui (FRC), and the var. Jian (JC, at Wuxi, Jiangsu province, China) (Supplementary Figure S1). The samples were maintained at the experimental fish farm of Chinese Academy of Fishery Sciences (Fangshan, Beijing, China) and fed with the same commercial diet (Tongwei, China) in the culture ponds. This commercial diet contained fish meal, fish oil, colza oil, and soybean meal. In 2019, a total of 269 one-year-old common carp were randomly selected, including 124 FRC individuals, 47 HHC individuals, and 98 JC individuals. The liver and muscle of each individual were dissected, immediately frozen in liquid nitrogen, and stored at −80 °C.

2.3. RNA Extraction, cDNA Synthesis, Sequencing, and Genotyping

RNA was extracted from the liver of each individual using TRIzol® (100 mg sample /1 mL TRIzol, Invitrogen, Waltham, MA, USA). The concentration of RNA was determined using the NanoDrop 2000 spectrophotometer (Thermo Scientific™, Wilmington, DE, USA), and its quality was determined by 1% agarose gel electrophoresis. Next, 1 µg RNA was reverse transcribed to cDNA using the SuperScript III RNase H-Reverse Transcriptase Kit (Invitrogen, Carlsbad, CA, USA) with oligo-dT. Based on the reference full-length sequence of fads2a and fads2b in common carp (GenBank accessions: MK852165 and MK852166), gene-specific primers were designed to amplify the complete coding sequence (CDS) regions of these two genes (Table 1).
PCR amplifications were performed in a total volume of 15 μL, containing 50 ng of cDNA, 1.5 mM of MgCl2, 0.2 mM of each dNTP, 15 pmol of each primer, and 0.3 U of Taq polymerase (TransGen Biotech, Beijing, China). The following thermal profile was applied: 5 min at 94 °C, 40 cycles of 30 s at 94 °C, 30 s at the annealing temperature of 56/62 °C (Table 1), 1 min at 72 °C, and a final extension of 10 min at 72 °C. Finally, the PCR products were sequenced with the Sanger method. Since the CDS of each gene was less than 1350 bp, two ends of one round of Sanger sequencing covers the complete CDS.
Since fads2a and fad2b have high nucleotide sequence similarities at 89.86%, to avoid misalignments and putative artificial coding SNPs (cSNPs), all of the amplified sequences were aligned to fads2a and fads2b using blastn. For one sequence expected to be from fads2a, if it had a higher alignment score for fads2b than fads2a, then this sequence should be aligned to fads2b to call for SNPs. The same operation was performed on all sequences expected from fads2b. To detect SNPs and to perform genotyping in each sample, the sequences were aligned to their corresponding reference genes in the novoSNP software [28] with the position ranging from 100 bp to 700 bp. If one locus had only one peak, this locus was considered a homozygote. If the base in this locus was different from the reference, then this locus was a cSNP. For one locus with two peaks, the genotype was auto-detected with the software and considered a heterozygous site. If one site had an F-score over 30 measured by novoSNP, it was of high quality.

2.4. Genetic Diversities of Common Carp fads2a and fads2b

We investigated the genetic distances and structures among three varieties with all retained genotypes in fads2a and fads2b. The genetic distances were estimated using Principle Component analysis (PCA) in the Tassel 5.0 software [29]. The first two eigenvectors were plotted. The population structure among three varieties we analyzed using Admixture 1.3.0 [30]. K was set from 2 to 6. The population structures and the genetic compositions of each individual were visualized by pophelper v2.3.1 [31].
As three varieties were grouped together in the PCA analysis and had similar structures, we combined these varieties into one population. The observed heterozygosity (Ho), expected heterozygosity (He), genotype frequency, and allele frequency in the population were calculated using the Genepop software [32]. If the frequency of one SNP in the population was higher than 0.04 (at least 5 out of 122 individuals with fads2a genotype information), it was retained in the downstream analysis. The polymorphism information content (PIC) for each retained SNP locus was estimated using PICcalc 0.6 [33]. The effects of SNPs to the coding sequences were classified into synonymous substitution, non-synonymous substitution, stop gain, and stop loss.

2.5. Measuring the Contents of 12 PUFAs in Common Carp

FAs in each individual muscle were transformed into fatty acid methyl esters (FAMEs). FAMEs were prepared, extracted, and purified by thin-layer chromatography following Li et al.’s strategy [34]. The type of each FA was identified using the 7890A GC System (Agilent Technologies, Wilmington, DE, USA) equipped with a flame ionization detector. Samples were subjected to a temperature gradient from 60 °C to 150 °C at 10 °C/min, then to 200 °C at 15 °C/min, and finally to 230 °C at 30 °C/min. Each FAME was identified by comparing its GC retention time with the peaks in a Supelco 37 Component FAMEs standard mix (Nu-chek Prep, Inc., Elysian, USA). We calculated all areas of 25 long FAs (C14:0, C15:0, C16:0, C16:1, C17:0, C17:1, C18:0, C18:1n-9, C18:2n-6, C18:3n-6, C18:3n-3, C18:4n-3, C20:0, C20:1, C20:3n-6, C20:4n-6, C20:3n-3, C20:4n-3, C20:5n-3, C22:0, C23:0, C22:4n-6, C22:5n-6, C22:5n-3, and C24:0). We focused on studying the substrates and the products in the PUFA biosynthesis pathway [34], including nine n-3 PUFAs and nine n-6 PUFAs. Since there was no GC retention time for four PUFAs having at least 24 carbons, we did not detect the contents of these PUFAs. In addition, two PUFAs (C20:2n-6 and C22:6n-3) were not detected in at least half of the samples and were therefore not included in the following analysis. Among the remaining 12 PUFAs (C18:2n-6, C18:3n-6, C18:3n-3, C18:4n-3, C20:3n-6, C20:4n-6, C20:3n-3, C20:4n-3, C20:5n-3, C22:4n-6, C22:5n-6, and C22:5n-3), the proportion of each PUFA was calculated as (area of one PUFA/total area of 25 FAs) × 100.

2.6. PUFA Content Comparison

Before the following association study, we first examine whether there existed significant differences in the PUFA types and contents among three varieties. With the contents of 12 PUFAs, the distances measured by the PCA analysis were estimated with Tassel 5.0.
The Spearman correlation coefficient of the contents of any two PUFAs in all individuals was calculated using the R ‘cor.test’ function. Using the TBtools software [35], we clustered 12 PUFAs on the basis of the correlations using the ‘Median method’ and visualized all correlation coefficients using the R function ‘heatmap’.

2.7. Associations of Polymorphisms in fads2a and fads2b with the Contents of 12 PUFAs

Associations between the contents of each PUFA and the genotypes were studied using the mixed linear model (MLM) and the analysis of variance (ANOVA), respectively. The MLM model, including the PCA and the kinship matrix, which is MLM (PCA + K), was applied into the association study with Tassel 5. This method was widely used in the association study between the polymorphisms in candidate genes and phenotypes [36,37,38]. The percentage of phenotypic variation explained by each marker was calculated with Tassel 5.
For each SNP locus, we grouped the individuals on the basis of their genotypes. Then, we performed pairwise group comparison with ANOVA to estimate whether there existed significant content difference in each PUFA between the two groups. All p values were corrected using the false discovery rate (FDR) method for multiple hypothesis testing.
As for each PUFA, one SNP locus was considered significantly associated with the content if it had a p value < 0.05 in the MLM method and a FDR-corrected p value < 0.05 in the ANOVA. In each gene, the pairwise linkage disequilibrium (LD) between any two SNPs was measured by D’ calculated with PLINK v1.90 [39] and visualized with the R package LDheatmap [40]. The haplotype block was defined if the average D’ of any two compared SNPs in this region was greater than 0.6.

3. Results

3.1. Genotyping Common Carp fads2a and fads2b

The CDS sequences of fads2a and fads2b were highly similar, with a nucleotide identity of 89.86% and a protein identity of 92.06%. The fads2a CDS spanned 12 exons, and the fads2b CDS covered 12 exons. For fads2a, base contents of A, G, C, and T in the sequence were 25.0%, 26.2%, 24.6%, and 24.2%, respectively; the A + T content (49.2%) was lower than the G + C content (50.8%). For fads2b, the average A, G, C, and T base contents in amplified sequences were 25.4%, 26.1%, 24.5%, and 24%, respectively; the A + T content (49.4%) was lower than the G + C content (50.6%). All of these data suggest high similarity between the CDS of these two genes. After amplification and validating the real source genes, we successfully sequenced the entire CDS of fads2a in 122 individuals and the entire CDS of fads2b in 237 individuals.
We obtained ten fads2a cSNPs and 27 fads2b cSNPs (Supplementary Table S1). After filtering low-frequency cSNPs with a MAF threshold of 0.04, five cSNPs, including one non-synonymous SNPs and four synonymous SNPs, were identified in fads2a from 122 samples, corresponding to 14 genotypes (Table 2). These cSNPs were distributed in four exons. Likewise, eleven cSNPs, including six non-synonymous SNPs and five synonymous SNPs were identified in fads2b from 237 samples (Table 2), being distributed over exons 1 to 11. In these loci, 30 genotypes were detected. Taking the CDS lengths into consideration, the SNP loci only accounted for 0.37% in fads2a and 0.82% in fads2b, suggesting low polymorphism in these two genes. However, fads2b had higher polymorphisms than fads2a.

3.2. Genetic Diversities of fads2a and fads2b

PCA based on the fads2a genotypes clustered three common carp varieties together (Figure 1A). The first two principal components explained 30% and 24% of the total genetic variances. A similar phenomenon of clustering together was observed with the fads2b genotypes (Figure 1B). The first two principal components explained 60.1% and 11.14% of the total genetic variances, respectively. These data proved that these three varieties had similarity genetic background in both fads2a and fads2b. These findings were further supported by the population structure analysis with fads2a cSNPs and fads2b cSNPs, respectively (Supplementary Figure S2). In the admixture plots with different K values, three varieties had similar genetic components. There was no variety-specific SNP in these two genes, as evidenced by both PCA and population structure analysis. Therefore, we combined these three varieties into one population in the following analysis.
The minor allele frequencies (MAF) of fads2a cSNPs ranged from 0.05 to 0.28. The MAFs of fads2b cSNPs ranged from 0.04 to 0.47. No significant MAF distribution differences between these two genes were observed (Mann–Whitney U test, p value = 0.377). Ho in fads2a ranged from 0.1 to 0.51 and He ranged from 0.09 to 0.4. PIC analysis indicated that the fads2a.288 locus displayed a low polymorphism level (PIC < 0.1) compared with the other four loci. Among the fads2b cSNPs, Ho ranged from 0.02 to 0.38 and He ranged from 0.07 to 0.49. Two loci displayed low polymorphism levels (PIC < 0.1) compared with the remaining nine loci. All fads2a cSNPs and fads2b cSNPs significantly deviated from the Hardy–Weinberg equilibrium (Table 2, chi-square p value < 0.05).

3.3. Diversities of PUFA Contents in Common Carp

We obtained the contents of 12 PUFAs in 269 common carp samples (Supplementary Table S2). PCA analysis with the contents of 12 PUFAs demonstrated that there were no variety-enriched PUFAs (Supplementary Figure S3), similar to no variety-specific SNPs in these two genes. Hence, in the following phenotype comparison and association study, we also grouped three varieties into one population. The n-6 PUFA contents (44.68 ± 16.81%) were higher than the n-3 PUFA contents (6.76 ± 3.58%). The most abundant PUFA was C18:2n-6 (24.33 ± 11.03%), followed by C20:4n-6 (8.17 ± 4.96%) and C18:3n-6 (6.36 ± 6.75%) (Table 3). The content distributions of 12 PUFAs were not subject to the normal distribution (Kolmogorov–Smirnov test p value < 0.05, Supplementary Figure S4).
A correlation matrix of pairwise content comparisons between two PUFAs (Figure 2) exhibited two major clades. The first clade including PUFAs with 18 carbons. The components in the second clade mainly included at least 20 carbons (except C18:3n-6), which were the derivates of the first clade. Hence, it is reasonable that there exist negative correlations between these two clades. Based on the correlations among the components, the second clade was further classified into two groups: n-6 PUFAs (except C20:3n-3) and n-3 PUFAs. The second-clade classification was consistent with the classification based on the location of the last double bond with reference to the terminal methyl end of the molecule (n-3 and n-6) [11]. The clustering suggested that correlations among the PUFA products were higher than those between the products and substrates.

3.4. Three cSNPs Associated with the PUFA Contents

Out of five fads2a cSNPs, only one synonymous cSNP (fads2a.624) was found to be significantly associated with the content of C20:3n-6 by both MLM (p value of 0.025) and ANOVA (corrected p value of 0.0037, Table 4, and Figure 3A). The homozygous genotype (GG) of this locus was associated with higher C20:3n-6 content than the heterozygous genotype (AG), with a fold change of 1.50.
Among 11 fads2b cSNPs, two cSNPs were significantly associated with the contents of multiple PUFAs by both MLM and ANOVA. One non-synonymous cSNP (fads2b.751), resulting in the conversion of valine to isoleucine, was associated with the contents of four n-3 PUFAs (C18:3n-3, C20:3n-3, C20:4n-3, and C22:5n-3) and three n-6 PUFAs (C20:3n-6, C22:4n-6, and C22:5n-6). In this locus, two genotypes including the homozygous genotype (GG) and the heterozygous genotype (AG) were observed while the homozygous genotype of AA was not identified. Interestingly, in all observed associated PUFAs, the individuals with the heterozygous genotype had significantly higher contents than those with the homozygous genotype (Table 4, Figure 3B–H). The fold changes of mean PUFA contents between two groups ranged from 1.4 to 2.1.
The other cSNP (fads2b.1197) was synonymous and associated with the contents of three n-3 PUFAs (C20:3n-3, C20:4n-3, and C22:5n-3) and three n-6 PUFAs (C18:2n-6, C20:3n-6, and C22:5n-6). In this locus, two genotypes including the homozygous genotype (CC) and the heterozygous genotype (CT) were observed while the homozygous genotype of TT was not identified. Likewise, in all observed associated PUFAs, the individuals with the heterozygous genotype had significant higher contents than those with the homozygous genotype (Table 4, Figure 3I–N). The fold changes of mean PUFA contents between two groups ranged from 1.5 to 2.0.
The contents of five PUFAs (C20:3n-3, C20:4n-3, C22:5n-3, C20:3n-6, and C22:5n-6) were associated with both cSNPs. Two haplotype blocks were identified in the fads2b CDS (Figure 4). The fads2b.751 and fads2b.1197 were located in the second block, possibly explaining the co-associations of these two cSNPs with five PUFAs contents. However, in these five PUFAs, the non-synonymous cSNPs explained more phenotypic variations than the synonymous cSNP, suggesting that the former was the major effect genotype.

4. Discussion

The limited availability of PUFAs derived from fish represents the critical bottleneck in food production systems, one that numerous research institutions and aqua-feed companies in this field are trying to overcome. Increasing PUFA in fish may have important impacts on human heath, especially in a context where the traditional sources of PUFA, wild fish, and fish oils, are limited by the stagnation of fisheries. Although producing aquaculture fish with more PUFA could be achieved by feeding different fish ingredients [41,42], this goal could be minimized by select-bred fish to be capable of producing endogenous PUFAs more effectively.
The fads2 gene is a rate-limiting enzyme catalyzing the desaturation of PUCAs, and the overexpression of salmon fads2 gene in zebrafish could improve PUFA contents [43]. Two fads2 genes were identified in the common carp and had differential expression patterns during the development from embryo to larval [23]. Our study intends to find SNPs linked to the PUFA contents in common carp, using a candidate gene approach, by searching associations between polymorphisms in the coding region of fads2a/fads2b and the PUFA contents. The PUFA content diversities in common carp suggest the possible existence of SNPs in fads2a/fads2b. Since the genic regions of fads2a and fads2b were longer than 11,500 bp [23], it is laborious to amplify the whole genic regions. Therefore, we investigated the presence of SNPs in the CDS regions of fads2a and fads2b. The lower amplification efficiency of fads2a than fads2b was possibly due to the low gene expression of fads2a in liver.
Although under long-term selection (both natural and artificial) common carp acquired genetic diversity and phenotypic diversity, the three varieties studied had no significant differences in the genetic diversities of these two genes and the PUFA content diversities. Three varieties of common carp were grouped into one population to increase the sample size, the genetic diversities of fads2a and fads2b, and the PUFA content diversities. It is still unknown which gene makes more contributions to the PUFA biosynthesis. More associated PUFAs and higher explained percentage of phenotypic variations in fads2b than fads2a suggest that fads2b might be the major effect gene for PUFA biosynthesis. More functional studies on these two genes are required for further validation [12,13,15,16].
The non-synonymous fads2b cSNP might improve desaturase efficiency on the n-3 and n-6 substrates, leading to higher PUFA contents. We also observed one synonymous cSNP associated with the PUFA contents. One possible reason is the tight linkage between the non-synonymous cSNP and the synonymous cSNP, and the synonymous cSNP is a possible biomarker representing the non-synonymous cSNP. The other possible reason is that the synonymous cSNP might affect the DNA methylation level of fads2b. In humans, the DNA methylation level in the fads1/2/3 gene cluster was linked with genetic variants and desaturase activities and thus affected fads2 gene expression [44,45]. We predicted two potential CpG islands (from 157 to 731 bp, and from 1015 to 1237 bp) on the fads2b CDS region using the method described by Gardiner-Garden and Frommer (1987) with the parameters of GC content over 50% and of the observed/expected ratio over 60% [46]. The synonymous cSNP of fads2b.1197 is located on the second CpG island. Whether this cSNP affects the fads2b DNA methylation level and then its expression requires future study.
We observed the eterozygote advantage with the PUFA contents. The heterozygote advantage was widely observed in the economic traits including the growth rates [47]. In two cSNPs, fads2b.751 and fads2b.1197, the heterozygous genotypes were associated with higher PUFA contents than the homozygous genotypes, suggesting that the heterozygosity of fads2b might increase the desaturase activity. Steer et al. [48] reported heterozygotes of fads2 in humans to be increasingly capable of synthesizing docosahexaenoic acid from alpha-linolenic acid, thereby suggesting that heterozygotes can achieve nutritional adequacy.
We identified cSNPs in fads2a and fads2b associated with the PUFA contents. These cSNPs will be applied into future marker-assisted selective breeding of common carp to improve PUFA contents. The question of whether there exist polymorphisms in the promoters, miRNA binding sites, and other functional elements of fads2a and fads2b will be studied in the future.

5. Conclusions

We detected many polymorphisms in the coding regions of fads2a and fads2b in common carp and found higher polymorphisms in fads2b than fads2a. We identified the contents of 12 PUFAs in common carp muscle, which exhibited diversities among individuals. The association studies between the polymorphisms of these two genes and the PUFA contents in common carp identified three cSNPs linked to the PUFA contents. The gene fads2b might be the major gene responding for common carp PUFA contents, and fads.751 might be the main effect SNP. Taken together, our findings highlight the importance of polymorphisms in fads2a and fads2b, critical to the biosynthesis of n-6 and n-3 PUFA levels in common carp. These cSNPs would be potential markers for future selection to improve PUFA contents in common carp.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/ani11061780/s1, Table S1: The genotypes of fads2a and fads2b, Table S2: The contents of 12 PUFAs in 269 samples, Figure S1: The images of three varieties of common carp used in this study, Figure S2: Population structures using the genotypes of fads2a and fads2b, Figure S3: PCA plot clustering three common carp varieties with the contents of 12 PUFAs, Figure S4: Comparing the content distributions of 12 PUFAs with the normal distribution.

Author Contributions

Conceptualization, J.-T.L. and Y.Z.; methodology, J.-T.L., Y.Z., Y.-Q.Y., and X.-Q.S.; software, Q.W., Q.-S.L., X.-Q.S., and Y.Z.; validation, J.-T.L. and Y.Z.; formal analysis, Q.W., Q.-S.L., Y.-Q.Y., and X.-Q.S.; investigation, J.-T.L., Y.Z., and Q.-S.L.; resources, J.-T.L. and H.-W.W.; data curation, Y.-Q.Y. and R.Z.; writing—original draft preparation, Y.Z.; writing—review and editing, J.-T.L.; supervision, J.-T.L.; project administration, J.-T.L. and Y.Z.; funding acquisition, J.-T.L. and Y.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program (grant numbers 2018YFD0900102); by the National Natural Science Foundation of China (grant number 31672644); by the Beijing Municipal Natural Science Foundation (grant number 6212033); and by the Special Scientific Research Funds for Central Non-profit Institutes, Chinese Academy of Fishery Sciences (grant numbers 2018HY-ZD0207, 2020XT0103, and 2020TD24).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of China, and approved by the Animal Care and Use Committee of the Chinese Academy of Fishery Sciences (protocol code ACUC-CAFS-20191202 and date of approval is 27 December 2019).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in supplementary material.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gow, R.V.; Hibbeln, J.R. Omega-3 fatty acid and nutrient deficits in adverse neurodevelopment and childhood behaviors. Child Adolesc. Psychiatr. Clin. N. Am. 2014, 23, 555–590. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Katalin Nagy, I.-D.T. Importance of Fatty Acids in Physiopathology of Human Body; IntechOpen: London, UK, 2017. [Google Scholar] [CrossRef] [Green Version]
  3. Lands, B. Highly unsaturated fatty acids (HUFA) mediate and monitor food’s impact on health. Prostaglandins Other Lipid Mediat. 2017, 133, 4–10. [Google Scholar] [CrossRef]
  4. Rennison, J.H.; Van Wagoner, D.R. Impact of dietary fatty acids on cardiac arrhythmogenesis. Circ. Arrhythm. Electrophysiol. 2009, 2, 460–469. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Monroig, O.; Rotllant, J.; Sanchez, E.; Cerda-Reverter, J.M.; Tocher, D.R. Expression of long-chain polyunsaturated fatty acid (LC-PUFA) biosynthesis genes during zebrafish Danio rerio early embryogenesis. Biochim. Biophys. Acta 2009, 1791, 1093–1101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Monroig, Ó.; Tocher, D.R.; Hontoria, F.; Navarro, J.C. Functional characterisation of a Fads2 fatty acyl desaturase with Δ6/Δ8 activity and an Elovl5 with C16, C18 and C20 elongase activity in the anadromous teleost meagre (Argyrosomus regius). Aquaculture 2013, 412, 14–22. [Google Scholar] [CrossRef]
  7. Hastings, N.; Agaba, M.; Tocher, D.R.; Leaver, M.J.; Dick, J.R.; Sargent, J.R.; Teale, A.J. A vertebrate fatty acid desaturase with Delta 5 and Delta 6 activities. Proc. Natl. Acad. Sci. USA 2001, 98, 14304–14309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Monroig, O.; Tocher, D.R.; Navarro, J.C. Biosynthesis of polyunsaturated fatty acids in marine invertebrates: Recent advances in molecular mechanisms. Mar. Drugs 2013, 11, 3998–4018. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Monroig, O.; Zheng, X.; Morais, S.; Leaver, M.J.; Taggart, J.B.; Tocher, D.R. Multiple genes for functional 6 fatty acyl desaturases (Fad) in Atlantic salmon (Salmo salar L.): Gene and cDNA characterization, functional expression, tissue distribution and nutritional regulation. Biochim. Biophys. Acta 2010, 1801, 1072–1081. [Google Scholar] [CrossRef]
  10. Agaba, M.; Tocher, D.R.; Dickson, C.A.; Dick, J.R.; Teale, A.J. Zebrafish cDNA encoding multifunctional Fatty Acid elongase involved in production of eicosapentaenoic (20:5n-3) and docosahexaenoic (22:6n-3) acids. Mar. Biotechnol 2004, 6, 251–261. [Google Scholar] [CrossRef]
  11. Castro, L.F.C.; Tocher, D.R.; Monroig, O. Long-chain polyunsaturated fatty acid biosynthesis in chordates: Insights into the evolution of Fads and Elovl gene repertoire. Prog. Lipid Res. 2016, 62, 25–40. [Google Scholar] [CrossRef]
  12. Monroig, O.; Li, Y.; Tocher, D.R. Delta-8 desaturation activity varies among fatty acyl desaturases of teleost fish: High activity in delta-6 desaturases of marine species. Comp. Biochem. Physiol. Part B 2011, 159, 206–213. [Google Scholar] [CrossRef]
  13. Oboh, A.; Kabeya, N.; Carmona-Antonanzas, G.; Castro, L.F.C.; Dick, J.R.; Tocher, D.R.; Monroig, O. Two alternative pathways for docosahexaenoic acid (DHA, 22:6n-3) biosynthesis are widespread among teleost fish. Sci. Rep. 2017, 7, 3889. [Google Scholar] [CrossRef] [PubMed]
  14. Zheng, X.; Seiliez, I.; Hastings, N.; Tocher, D.R.; Panserat, S.; Dickson, C.A.; Bergot, P.; Teale, A.J. Characterization and comparison of fatty acyl Delta6 desaturase cDNAs from freshwater and marine teleost fish species. Comp. Biochem. Physiol. Part B 2004, 139, 269–279. [Google Scholar] [CrossRef]
  15. Ferosekhan, S.; Turkmen, S.; Xu, H.; Afonso, J.M.; Zamorano, M.J.; Kaushik, S.; Izquierdo, M. The relationship between the expression of fatty acyl desaturase 2 (Fads2) gene in peripheral blood cells (pbcs) and liver in gilthead seabream, sparus aurata broodstock fed a low n-3 lc-pufa diet. Life 2020, 10, 117. [Google Scholar] [CrossRef]
  16. Ganguly, S.; Mitra, T.; Mahanty, A.; Mohanty, S.; Mohanty, B.P. A comparative metabolomics study on anadromous clupeid Tenualosa ilisha for better understanding the influence of habitat on nutritional composition. Metabolomics 2020, 16, 30. [Google Scholar] [CrossRef] [PubMed]
  17. Gol, S.; Pena, R.N.; Rothschild, M.F.; Tor, M.; Estany, J. A polymorphism in the fatty acid desaturase-2 gene is associated with the arachidonic acid metabolism in pigs. Sci. Rep. 2018, 8, 1–9. [Google Scholar] [CrossRef] [Green Version]
  18. Proskura, W.S.; Liput, M.; Zaborski, D.; Sobek, Z.; Yu, Y.H.; Cheng, Y.H.; Dybus, A. The effect of polymorphism in the FADS2 gene on the fatty acid composition of bovine milk. Arch. Anim. Breed. 2019, 62, 547–555. [Google Scholar] [CrossRef] [PubMed]
  19. Renaville, B.; Tulli, F.; Bruno, M.; Tibaldi, E.; Messina, M. Fatty acid desaturase 2 (FADS2) insertion/deletion polymorphism impact on muscle fatty acid profile in European grayling (Thymallus thymallus). Br. J. Nutr. 2013, 110, 1559–1564. [Google Scholar] [CrossRef] [Green Version]
  20. Schaeffer, L.; Gohlke, H.; Müller, M.; Heid, I.M.; Palmer, L.J.; Kompauer, I.; Demmelmair, H.; Illig, T.; Koletzko, B.; Heinrich, J. Common genetic variants of the FADS1 FADS2 gene cluster and their reconstructed haplotypes are associated with the fatty acid composition in phospholipids. Hum. Mol. Genet. 2006, 15, 1745–1756. [Google Scholar] [CrossRef]
  21. Xu, P.; Zhang, X.; Wang, X.; Li, J.; Liu, G.; Kuang, Y.; Xu, J.; Zheng, X.; Ren, L.; Wang, G.; et al. Genome sequence and genetic diversity of the common carp, Cyprinus carpio. Nat. Genet. 2014, 46, 1212–1219. [Google Scholar] [CrossRef] [Green Version]
  22. Xu, P.; Xu, J.; Liu, G.; Chen, L.; Zhou, Z.; Peng, W.; Jiang, Y.; Zhao, Z.; Jia, Z.; Sun, Y.; et al. The allotetraploid origin and asymmetrical genome evolution of the common carp Cyprinus carpio. Nat. Commun. 2019, 10, 4625. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Ren, H.T.; Zhang, G.Q.; Li, J.L.; Tang, Y.K.; Li, H.X.; Yu, J.H.; Xu, P. Two Delta6-desaturase-like genes in common carp (Cyprinus carpio var. Jian): Structure characterization, mRNA expression, temperature and nutritional regulation. Gene 2013, 525, 11–17. [Google Scholar] [CrossRef] [PubMed]
  24. Chen, J.; Qin, Z.; Chang-yi, Q.; Jian-xin, F. Analysis of Fatty Acid Content in Edible Tissues of HuangheCommon Carp and Songpu Mirror Carp. Acta Agric. Jiangxi 2015, 27, 85–87. [Google Scholar] [CrossRef]
  25. Exadactylos, A.; Arvanitoyannis, I. Aquaculture Biotechnology for enhanced fish production for human consumption. Microb. Biotechnol. Agric. Aquac. 2006, 2, 453–510. [Google Scholar]
  26. Kavouras, M.; Malandrakis, E.; Danis, T.; Blom, E.; Anastassiadis, K.; Panagiota, P.; Exadactylos, A. Hox Genes Polymorphism Depicts Developmental Disruption of Common Sole Eggs. Open Life Sci. 2019, 14, 549–563. [Google Scholar] [CrossRef]
  27. Martsikalis, P.V.; Gkafas, G.; Palaiokostas, C.; Exadactylos, A. Genomics Era on Breeding Aquaculture Stocks. In Organic Aquaculture; Springer: Cham, Switzerland, 2019. [Google Scholar] [CrossRef]
  28. Weckx, S.; Del-Favero, J.; Rademakers, R.; Claes, L.; Cruts, M.; De Jonghe, P.; Van Broeckhoven, C.; De Rijk, P. novoSNP, a novel computational tool for sequence variation discovery. Genome Res. 2005, 15, 436–442. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Bradbury, P.; Zhang, Z.; Kroon, D.; Casstevens, T.; Ramdoss, Y.; Buckler, E. TASSEL: Software for association mapping of complex traits in diverse samples. Bioinformatics 2007, 23, 2633–2635. [Google Scholar] [CrossRef]
  30. Alexander, D.H.; Novembre, J.; Lange, K. Fast model-based estimation of ancestry in unrelated individuals. Genome Res. 2009, 19, 1655–1664. [Google Scholar] [CrossRef] [Green Version]
  31. Francis, R.M. pophelper: An R package and web app to analyse and visualize population structure. Mol. Ecol. Resour. 2017, 17, 27–32. [Google Scholar] [CrossRef] [Green Version]
  32. Dereeper, A.; Nicolas, S.; Le Cunff, L.; Bacilieri, R.; Doligez, A.; Peros, J.P.; Ruiz, M.; This, P. SNiPlay: A web-based tool for detection, management and analysis of SNPs. Application to grapevine diversity projects. BMC Bioinform. 2011, 12, 134. [Google Scholar] [CrossRef] [Green Version]
  33. Nagy, S.; Poczai, P.; Cernák, I.; Gorji, A.M.; Hegedűs, G.; Taller, J. PICcalc: An online program to calculate polymorphic information content for molecular genetic studies. Biochem. Genet. 2012, 50, 670–672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Li, Y.; Monroig, O.; Zhang, L.; Wang, S.; Zheng, X.; Dick, J.R.; You, C.; Tocher, D.R. Vertebrate fatty acyl desaturase with Delta4 activity. Proc. Natl. Acad. Sci. USA 2010, 107, 16840–16845. [Google Scholar] [CrossRef] [Green Version]
  35. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  36. Liu, C.; Zhou, Y.; Zhang, X.; Zhang, J.; Zhou, Z.; Weng, J.; Li, X.; Wang, Z. Natural variation in the THICK TASSEL DWARF1 (TD1) gene in the regulation of maize (Zea mays L.) ear-related traits. Breed. Sci. 2019, 69, 323–331. [Google Scholar] [CrossRef] [Green Version]
  37. Quan, M.; Xiao, L.; Lu, W.; Liu, X.; Song, F.; Si, J.; Du, Q.; Zhang, D. Association Genetics in Populus Reveal the Allelic Interactions of Pto-MIR167a and Its Targets in Wood Formation. Front. Plant Sci. 2018, 9, 744. [Google Scholar] [CrossRef]
  38. Ur Rehman, S.; Wang, J.; Chang, X.; Zhang, X.; Mao, X.; Jing, R. A wheat protein kinase gene TaSnRK2.9-5A associated with yield contributing traits. Appl. Genet. 2019, 132, 907–919. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Purcell, S.; Neale, B.; Todd-Brown, K.; Thomas, L.; Ferreira, M.A.; Bender, D.; Maller, J.; Sklar, P.; de Bakker, P.I.; Daly, M.J.; et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 2007, 81, 559–575. [Google Scholar] [CrossRef] [Green Version]
  40. Shin, J.-H.; Blay, S.; McNeney, B.; Graham, J. LDheatmap: An R Function for Graphical Display of Pairwise Linkage Disequilibria between Single Nucleotide Polymorphisms. J. Stat. Softw. 2006, 16, 9. [Google Scholar] [CrossRef] [Green Version]
  41. Exadactylos, A. Nutrigenomics in Aquaculture Research. Fish. Aquac. J. 2014, 5, e107. [Google Scholar] [CrossRef] [Green Version]
  42. Psofakis, P.; Karapanagiotidis, I.; Malandrakis, E.; Golomazou, E.; Exadactylos, A.; Mente, E. Effect of fishmeal replacement by hydrolyzed feather meal on growth performance, proximate composition, digestive enzyme activity, haematological parameters and growth-related gene expression of gilthead seabream (Sparus aurata). Aquaculture 2020, 521, 735006. [Google Scholar] [CrossRef]
  43. Yoshizaki, G.; Kiron, V.; Satoh, S.; Takeuchi, T. Expression of masu salmon Delta 5-desaturase-like gene elevated EPA and DHA biosynthesis in zebrafish. Mar. Biotechnol. 2007, 9, 92–100. [Google Scholar] [CrossRef]
  44. He, Z.; Zhang, R.; Jiang, F.; Zhang, H.; Zhao, A.; Xu, B.; Jin, L.; Wang, T.; Jia, W.; Jia, W.; et al. FADS1-FADS2 genetic polymorphisms are associated with fatty acid metabolism through changes in DNA methylation and gene expression. Clin. Epigenet. 2018, 10, 113. [Google Scholar] [CrossRef] [PubMed]
  45. Walle, P.; Mannisto, V.; de Mello, V.D.; Vaittinen, M.; Perfilyev, A.; Hanhineva, K.; Ling, C.; Pihlajamaki, J. Liver DNA methylation of FADS2 associates with FADS2 genotype. Clin. Epigenet. 2019, 11, 10, Correction in 2019, 11, 47, doi:10.1186/s13148-019-0625-1. [Google Scholar] [CrossRef]
  46. Gardiner-Garden, M.; Frommer, M. CpG islands in vertebrate genomes. J. Mol. Biol. 1987, 196, 261–282. [Google Scholar] [CrossRef]
  47. Exadactylos, A.; Malandrakis, E.; Panagiota, P.; Geffen, A. The development of size variation in Dover sole, Solea solea and turbot, Scophthalmus maximus: Genetic variability between different geographical and among year class farmed strains. Aquac. Res. 2013, 44, 1912–1925. [Google Scholar] [CrossRef]
  48. Steer, C.D.; Hibbeln, J.R.; Golding, J.; Davey Smith, G. Polyunsaturated fatty acid levels in blood during pregnancy, at birth and at 7 years: Their associations with two common FADS2 polymorphisms. Hum. Mol. Genet. 2012, 21, 1504–1512. [Google Scholar] [CrossRef] [Green Version]
Animals 11 01780 g001 550
Figure 1. The PCA plots clustering three common carp varieties with the genotypes of fads2a (A) and fads2b (B).
Figure 1. The PCA plots clustering three common carp varieties with the genotypes of fads2a (A) and fads2b (B).
Animals 11 01780 g001
Animals 11 01780 g002 550
Figure 2. Heat map shows content correlations among 12 PUFAs.
Figure 2. Heat map shows content correlations among 12 PUFAs.
Animals 11 01780 g002
Animals 11 01780 g003 550
Figure 3. Box plots show significant PUFA content differences between two genotypes in one locus. A: fads2a.624; B–H: fads2b.751; and I–N: fads2b.1197. The correlated p value calculated with ANOVA indicates a significant difference between two groups.
Figure 3. Box plots show significant PUFA content differences between two genotypes in one locus. A: fads2a.624; B–H: fads2b.751; and I–N: fads2b.1197. The correlated p value calculated with ANOVA indicates a significant difference between two groups.
Animals 11 01780 g003
Animals 11 01780 g004 550
Figure 4. Two haplotype blocks in the fads2b CDS. The red color represented tight linkage.
Figure 4. Two haplotype blocks in the fads2b CDS. The red color represented tight linkage.
Animals 11 01780 g004
Table
Table 1. The primers used for amplification of the CDS regions of fads2a and fads2b.
Table 1. The primers used for amplification of the CDS regions of fads2a and fads2b.
GenePrimer Sequence (5′-3′)Accession No.TmAmplification Length (bp)
fads2aF: CAGAGTTTGATCAGTTATGGGCGMK85216556 °C1348
R: TTTGTTGAGGTACGCATCCAGC
fads2bF: ATGGGTGGCGGAGGACAGCAGMK85216662 °C1324
R: GTACGCATCCAGCCAGATTTCTCC
Table
Table 2. Genetic diversities of cSNPs in fads2a and fads2b.
Table 2. Genetic diversities of cSNPs in fads2a and fads2b.
dbSNPPosition/ExonRef/AltHoHePICMAFGenotypeFrequencies of GenotypesAmino Acid Change
Fads2a.288288/2G/T0.10.090.090.05GG0.9
AG0.1
Fads2a.408408/3T/C0.260.250.220.15TT0.72
CC0.02
CT0.26
Fads2a.502502/3A/G0.510.40.320.28AA0.46M-L
CC0.03
AC0.51
Fads2a.561561/4C/A0.30.290.250.18GG0.67
CC0.03
CG0.3
Fads2a.624624/5G/A0.430.320.270.2GG0.55
AA0.02
AG0.43
Fads2b.128128/1T/G0.190.170.150.09TT0.81V-G
GT0.19
Fads2b.169169/1C/A0.30.330.280.21CC0.64Y-H
AA0.06
AC0.3
Fads2b.222222/2G/A0.150.450.350.33AA0.59
GG0.26
AG0.15
Fads2b.235235/2A/C0.160.440.340.33CC0.59
AA0.25
AC0.16
Fads2b.288288/2A/G0.340.50.370.47AA0.36L-M
GG0.3
AG0.34
Fads2b.291291/2T/C0.380.480.360.4TT0.41I-L
CC0.21
CT0.38
Fads2b.357357/3T/C0.350.490.370.45TT0.37
CC0.28
CT0.35
Fads2b.552552/4T/C0.130.130.120.07TT0.86H-Q
CC0.01
CT0.13
Fads2b.751751/6G/A0.10.10.10.05GG0.9V-I
AG0.1
Fads2b.916916/8T/C0.020.340.280.22TT0.77
CC0.21
CT0.02
Fads2b.11971197/11C/T0.080.070.070.04CC0.92
CT0.08
Table
Table 3. Proportions of PUFA composition.
Table 3. Proportions of PUFA composition.
n-3 PUFAComposition (%)n-6 PUFAComposition (%)
18:3n-30.98 ± 0.8818:2n-624.33 ± 11.03
18:4n-30.1 ± 0.1918:3n-66.36 ± 6.75
20:3n-30.32 ± 0.4820:3n-62.85 ± 1.74
20:4n-30.29 ± 0.1520:4n-68.17 ± 4.96
20:5n-33.39 ± 2.2122:4n-60.67 ± 0.39
22:5n-31.69 ± 0.9922:5n-62.37 ± 1.84
Total6.76 ± 3.58Total44.68 ± 16.81
All data are presented as the mean ± standard error (SE).
Table
Table 4. Association analysis of PUFA contents using MLM and ANOVA.
Table 4. Association analysis of PUFA contents using MLM and ANOVA.
TraitSNPMLM (PCA + K)ANOVA
PUFAIDp ValueMarker R2 (%)GenotypeFDR p Value
MMMm
Fads2a
C20:3n-6fads2a.6242.50 × 10−24.43.26 ± 2.352.18 ± 1.123.7 × 10−3
Fads2b
C18:3n-3fads2b.7511.0 × 10−250.9 ± 0.721.85 ± 1.392.1 × 10−4
C20:3n-3fads2b.7512.7 × 10−6130.25 ± 0.120.42 ± 0.194.2 × 10−6
C20:4n-3fads2b.7513.2 × 10−5110.29 ± 0.120.47 ± 0.221.4 × 10−5
C22:5n-3fads2b.7512.0 × 10−5111.67 ± 0.932.47 ± 1.194.7 × 10−4
C20:3n-3fads2b.11971.7 × 10−34.30.25 ± 0.120.47 ± 0.181.9 × 10−7
C20:4n-3fads2b.11978.5 × 10−450.29 ± 0.130.52 ± 0.214.5 × 10−7
C22:5n-3fads2b.11974.7 × 10−451.66 ± 0.882.81 ± 1.432.1 × 10−6
C20:3n-6fads2b.7512.7 × 10−5112.78 ± 1.444.69 ± 2.472.2 × 10−6
C22:4n-6Fads2b.7513.1 × 10−470.68 ± 0.360.95 ± 0.456.9 × 10−4
C22:5n-6Fads2b.7512.7 × 10−392.28 ± 1.594.08 ± 2.59.9 × 10−6
C18:2n-6Fads2b.11972.5 × 10−3424.19 ± 7.8337.28 ± 20.346.4 × 10−3
C20:3n-6Fads2b.11972.0 × 10−342.79 ± 1.445.17 ± 2.521.2 × 10−6
C22:5n-6Fads2b.11971.2 × 10−632.29 ± 1.584.59 ± 2.551.6 × 10−6
Marker R2: percentage of phenotypic variation explained by markers in MLM (PCA + K) method; K: Kinship matrix; M: major allele; m: minor allele. The data are presented as the mean ± SE represented the PUFA content in one genotype group.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhang, Y.; Sun, X.-Q.; Ye, Y.-Q.; Wang, Q.; Li, Q.-S.; Zhao, R.; Wang, H.-W.; Li, J.-T. Association between the Polymorphisms of fads2a and fads2b and Poly-Unsaturated Fatty Acids in Common Carp (Cyprinus carpio). Animals 2021, 11, 1780. https://doi.org/10.3390/ani11061780

AMA Style

Zhang Y, Sun X-Q, Ye Y-Q, Wang Q, Li Q-S, Zhao R, Wang H-W, Li J-T. Association between the Polymorphisms of fads2a and fads2b and Poly-Unsaturated Fatty Acids in Common Carp (Cyprinus carpio). Animals. 2021; 11(6):1780. https://doi.org/10.3390/ani11061780

Chicago/Turabian Style

Zhang, Yan, Xiao-Qing Sun, Yu-Qing Ye, Qi Wang, Qing-Song Li, Ran Zhao, Hong-Wei Wang, and Jiong-Tang Li. 2021. "Association between the Polymorphisms of fads2a and fads2b and Poly-Unsaturated Fatty Acids in Common Carp (Cyprinus carpio)" Animals 11, no. 6: 1780. https://doi.org/10.3390/ani11061780

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop