Chemicals and reagents
Scutellarin (SCU, purity > 97%) and bifendate were purchased from Yunnan Plant Pharmaceutical Co., Ltd (Kunming, Yunnan, China) and dissolved in 0.5% sodium carboxymethyl cellulose (CMC-Na). CCl4 was purchased from Sinoreagent (Shanghai, China), diluted 1:9 in olive oil. The assay kits for Alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), albumin (ALB), malondialdehyde (MDA) and superoxide dismutase (SOD) were purchased from Nanjing jiancheng bioengineering institute (Nanjing, Jiangsu, China). DeadEndTM Fluorometric TUNEL System was purchased from Promega (Wisconsin, USA). TRIzol reagent and RevertAid First Strand cDNA Synthesis Kit were purchased from Thermo Fisher Scientific (NY, USA). TB Green® Premix Ex Taq™ II was purchased from Takara Bio, Inc., (Shiga, Japan). BCA assay kit, RIPA lysis buffer, ECL regents were purchased from Solarbio (Beijing, China). Rabbit anti-NF-κB antibody (#8242, 1:1000), rabbit anti-IκBα antibody (#4812, 1:1000) were purchased from Cell Signaling Technology (Danvers, MA, USA). Rabbit anti-CYP2E1 antibody (ab28146, 1:3000), rabbit anti-GAPDH antibody (ab9484, 1:2500) and goat anti-rabbit IgG H&L (HRP) (ab205718, 1:5000) were purchased from Abcam (Cambridge, UK). All other chemicals and regents were purchased from local firms.
Animal Model
Male BALB/c mice (6–8 week and 18–22 g) were obtained from Tianqin biotechnology Co., Ltd with a certificate of quality No.SCXK-2019-0004 (Changsha, Hunan, China) and acclimatized for 7 days. All animal experiments were performed in accordance with the guidelines of the Care and Use of Laboratory Animals of the Laboratory Animal Ethical Commission of Dali University and all efforts were taken to minimize animals suffering. Chronic liver injury in mice was induced by intraperitoneal injection of 1 ml/kg CCl4 (diluted 1:9 in olive oil, Sinoreagent, Shanghai, China) every three days. SCU (PubChem ID 185617) (15 mg/kg, 30 mg/kg, 60 mg/kg, Yunnan Plant Pharmaceutical Co., Ltd, Kunming, Yunnan, China) was given by gavage every day. The groups were treated as follows (n = 10 each group): (1) Normal group (N) was given an equal volume of solvent (0.5% CMC-Na) and an equal volume of olive oil. (2) Model group (M) was given an equal volume of solvent and 1 ml/kg CCl4. (3) Low SCU treatment group (ML) was given 15 mg/kg SCU and 1 ml/kg CCl4. (4) Middle SCU treatment group (MM) was given 30 mg/kg SCU and 1 ml/kg CCl4. (5) High SCU treatment group (MH) was given 60 mg/kg SCU and 1 ml/kg CCl4. (6) Positive drug group (BIF, Bifendate served as a positive drug) was given 120 mg/kg Bifendate and 1 ml/kg CCl4. All animals were treated for an additional 5 weeks. Mice were euthanized and blood samples along with stools and liver tissues were collected 12 h after the injection of CCl4.
Liver Function and Oxidative Stress Assessment
Blood samples were centrifuged at 2000 rpm and 4℃ for 7 min to obtain serum. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL) and albumin (ALB) were measured according to the manufacture’s instructions (Nanjing jiancheng bioengineering institute, Nanjing, Jiangsu, China). Liver tissues were homogenized for 1 min in physiological saline, the homogenates were centrifuged at 12000 rpm and 4℃ for 30 min and the supernatant was collected. Commercial kits were used to determine the superoxide dismutase (SOD) and malondialdehyde (MDA) levels (Nanjing jiancheng bioengineering institute, Nanjing, Jiangsu, China).
Histological Analysis
Liver samples were fixed in 4% paraformaldehyde and embedded in paraffin wax. Embedded tissues were cut into 4 µm thick sections and stained with hematoxylin–eosin (H&E) for the histological analyses. The histological score of sections was assessed by two pathology experts (Table S3).
TUNEL Assay
Cell apoptosis in the liver tissue was detected by DeadEndTM Fluorometric TUNEL System according to the manufacture’s protocol (Promega, Wisconsin, USA). Paraffin sections were briefly digested by 20 µg/mL of proteinase K solution for 7 min and then equilibrated with equilibration buffer for 10 min at room temperature. The sections were incubated with TdT reaction mix for 60 min at 37℃ in a humidified chamber before being transferred to 2 × SSC buffer for 15 min to stop the reaction. After immersing in propidium iodide solution (PI) for 15 min at room temperature in the dark, the sections were analyzed under a fluorescence microscope. Areas of apoptosis were quantified by Image J (National Institute of Health, Bethesda, MA, USA).
Immunohistochemistry (IHC)
Immunohistochemistry for CYP2E1 was performed with the paraffin-embeded liver sections. Antigen retrieval was carried out by incubation in EDTA buffer after the slides were deparaffinized. Endogenous peroxidase in the section was blocked with 0.3% hydrogen peroxide solution in the dark for 10 min. The sections were incubated with primary antibody against mouse CYP2E1 (1:500, Abcam, Cambridge, UK) at 4℃ for 60 min and then with HRP-conjugated secondary antibodies at room temperature for 15 min. Finally, the sections were stained with DAB substrate and counterstained with hematoxylin. Areas of CYP2E1 expression were quantified by Image J (National Institute of Health, Bethesda, MA, USA).
Real-Time Quantitative PCR (RT-qPCR)
Total RNA was extracted from liver tissues with TRIzol reagent (Invitrogen, Thermo Fisher Scientific, NY, USA). 3 µg of total RNA was reverse-transcribed into complementary DNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, NY, USA) following the supplier’s protocol. The PCR primer sequences are listed in Table 1. RT-qPCR was performed in a StepOnePlus™ Real-Time PCR system (Thermo Fisher Scientific, NY, USA) in combination with TB Green® Premix Ex Taq™ II (Takara Bio, Inc., Shiga, Japan). The reaction was as follows: a precycling stage at 95℃ for 30 s, 40 cycles of denaturation at 95℃ for 5 s and annealing at 60℃ for 30 s. The expression levels, which were normalized to GAPDH, were calculated using the 2−ΔΔCt method.
Table 1
Primers for real-time PCR
Genes | Forward primers (5′-3′) | Reverse primers (5′-3′) |
IL−6 | CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG |
IL−1β | TGTGAAATGCCACCTTTTGA | GGTCAAAGGTTTGGAAGCAG |
TNF-α | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
CYP2E1 | TTTCCCTAAGTATCCTCCGTGAC | CTTAATCGAAGCGTTTGTTGA |
GAPDH | GGTTGTCTCCTGCGACTTCA | TGGTCCAGGGTTTCTTACTCC |
Western Blot
The total protein from liver tissues was extracted by RIPA lysis buffer (Solarbio, Beijing, China) on ice and then quantified using BCA protein assay kit (Solarbio, Beijing, China). The protein was resolved through SDS-PAGE gel separation with a Bio-Rad electrophoresis system and transferred to polyvinylidene difluoride membranes (Millipore, MA, USA). The membranes were blocked with 5% skim milk (BD, USA) for 1.5 h. And then incubated with the following antibodies overnight at 4℃: anti-CYP2E1 (Abcam, Cambridge, UK, 1:2500), anti-IκBα (Cell Signaling, MA, USA, 1:1000), anti-NF-κB P65 (Cell Signaling, MA, USA, 1:1000) and anti-GAPDH (Abcam, Cambridge, UK, 1:2500) antibodies. The blots were incubated with HRP-conjugated secondary antibody (Abcam, Cambridge, UK, 1:8000) at room temperature for 1 h and then quantified by G:BOX gel imaging system (Syngene, Cambridge, UK).
16S rRNA gene sequence analysis
The sequencing service was provided by Personal Biotechnology Co., Ltd. (Shanghai, China). The fecal DNA from each group was briefly extracted by QIAamp DNA Stool Kit (Qiagen, Valencia, USA) and quantified by Nanodrop (Thermo Fisher Scientific, NY, USA). The bacterial 16S rRNA gene V3–4 region was amplified by PCR using the forward primer (338F: 5′-ACTCCTACGGGAGGCAGCA-3′) and the reverse primer (806R: 5′-GGACTACHVGGGTWTCTAAT − 3′). The PCR products were separated and purified with Vazyme VAHTSTM DNA Clean Beads (Vazyme, Shanghai, China) according to manufacturer's recommended instructions. The sequencing library was built up with obtained products and then sequenced on a MiSeq sequencing platform (Illumina, USA). The sequencing data analysis was carried out as previously described[16]. The Chao1, Shannon and Pielou indices were calculated for α-diversity evaluation. UniFrac-based principal coordinates analysis (PCoA) was employed to assess β-diversity. The different abundant bacteria among all groups were performed by hierarchical clustering heatmap. The correlation between gut microbiota and liver injury indicators was analyzed using spearman index. All figures were performed by Personalbio genescloud (https://www.genescloud.cn/chart/). The raw data were deposited into NCBI Sequence Read Archive (SRA) database and accession numbers are SRR12278403-SRR12278407.
Statistical analysis
Statistical analysis was performed with SPSS 22.0 (IBM Corp., NY, USA). All data are presented as the mean ± SD (n = 5). Comparisons between groups were assessed by a one-way analysis of variance (AVONA), and Dunnett's test was employed as a post hoc test. Statistical significance was set at P < 0.05.