Cell Lines
The LLC-OVA murine lung carcinoma cell line was generated as previously described (40). LLC-OVA, B16-F1, and human embryonic kidney (HEK) 293T cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, and 1% penicillin-streptomycin (complete DMEM). Transduced LLC-OVA cells were maintained in complete DMEM with 2 µg/ml puromycin. All cells were cultured at 37°C with 5% CO2.
Lentiviral transduction and CRISPR-Cas9 gene editingLentivirus was generated through transfection of HEK 293 T Cells with packaging plasmids (pMD2.G and psPAX2 vectors) and previously described plasmids containing mouse wild type Ripk3 on a modified lentiviral tet-on pTRIPZ/Puro vector using the TransIT®-Lenti transfection reagent (Mirus Bio, Madison, WI, USA) (3). After 48 hours, the culture supernatant was filtered with 0.45 µm cellulose acetate filters (VWR, Radnor, PA, USA) to collect RIPK3-encoding lentivirus. LLC-OVA cells were incubated with lentivirus in complete DMEM containing polybrene (8 µg/mL) for an additional 48 hours. Transduced cells were selected with 2 µg/ml puromycin.
For generating RIPK1, CASP8 and MLKL-deficient cell lines, the following guide RNA (gRNA) sequences were cloned into LentiCRISPRv2-Blast lentiviral vector [a gift from Mohan Babu; Addgene plasmid # 83480]: 5’- CAGACTGAGACACAGTCGAG-3’ (murine Ripk1 gRNA #1), 5’- TGTGAAAGTCACGATCAACG-3’ (murine Ripk1 gRNA #2), 5’-AGACGACACCCTTGTCACCG-3’ (murine Casp8 gRNA #1), 5’-AGATGTCAGGTCATAGATGG-3’ (murine Casp8 gRNA #2), 5’-CAAAGTATTCAACAACCCCC-3’ (murine Mlkl gRNA #1), 5’- AGGAACATCTTGGACCTCCG-3’ (murine Mlkl gRNA #2). Constructs were transduced into LLC OVA cells as described above and selected in Blasticidin (8 µg/mL).
Mice
Age- and sex-matched mice of C57BL/6J background were used for these experiments unless otherwise specified. C57BL/6J (Stock No: 000664), OT-II (B6.Cg-Tg(TcraTcrb)425Cbn/J, Stock No: 004194), CD45.1 (B6.SJL-PtprcaPepcb/BoyJ, Stock No: 002014), and IFN-αR−/− (B6(Cg)-Ifnar1tm1.2Ees/J, Stock No: 028288), mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). Batf3-/- mice (B6.129S(C)-Batf3tm1Kmm/J) were kindly provided by Dr. Dee Gunn (Stock No: 013755). All mice were housed in a specific pathogen-free (SPF) facility at Duke University and maintained according to protocols approved by the Duke University Institutional Animal Care and Use Committee.
In vivo prophylactic dying tumor cell immunization
Tumor cells were seeded on 15-cm tissue culture dishes and cell death was induced in vitro by treating cells with DOX (1 µg/ml) for 9 hours followed by MG132 (4 µM, APExBio, Houston, TX, USA) for 4.5 hours. Dying tumor cells were then collected, washed twice in PBS (Thermo Fisher Scientific, Waltham, MA, USA), then re-suspended at 7.5 x 106 cells/mL in PBS. Mice were immunized subcutaneously with 7.5 x 105 cells (100 µl) in the right flank. On day 8 after vaccination, mice were challenged subcutaneously on the left flank with 5 x 105 live tumor cells suspended in serum free-DMEM mixed 1:1 with Matrigel (Matrigel® Basement Membrane Matrix, LDEV-free, Corning Life Sciences, Tewksbury, MA, USA). Tumor growth on the challenge site was evaluated using calipers. Tumor volume was calculated using the formula: 0.5 x long axis x short axis2. Mice were euthanized if tumors exceeded 2000 mm3.
In vivo antibody administration
For INFAR1 blockade, 1 mg of anti-IFNAR-1 antibody (clone MAR1-5A3, Bio X Cell, Lebanon, NH, USA) or isotype control was administered to mice intravenously via retroorbital injection the day prior to dying cell immunization. For T cell depletion, 350 µg of anti-CD8 (clone YTS 169.4, Bio X Cell), anti-CD4 (clone GK1.5, Bio X Cell), or Isotype control was administered to mice intravenously prior to dying cell immunization. Where indicated, an additional 150 µg of anti-CD8, anti-CD4, or Isotype control was administered on the day prior to dying cell immunization.
OT-II adoptive transfer
For OT-II adoptive transfer experiments, spleens were collected from congenic OT-II mice, mechanically homogenized and filtered through a 70 µM cell strainer. Erythrocytes were then lysed using ACK Lysis Buffer (150 mM NH4Cl, 10 mM KHCO3, 0.1 mM Na2EDTA). Splenocytes were subsequently counted and the percentage of CD4+ T cells was determined by flow cytometry. Splenocytes were resuspended in RPMI at 10 x 106 CD4+ T cells/mL and 100 µl was administered to mice intravenously via retroorbital injection.
Splenocyte co-culture with necroptotic cells
For expansion of endogenous myeloid populations in vivo, mice were implanted subcutaneously on the flank with 2.5 x 105 cells Flt3L expressing B16 cells (B16-Flt3L) (41). On day 14 post-tumor implantation, spleens were collected, minced and digested in HBSS with Ca and Mg (Thermo Fisher Scientific) + 5% FBS + 10mM HEPES + 2 mg/mL Type IV Collagenase (Sigma, St. Louis, MO, USA C-5138) + 10 IU/ml DNase I (Sigma D4263-1VL) for 30 minutes at 37°C. Spleens were then homogenized and filtered through a 70 µM cell strainer. Erythrocytes were then lysed using ACK Lysis Buffer (150 mM NH4Cl, 10 mM KHCO3, 0.1 mM Na2EDTA).
Cell death was induced in tumor cells with DOX (1 µg/ml) for 9 hours followed by MG132 (4 µM, APExBio) for 4.5 hours. Dying cells were collected for co-culture. Dying tumor cells and splenocytes were co-cultured at a 10:1 ratio in a 24 well plate with 0.5 mL of RPMI 1640 with 10% fetal bovine serum (FBS), 1% Non-essential Amino Acids, 1% sodium pyruvate, 2 mM L-glutamine, and 1% penicillin-streptomycin. Cells were harvested 8 and 24 hours later for flow cytometry analysis.
Flow cytometry
Single cell suspensions were obtained from tumors by digesting minced tumor tissue in complete RPMI containing type IV collagenase (1 mg/ml, Sigma C-5138) and deoxyribonuclease I (20 IU/ml, Sigma D4263-1VL) at 37°C with gentle agitation for 30 minutes followed by tissue homogenization. Cell suspension was then passed through a 70 µM cell strainer. Erythrocytes were lysed using ACK Lysis Buffer. Two million cells were stained with LIVE/DEAD fixable aqua dead cell stain kit (Thermo Fisher Scientific) for 30 mins at 4°C. Cells were incubated with Fc-blocking antibody (clone 2.4G2) for 15 mins prior to incubation with fluorochrome-conjugated antibodies in 1x PBS, 2% FBS, and 2 mM EDTA at 4°C for 30 mins. Flow cytometry was performed on a BD Fortessa instrument. Analysis of flow cytometry data was done using FlowJo Treestar) software (version 10.8.1).
Cells were stained with the following antibodies: NK1.1 (PK136, FITC), CD11b (M1/70, PerCP-Cy5.5), CD11b (M1/70, PE-Cy7), CD19 (6D5, PE-Cy7), CD3 (17A2, APC), CD3 (17A2, FITC), I-A/I-E (M5/114.15.2, AlexaFluor 700), CD8β (YTS156.7.7, APC-Cy7), CD45-2 (104, Pacific Blue, CD45-2 (30-F11, BV605), CD45-1 (A20, FITC), Ly6C (HK1.4, BV605), B220 (RA3-6B2, BV650), XCR1 (ZET, BV785), CD11c (N418, PE), CD4 (GK1.5, PE-Cy5), Ly6G (1A8, PE-Dazzle594), F4/80 (BM8, PE-Cy7, Sirpα (P84, APC), CD80 (16-10A1, PE-Dazzle594), CD44 IM7, BV711), CD62L (MEL-14, PE), PD-1 (29F.1A12, PE-Cy7) from Biolegend (San Diego, CA, USA) and TCR-β (H57-597, APC) from eBiosciences (San Diego, CA, USA).
NanoString RNA analysis and qRT-PCR
To assess tumor cell cytokine production, cell death was induced in tumor cells using DOX and MG132. Total RNA was isolated using the Qiagen RNeasy Mini Kit (Qiagen). For Nanostring analysis, RNA was run on a NanoString nCounter Pro Analysis System using an nCounter Mouse Tumor Signaling 360 Panel (Nanostring, Seattle, WA, USA). Data were normalized and analyzed using ROSALIND software (NanoString). We thank the Duke University School of Medicine for the use of the Microbiome Core Facility, which provided NanoString Gene Expression service. For qPCR, cDNA was synthesized using the iScripts cDNA synthesis kit (Bio-Rad 170–8891). Thermal cycling reaction was then performed using iQ™ SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA 170–8882) and a CFX Connect Real-Time PCR Detection System (Bio-Rad). Cycle threshold (CT) values for target genes were normalized to CT values of the housekeeping gene Tbp1 (ΔCT = CT(Target) – CT(Tbp1)) and subsequently normalized to baseline control values (ΔΔCT = ΔCT(Experimental) – ΔCT(Control)).
Primers:
Mtbp | Forward | CAAACCCAGAATTGTTCTCCTT |
Reverse | ATGTGGTCTTCCTGAATCCCT |
Tnf | Forward | CCCACTCTGACCCCTTTACT |
Reverse | TTTGAGTCCTTGATGGTGGT |
Ccl2 | Forward | AGGTGTCCCAAAGAAGCTGTA |
Reverse | ATGTCTGGACCCATTCCTTCT |
Cxcl1 | Forward | CGAAGTCATAGCCACACTCAA |
Reverse | GAGCAGTCTGTCTTCTTTCTCC |
Ifnb1 | Forward | AATTTCTCCAGCACTGGGTG |
Reverse | AGTTGAGGACATCTCCCACG |
Ifit1 | Forward | CACCAGTATGAAGAAGCAGAGAG |
Reverse | GCCATAGCGGAGGTGAATATC |
Ifi44 | Forward | GGGCTGTGATGAAGATGGAA |
Reverse | CCCAGTGAGTCACACAGAATAA |
Ifi208 | Forward | GCACAGAGAAGAGAAGGAGAAA |
Reverse | CTGTTGTCTGTGGTGGAGATAG |
Ifi213 | Forward | GATGGAAGCTTGGGAAGTAGAA |
Reverse | GAGAGAACGAGCTTAGTGGATG |
Tgtp1 | Forward | CTTCCCAAAGCTGGAAACTAAAC |
Reverse | GTTAATGGTGGCCTCAGTAAGA |
Tgpt2 | Forward | CTTCCCAAAGCTGGAAACTAAAC |
Reverse | GTTAATGGTGGCCTCAGTAAGA |
RNAseq
Total RNA was extracted from single cell suspensions from tumor tissues. A mRNA library was prepared using the DNBSEQ platform by BGI with data filtering using the SOAPnuke software (42). HISAT2 was selected to map the filtered sequenced reads to the reference genome. BAM files containing mapping results were counted using the featureCounts function using Python. Counting was performed using the mouse genome for comparison. Downstream analyses were performed using iDEP.96 web interface (43). DEG analysis was then performed using DESeq2 considering all genes with FDR ≤ 0.1 and 1 ≤ Log2FC ≤ -1. Functional analysis of genes with FDR ≤ 0.1, regardless of Log2FC, comprised of GO and GSEA (Gene Set Enrichment Analysis) analyses. For GSEA, gene sets used in this assessment included curated gene sets, known pathways (KEGG), and gene ontology terms (Biological Process & Molecular Function).
Incucyte Cell Death Assays
Cells were seeded in a 96-well plate with 10,000 cells per well in 200 µl complete growth medium. Eight hours prior to cell death initiation, medium was exchanged for Complete DMEM with DOX (1 µg/ml) or DMSO. Cells were subsequently treated with MG132 (4 µM, APExBio). Imaging was subsequently performed using the IncuCyte S3 (Sartorius, Göttingen, Germany; version 2021C). Nine images per well were captured, analyzed, and averaged. Cell death was assessed through measuring uptake of YoYo-1 (50 nM, Thermo Fisher Scientific) and expressed as the area of YoYo-1+ cells as a percentage of the total phase area. In experiments where zVAD-fmk and GSK’843 were used, zVAD-fmk (20 µM, APExBio) was administered 30 minutes prior to treatment with GSK’843 (20 µM, Sigma) and MG132.
Western blot
Cell lysates were prepared in RIPA buffer containing 0.15 M NaCl, 0.05 M Tris (pH 8.0), 0.1% SDS, 0.5% Sodium deoxycholate, and 1% Nonidet P-40 supplemented with Protease (Roche, Basel, Switzerland11836145001) and Phosphatase inhibitor cocktails (Sigma P5726). Protein concentration was determined using a BCA Protein Assay (Thermo Fisher Scientific). The proteins were separated by SDS-PAGE and transferred to nitrocellulose membranes. Primary antibodies used were anti-MLKL phospho-S345 (Cell Signaling Technology, Danvers, MA, USA 37333), anti-MLKL (Cell Signaling Technology, 37705), anti-RIPK3 phospho-S232 (Abcam, Cambridge, United Kingdom, ab195117), anti-RIPK3 (Genentech, San Francisco, CA, USA, PUR135347), anti-RIPK3 (Prosci, Poway, CA, USA, 2283), anti-RIPK1 (BD Biosciences, Franklin Lakes, NJ, USA, 610459), anti-cleaved caspase-3 (Cell Signaling Technology, 9664), anti-caspase-8 (Enzo, Farmingdale, NY, USA, ALX-804-447-C100), anti-p65 phospho-S536 (Cell Signaling Technology, 3033), anti-p65 (Santa Cruz Biotechnology, Dallas, TX, USA sc-8008), anti-IκBα phospho-S32/36 (Cell Signaling Technology, 9246), anti-IκBα (Cell Signaling Technology, 4814), anti-Actin (Cell Signaling Technology, 3700). HRP-conjugated goat anti-rabbit immunoglobulin G (IgG) (111-035-144), rabbit anti-mouse IgG (315-035-008) or goat anti-rat IgG (112-035-175) were obtained from Jackson ImmunoResearch Laboratories Inc (West Grove, PA, USA). After incubation with the appropriate secondary antibodies, membranes were incubated with Clarity ECL western blotting substrate (Bio-Rad, 170–5061) or Clarity Max ECL (Bio-Rad, 170–5062).
Statistics
Statistical analysis was performed in GraphPad Prism (version 9). Unpaired two-tailed Student’s t-test was used to compare two independent groups. Tukey’s multiple comparison test, or one-way Analysis of variance (ANOVA) or two-way ANOVA were used to compare multiple (> 2) groups with one or two independent variables, respectively; with multiple comparisons tests as indicated. P values > 0.05 were considered statistically non-significant. *p value < 0.05, **p value < 0.01, ***p value < 0.001, ****p value < 0.0001.