Cultured IVB5 cell-line of Acropora tenuis

Details of production of stable in vitro cell-culture lines originating from planula larvae of the coral Acropora tenuis are described in Kawamura et al. (2021a). IVB5 is one of 20 cryo-preservable lines and has been cultured in basic seawater medium consisting of natural seawater, one-fifth volume of H2O, 10 mM HEPES (final pH 6.8), and the antibiotics penicillin (100 U/mL), streptomycin (100 µg/mL), and amphotericin B (0.25 µg/mL). Immediately before experiments, the basic medium was mixed with Dulbecco's modified Eagle's medium (DMEM) containing 15% fetal bovine serum at a ratio of 9:1. The IVB5-line is polyclonal, but major components are dark, flattened, amorphous cells (FACs), 20–40 µm in length (Fig. 1A). FACs are considered interchangeable with spherical, brilliant cells (Fig. 1B). When dark amorphous cells were resuspended in a 24-well multiplate filled with growth medium, they became flat and extended lamellipodia and filopodia with moderate locomotor activity. These flattened amorphous cells likely have properties of gastroderm cells (Kawamura et al., unpublished) and they exhibit in vitro symbiosis with algal cells (Kawamura et al., 2021b).

Symbiodiniaceae strains, culture, and cell size measurements

Five culturable strains of four species of the family Symbiodiniaceae (Coffroth and Santos, 2005; Yamashita and Koike, 2013; Jeong et al., 2014; LaJeunesse, 2017; LaJeunesse et al., 2018) were used in this study: Symbiodinium microadriaticum (culture ID, AJIS2-C2), S. microadriaticum (culture ID, CCMP828), Breviolum minutum (Mf1.05b), Cladocopium sp. (Y103), and Effrenium voratum (GY-H50-E) (Fig. 2; and see   Supplementary Table S1 (zs230045_TableS1.pdf)). All strains were pre-cultured at 20°C with standard IMK medium (Sanko Jyunyaku, Tokyo) using an incubator (SANYO MIR-554) under 12 h:12 h dark and light conditions using a fluorescent lamp producing 20 µmol/m²/s (Kawamura et al., 2021b).

Identities of strains were reconfirmed by sequencing ITS2 parts of their genomes according to the method of Stat et al. (2009) (see   Supplementary Figure S1 (zs230045_FigS1.pdf)). The primer sequences used were itsD forward: GTGAATTGCAGAACTCCGTG and its2rev2 reverse: CCTCCGCTTACTTATATGCTT. Amplified DNAs were sequenced with a SeqStudio Genetic Analyzer (Applied Biosystems). The sequences obtained were compared to previously determined sequences to confirm identity. Draft genomes of the strains AJIS2-C2, Mf1.05b, and Y103 were available (Shoguchi et al., 2013, 2018; Yoshioka et al., 2021) (see   Supplementary Table S1 (zs230045_TableS1.pdf)). CCMP828 and GY-H50-E, for which draft genomes are not available, were characterized by partial sequencing of 28S rDNAs on a SeqStudio Genetic Analyzer (Applied Biosystems). A database for BLASTN: GeoSymbio_ITS2_LocalDatabase (4).fasta ( https://sites.google.com/site/geosymbio/downloads) (Franklin et al., 2012) was also used for comparison. Details of the strains are as follows.

Symbiodinium microadriaticum strain AJIS2-C2 (ITS2 type A1] (Fig. 2): This strain was originally isolated from the coral Acropora sp. at Ishigaki Island, Okinawa, Japan (Yamashita and Koike, 2013). Sequences showed that this strain is ITS2 type A1 (see   Supplementary Figure S1A (zs230045_FigS1.pdf)). It was maintained in the laboratory of Dr. Hiroshi Yamashita at the Fisheries Technology Institute, Japan Fisheries Research and Education Agency, and then transferred to the Marine Genomics Unit at Okinawa Institute of Science and Technology Graduate University (OIST) (Yoshioka et al., 2021).

Fig. 1.

Configuration of the coral cell line, IVB5. (A) Lower magnification of flattened amorphous cells (FACs). Bar, 100 µm. (B) FACs (black arrowheads) and spherical brilliant cells (white arrowhead) are considered functionally interchangeable. Bar, 50 µm. (C) Coral cells 3 days after algal inoculation. Broken circles show “fatty cells” engulfing algae. Black arrowheads show FACs. Red arrowhead shows an alga. Bar, 50 µm. (D) Higher magnification of “fatty cells” (broken circle). Black arrowheads show FACs. Bar, 50 µm. (E) AtSnail immunocytochemistry of FACs 2 hours after algal inoculation. Bars, 20 µm. (E1) Dark field image. White arrowheads show nuclei with Snail-expression (green). Alga emits red autofluorescence. (E2) Fluorescent image merged with bright field image.

Symbiodinium microadriaticum strain CCMP828 (ITS2 type A1) (Fig. 2): This strain was originally isolated from the jellyfish Cassiopeia xamachana and was obtained from the National Center for Marine Algae and Microbiota (NCMA), Boothbay Harbor, Maine ( https://ncma.bigelow.org/CCMP828). Sequences showed that this strain is ITS2 type A1 (see   Supplementary Figure S1B (zs230045_FigS1.pdf)).

Breviolum minutum [ITS2 type B1) (Fig. 2): B. minutum (LaJeunesse et al., 2018), previously named Symbiodinium minutum (LaJeunesse et al., 2012), was originally harbored by the Caribbean coral Orbicella faveolata (previously Montastraea faveolata), maintained in the laboratory of Dr. Mary Alice Coffroth, at State University at New York, Buffalo, United States and then in the MGU at OIST and Sekida's laboratory of Kochi University. The culture ID of this strain is Mf1.05b (McIlroy and Coffroth, 2017), and it is currently provided through National Institute of Environmental Science, Tsukuba, Japan under  https://mcc.nies.go.jp/strainList.do?strainId=3806 upon request. For sequences for ITS2 type B1, see   Supplementary Figure S1C (zs230045_FigS1.pdf).

Cladocopium sp. (ITS2 type C92) (Fig. 2): Cladocopium sp. (LaJeunesse et al., 2018) was originally derived from the cardiid clam Fragum sp. in Okinawa, Japan, and was isolated by Prof. Terufumi Yamasu at the University of the Ryukyus. The culture ID of this strain is Y103. It has been maintained in the laboratory of Prof. Michio Hidaka at the University of the Ryukyus, and then transferred to laboratories at OIST and Kochi University. This strain is currently provided through the National Institute of Environmental Science, Tsukuba, Japan under  https://mcc.nies.go.jp/strainList.do?strainId=4075 upon request. For sequences of ITS2 type C92, see   Supplementary Figure S1D (zs230045_FigS1.pdf).

Effrenium voratum (ITS2 type E1) (Fig. 2): E. voratum (LaJeunesse et al., 2018) was originally derived from the East China Sea and maintained as a monoclonal line in the laboratory of Dr. Hongwei Zhao at the College of Ecology and Environment & State Key Laboratory of Marine Resource Utilization in South China Sea of Hainan University and then transferred to OIST and Kochi University. The culture ID of this strain is GY-H50-E. For sequences of ITS2 type E1, see   Supplementary Figure S1E (zs230045_FigS1.pdf).

Measurement of cell size

Symbiodiniaceae strains in culture exhibit three types of morphology: mastigote (motile, with flagella), coccoid (spherical, no flagella), and doublet (dividing, no flagella) (Jeong et al., 2014). Cell size was determined with images of the coccoid stage (Fig. 2). Cells were photographed under differential interference contrast (DIC) imaging using a Zeiss Axio Imager Z1 microscope equipped with an AxioCam digital camera (Zeiss, Jena, Germany). Ten individuals were measured manually using Adobe Photoshop CS6 (version 13.0), and mean cell sizes were calculated.

In vivo experiments with incorporation of dinoflagellates by coral larvae

Five strains of Symbiodiniaceae for infection tests were cultured in the MGU at OIST (Shoguchi et al., 2018). Symbiodinium microadriaticum AJIS2-C2 has been maintained in Daigo's IMK medium (Sanko Jyunyaku, Tokyo), plus three antibiotics, ampicillin (100 µg/mL), kanamycin (50 µg/mL), and streptomycin (50 µg/mL). The culture medium of the other four Symbiodiniaceae strains included artificial seawater containing 1x Guillard's (F/2) marine-water enrichment solution (Sigma-Aldrich) with three antibiotics. Pre-cultures for infection experiments were maintained for more than 1 week without antibiotics.

Fig. 2.

Five strains of four species of the family Symbiodiniaceae used in this study. Morphology of immobile coccoid cells is shown above, and average cell sizes (length and width) are shown with bars representing standard errors. Symbiodinium microadriaticum AJIS2-C2, S. microadriaticum CCMP828, Breviolum minutum Mf1.05b, Cladocopium sp. Y103, and Effrenium voratum GY-H50-E. See   Supplementary Table S1 (zs230045_TableS1.pdf) for further information of dinoflagellate strains.

Co-cultures involving Acropora larvae and Symbiodiniaceae were started at larval ages of 8.5 and 12.5 days. Acropora larvae were kindly provided in early June of 2019 by Mr. Shuichi Mekaru at Onna Fisheries Co., Onna, Okinawa. ∼80 larvae were cultured with 40 mL of filtered seawater in a petri dish. Each Symbiodiniaceae strain was added to the dishes at ∼600 cells/mL final density. Control petri dishes without cultured Symbiodiniaceae cells were prepared to confirm the absence of contamination. Co-culture dishes were put into an incubator CLE-305 (TOMY, Japan) set at 25°C and ∼20 µmol/m²/s (12 h light:12 h dark cycle) (Cumbo et al., 2013). After infection for 3 to 12 days, alga-infected larvae were detected by observation of 10 embryos under a Zeiss Axio Imager Z1 microscope (Zeiss, Germany). Observed larvae were trapped between a glass slide and a coverslip and were prevented from swimming. Counts of algal cells within larval bodies were performed by mildly crushing larvae with coverslips. The percentage of Symbiodiniaceae-infected larvae was calculated as described in Yamashita et al. (2018).

Observation of in vitro symbiosis

A 200–250-µL drop of culture medium containing dinoflagellates or latex beads was added to each well of a 24-well multiplate, which contained approximately 1 mL of medium for culturing cells of the IVB5 line. A 24-well multiplate that contained cultured coral cells and algae was put in a translucent, moist container and exposed to natural lighting at 20–22°C throughout culture and observation. Immediately after addition, interactions between the coral cells and dinoflagellates were observed using an inverted microscope (Olympus CKX41) equipped with a color digital camera (WRAYMER SR300) (Kawamura et al., 2021b). Photos obtained by consecutive observation with time-lapse video (2–3-s interval) was converted to a time-lapse video using iPhoto. Pictures and videos were also taken with an ordinary microscope (Nikon Eclipse 80i) equipped with a differential interference contrast (DIC) apparatus

We also examined whether coral cells retained the capacity for inoculation with dinoflagellates after they were cultured for several days since the first phagocytosis. In order to distinguish dinoflagellates used for the first and second inoculations, dinoflagellates of the second inoculation were labelled with DiI. The labelling was carried out by immersing dinoflagellates in a solution that contained 0.02% DiI in sterile seawater (Setareh Biotech) for 10 min.

Non-ionic latex beads

This study also examined whether cultured coral cells engulf inorganic materials such as latex beads. Microspheres called latex beads or latex particles were purchased from Fisher Scientific (Catalog ID, N37464). They are spherical particles, 10 µm in diameter, in the colloidal size range and are formed from an amorphous polymer, such as polystyrene.

Immunocytochemistry

Approximately 5 × 10⁶ FAC cell suspension was fixed in 2% paraformaldehyde for 15 minutes at room temperature. After quenching with 200 mM glycine in phosphate-buffered saline (PBS) for 5 minutes, the cell suspension was incubated for 30 minutes in the blocking solution containing 2.5% skim milk, 0.25% blocking reagent (Roche, Mannheim, Germany), 0.5% nonidet p-40, and 0.2% Triton X-100. Rabbit anti-AtSnail antibody (Kawamura et al., 2021a) was diluted 1000-fold with 0.1% Tween 20 in PBS (PBST). It was incubated with the cell suspension overnight at 4°C. Goat anti-rabbit IgG labeled with fluorescein isothiocyanate (FITC) (Vector Laboratory, Burlingame, CA, USA) was diluted 200-fold with PBST. Samples were stained with the secondary antibody for 0.5 h at room temperature. They were observed under a confocal microscope (ECLIPSE C1si system; Nikon, Japan).

Coral cell symbiosis with different Symbiodiniaceae strains

Coral cells of dark, flattened morphology actively extended and retracted pseudopodia and showed elevated locomotor activity soon after algae were added to culture dishes (Kawamura et al., 2021b). Coral cells endocytosed symbiotic algae within 30 min, after which, algae were surrounded by host cytoplasmic membrane (Sekida et al., unpublished). Cultured cells that engulfed algal cells changed their morphology from a dark flattened form to a spherical ‘fatty’ form (Fig. 1C, D). Cells that engulfed algae as well as the not-engulfed algae showed positive signals of AtSnail antibody of A. tenuis in the nucleus, indicating that the cultured cells that engulfed algae originated from the coral (Fig. 1E1, E2). Bacteria-like microorganisms are often observed in vacuoles of coral cell cytoplasm (Sekida et al., unpublished), suggesting that coral cells endocytose micro-organic materials. Our previous study showed that approximately 45% of IVB5 cells incorporated B. minutum within 24 h after inoculation (Kawamura et al., 2021b). To determine whether coral cells engulf dinoflagellates of other genera or stains of Symbiodiniaceae, in vitro endocytosis was examined using four additional strains, Symbiodinium microadriaticum AJIS2-C2 and CCMP828, Cladocopium sp. Y103, and Effrenium voratum GY-H50-E (Fig. 2, and see   Supplementary Table S1 (zs230045_TableS1.pdf)). In addition, as a control, we examined phagocytosis of these strains by intact planula larvae.

(a) Engulfment in vivo: Yamashita et al. (2014) reported that planula larvae of A. tenuis incorporated clade A (Symbiodinium) most effectively (60–100% of larvae), clade D (Durusdinium) less effectively (20–100%), and clade B (Breviolum) least effectively (10–40%), but larvae did not incorporate clade C (Cladocopium). We examined incorporation rates of different Symbiodiniaceae species at two larval stages, 8.5 and 12.5 days after fertilization, and two observation periods, 3–6 and 10–12 days after addition of dinoflagellates (Fig. 3). Under our experimental conditions, A. tenuis planula larvae incorporated Symbiodinium AJIS2-C2 and CCMP828 and Breviolum Mf1.05b. Approximately 70%, 50%, and 30% of larvae incorporated Symbiodinium AJIS2-C2 and CCMP828, and Breviolum, respectively (Fig. 3). In contrast, A. tenuis planula larvae did not engulf Cladocopium sp. Y103 (Fig. 3). Larvae at 3–6 days were not infected with Effrenium GY-H50-E, but approximately 10% of 12.5-day larvae engulfed Effrenium (Fig. 3). In general, 12.5-day larvae exhibited higher ratios of incorporation than 8.5-day larvae (Fig. 3). Larvae incorporated more algae at longer periods of infection (10–12 days after infection) than at shorter periods (3–6 days) (Fig. 3). These results were comparable to those of Yamashita et al. (2014).

Fig. 3.

Engulfment ratios when Acropora tenuis planula larvae were mixed with dinoflagellates in vivo. From left to right: Symbiodinium microadriaticum AJIS2-C2, S. microadriaticum CCMP828, Breviolum minutum Mf1.05b, Cladocopium sp. Y103, and Effrenium voratum GYH50-E. Dinoflagellates were added to larvae 8.5 and 12.5 days after fertilization. Ratios of larvae that engulfed dinoflagellates were scored at 3–6 days (green bars) and 10–12 days (red bars) after mixing the two organisms.

Fig. 4.

Scatterplots showing the infection rate of cultured IVB5-line cells that incorporated five species of dinoflagellates in vivo. From left to right: Symbiodinium microadriaticum AJIS2-C2, S. microadriaticum CCMP828, Breviolum minutum Mf1.05b, Cladocopium sp. Y103, and Effrenium voratum GY-H50-E. (A, B, C) One day, 2 days, and 3 days after mixture of the two organisms. Results are expressed as the mean ± standard deviations of more than 10 measurements. P-values were calculated with a two-tailed Student's t-test.

(b) Engulfment in vitro: Cultured IVB5-line cells incorporated all four clades of dinoflagellates, but the infection ratio differed significantly between Symbiodinium/Breviolum and Cladocopium/Effrenium (Fig. 4). Approximately 41%, 55%, and 40% of cultured cells endocytosed Symbiodinium AJIS2-C2 (Fig. 4) and CCMP828 (Figs. 4; 5A1, A2) and Breviolum (Figs. 4; 5B1, B2), respectively, within 1 day of mixture. CCMP828 always showed the highest rate of uptake among the five strains (Fig. 4). In contrast, the rates of Cladocopium and Effrenium incorporation were quite low; only 6% of cultured cells engulfed Cladocopium (Figs. 4; 5C1, C2) and Effrenium (Figs. 4; 5D1, D2).

In addition, a group constituted of Symbiodinium/Breviolum and another group of Cladocopium/Effrenium showed different alga-host cell interactions after incorporation. Symbiodinium and Breviolum provoked an immediate response of cultured cells, in which cultured cells engulfed these species as soon as 5 min after inoculation. One day later, algal uptake plateaued (Fig. 5A1, B1), and then gradually decreased (Figs. 4; 5A2, B2). For example, approximately 40% of coral cells engulfed Breviolum within 1 day and this symbiotic state continued for at least 1 week (Figs. 4, 5B). The symbiotic state, however, did not extend beyond 10 days, and most coral cells with Breviolum disappeared within 20 days. Similarly, Symbiodinium AJIS2-C2 disappeared from host cells after 4 weeks and CCMP828 after 5 weeks (Figs. 4, 5A2). Host coral cells gradually recovered the dark flattened morphology (Fig. 5A1). This is likely caused by host cell exocytosis or digestion of algal cells since fragments of dinoflagellates were found in the coral cell cytoplasm (Fig. 5A1, B2).

Fig. 5.

Differential affinity between algal species and coral cells. (A) Symbiodinium microadriaticum CCMP828. (B) Breviolum minutum Mf1.05b. (C) Cladocopium sp. Y103. (D) Effrenium voratum GY-H50-E. White arrowheads show coral cells engulfing algae. Red arrowheads show fragmented algae in a coral cell body. (A1–D1) One day after inoculation. Nomarski differential interference contrast microscopy. Bars, 20 µm. (A2, B2) Three days after inoculation. Inverted phase contrast microscopy (IPC). Bars, 50 µm. (C2, D2) 48 days after inoculation, IPC. Bars, 50 µm.

On the other hand, in the case of Cladocopium and Effrenium, incorporation occurred at a very low rate until the third day of infection (Fig. 4; Fig. 5C1, D1). Then, host cells with Cladocopium and Effrenium slightly increased in number until 2 weeks, and up to 50 % by 3 weeks of inoculation (data not shown). Algae were maintained by cultured cells at such an incorporation ratio for more than 7 weeks after inoculation (Fig. 5C2, D2). Host cells retained a spherical form (Fig. 5C2, D2).

(c) Capacity for algal engulfment of coral cells that once lost symbiotic dinoflagellates: As mentioned above, infection was maintained for 4 weeks for Symbiodinium and 2 weeks for Breviolum, and likely dissolved thereafter. We examined the capacity of cultured cells for phagocytosis after disappearance of algae from the first inoculation. Namely, additional algae were supplied to dark flattened cells 31 days after the primary inoculation of Symbiodinium CCPM828 (Fig. 6A2) and 51 days after the primary inoculation of Breviolum (Fig. 6B1). One day later, infection was re-established by host cells (Fig. 6A2, B2). Thus, phagocytosis by coral cells can occur if algae are available to host cells at least 1 month after the first inoculation.

We further examined whether in vitro cultured cells having algae in the cytoplasm continue to incorporate additional algae if they are available. Fresh algae were labeled with DiI (Fig. 6C1) and administered to cultured cells 5 days after the first administration of algae (Fig. 6C1). In a few hours, unlabeled and labeled algae were found in single cultured cells (Fig. 6C1). Three days after the secondary inoculation, most cultured cells still had DiI signals, and some cells had remnant DiI signals without algae (Fig. 6C2). These signals would have come from incorporated algae, suggesting algal digestion by coral cells or exocytosis of incorporated algae by coral cells.

In vitro endocytosis of coral cell with latex beads

Finally, we examined whether coral cells respond in vitro to inorganic materials such as latex beads and engulf them in the same way as they do symbiotic dinoflagellates. Since dinoflagellates range from 7 to 14 µm (Fig. 2), we selected latex beads of 10 µm and compared responses of coral cells toward beads with responses toward live dinoflagellates. Latex beads did not cause elevated locomotor activity of coral cells as seen in inoculation with Symbiodinium and Breviolum. In controls, 1 day after application, many cultured cells had engulfed Symbiodinium and Breviolum (Figs. 7A, 8A). On the other hand, latex beads were attached to surfaces of coral cells and in several cases, they were found in cell bodies (Fig. 8B). Approximately 10% of cells engulfed beads within 1 day (Fig. 7A). The number of beads associated with single coral cells increased by 2 days of bead application (Figs. 7B, 8C); however, unlike algal uptake, the number of coral cells with incorporated beads did not increase significantly thereafter (Figs. 7C, 8D). In addition, coral cells that endocytosed beads remained dark and flattened and did not become spherical (Fig. 8D). It is highly likely that coral cells are able to endocytose inorganic beads in a different manner from endocytosis of symbiotic dinoflagellates.

Fig. 6.

Effect of additional algae applied to coral cells that lost dinoflagellates after 2 weeks in a symbiotic state. (A) S. microadriaticum CCMP828. (B) B. minutum Mf1.05b. (A1) 31 days after the primary inoculation of algae. Bar, 50 µm. (A2) One day after the secondary inoculation. Broken circles show coral cells engulfing algae. Bar, 20 µm. (B1) 51 days after the primary inoculation of algae. Bar, 50 µm. (B2) One day after the secondary inoculation. Bar, 50 µm. (C) Secondary engulfment of S. microadriaticum CCMP82 marked with DiI (yellow arrowhead). White arrowheads show dinoflagellates engulfed after the primary inoculation. Blue arrowheads show algae not incorporated. Bars, 20 µm. (C1) A few hours after inoculation. (C2) Three days after inoculation showing coral cells that secondarily engulfed algae. White broken circle shows a coral cell that exhibits remnant DiI fluorescent signals without algae.

Fig. 7.

Scatterplots showing the incorporation rate of latex beads in cultured IVB5 cells. As controls, Symbiodinium microadriaticum AJIS2-C2, S. microadriaticum CCMP828, Cladocopium sp. Y103, and Effrenium voratum GY-H50-E were used. (A, B, C) One day, 2 days, and 3 days after mixture of the two organisms. Results are expressed as the mean ± standard deviations of more than 10 measurements. P-values were calculated with a two-tailed Student's t-test.

Fig. 8.

In vitro coral cell phagocytosis of latex beads. (A) Control, 1 day after mixing IVB5 coral cells with algae. Bar, 20 µm. (B) Latex beads mixed with coral cells, 1 day after mixing. Approximately 10% of cells had endocytosed beads. Bar, 50 µm. (Inset) Enlargement of a cell that engulfed two beads. Bar, 20 µm. (C) Two days after coral cell-bead mixing. Broken circles show coral cells engulfing several beads. Bar, 50 µm. (D) Three days after coral cell-bead mixing. Most cells were dark and flattened, having pseudopodia for motility. This contrasts with endocytosis of dinoflagellates, in which coral hosts became spherical (see Fig. 1C, D). Bar, 50 µm.