Genetic and Morphological Variability among the Isolates of Fusarium oxysporum f. sp. lentis causing Wilt of Lentil

Lentil (Lens culinaris) is the most nutritious pulse after chickpea. It is mostly cultivated in in north east and central parts of India during Rabi season. It is commonly damaged by vascular wilt caused by Fusarium oxysporum f.sp. lentis in all lentil grown regions. Wider adaptability of the pathogen strongly indicates the probability of existence of variants. Molecular and morphological variability in different lentil grown areas is in reports (Datta et al., 2011; Mohammadi et al., 2011; Rafique et al., 2015; Al-Husien et al., 2016). Molecular assay using ISSR primers (Mohammadi et al., 2011; Al-Husien et al., 2017) and SSR primers (Al-Husien et al., 2017) were also done earlier. Variability is always a desirable trait of a pathogen as it helps in the survival of the pathogen under different niche and competition. Identification of variability helps in designing of suitable management to combat multiple pathogenic variants.  Hence, the present investigation was conducted to study the genetic and morphological variability among the isolates of Fusarium oxysporum f. sp. lentis in two diverse population of lentil growing areas of Uttarakhand and Uttar Pradesh.

Collection, isolation and identification of pathogen and its isolates
 
Twenty-two isolates of the pathogen were collected from two different states viz; Uttarakhand and Uttar Pradesh given in Table 1. The collected samples were brought to the Pulse Pathology Laboratory at Govind Ballabh Pant University of Agriculture and Technology, Pantnagar, Udham Singh Nagar. Isolation was done from the infected root zone of the plant samples. Isolates were further purified with the “Single Spore Isolation” method given by Zhang et al., (2013). Cultural identification along with the molecular identification of the pathogen was also done. ITS primer i.e. ITS1 (CTTGGTCAT TTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) were used for molecular identification purpose.


 
Morphological characterization of the pathogen isolates
 
The isolates were characterized morphologically based on visual colonial characters and microscopy of mycelia and conidia.
 
Molecular characterization of the pathogen isolates using ISSR and SSR PCR amplification
 
Twenty two isolates of Fol were molecularly characterized by using the eight ISSR (Table 2) and five SSR (Table 3) primers synthesized by Eurofins Genomics India Pvt. Ltd. The experiment was conducted in the laboratory of International School of Biocontrol in the dept. of Plant Pathology, GBPUAT, Pantnagar. Amplification of DNA during PCR reaction using ISSR primers was accomplished by using reaction mixtures (DNA template (50 ng/µl conc.), dNTPs mix (1 mM each conc.), Taq DNA Polymerase (2.5U/ µl conc.), Reaction buffer (1X), MgCl₂ (2mM conc.), primer (40 ng) and deionized water (12.9 ml)) with total 40 PCR cycles (Denaturation at 95°C for 5 minutes, Annealing at  48.0-55.0°C for 1 min and Polymerization at 72°C for 6 min). Similarly, the reaction mixture (DNA template (25 ng/µl), dNTPs mix (0.2 mM), Taq DNA Polymerase (0.6U), Reaction buffer (1x), MgC12 (0.2 mM), Reverse Primer (25 ng/µl), Forward primer (25 ng/µl) and Deionized water (12.9 ml) for SSR primers was also prepared. The PCR amplification of the DNA for SSR primers were completed in 30 cycles (Denaturation: at 94°C for 30 seconds, Annealing 51.0°C for 40 seconds and polymerization 72°C for 30 second). The analysis of the recorded data was done by counting of the reproducible and clear bands with binary digit code “1” (present) and “0” (absent) for presence and absence of the bands.  Jaccard’s Similarity coefficients was generated using presence and absence of unique and shared and polymorphic bands with the use of NTSYS 2.01 Software (Rholf 1993). On the basis of Similarity coefficient dendrogram was made manually by UPGMA (Unweighted Pair- Group Method with Arithmetical Averages).





Jacquard’s similarity coefficient was the basis for analysis and given as follows:  
Polymorphic information content (PIC) provides an estimate of the discriminatory power of a locus or loci, by taking into account, not only the number of alleles that are expressed, but also relative frequencies of those alleles (Kumar et al., 2003). The following formula was used for the estimation: Where,
P_ij = Frequency of j^th allele in the i^th primer.
n = Total number of alleles expressed by i^th primer.
 
Study on the genetic diversity of the population
 
The study on the genetic diversity of the two population was also done using the GENALEX  Software and AMOVA.

Identification of pathogen and its isolates
 
The identity of pathogenic isolate FOL3 (Pantnagar isolate) was confirmed with BLASTn report at NCBI site (Fig 1) and accession no. MK452341 was obtained for the sequence. Rest of the isolates showed the amplicon size »750 bp which was found same as the sequenced isolate.
 

 
Morphological characterization of the pathogen isolates
 
There were two types of mycelial growth pattern such as appressed growth where mycelium was less developed showing sparse growth and fluffy growth where mycelium was well developed and have a dense appearance (Table 1, Fig 2). The color and pigmentation of the colony varied from white, yellow, purple, olive green, pink and wine color. Among 22 isolates collected, 15 were found fast-growing followed by six isolates showing medium growth rate and one isolate had a slow growth rate (Table 1). All the collected isolates showed three types of conidia of different size and shape. All collected isolates produced abundant microconidia in culture and size of the microconidia varied from 1.47 µm × 1.05 µm to 5.43 µm × 1.21 µm. Isolates showed variety in the size and shapes of the conidia and chlamydospores. Chlamydospores were produced intercalary and terminally from the mycelium as described by Vasudeva and Srinivasan (1952). The shape of chlamydospores observed was round and oval. The sizes of the chlamydospores were also found significantly different from each other and varied in a range from 1.45 × 2.82 µm to 9.32 × 2.16 µm. The results recorded are in agreement with report of variability in terms of their growth pattern and pigmentation as described by Kannaiyan and Nene (1978) who isolated the different isolates of Fusarium oxysporum f.sp. lentis.
 


Genetic variability in the pathogen isolates employing ISSR Primers and SSR primers
 
The temperature required for the annealing of the primers is listed in Table 2 ranged from 48 to 55°C. Maximum annealing temperature required by the primer ISSR 10 was 55°C, A range of 50 to 55°C for the isolates of Foc was recorded by Rakhonde et al., (2017). Total 81 loci were amplified by eight ISSR primers. The maximum of 12 loci was amplified by three primers named as GAC, PRIMER3 and ISSR10. All the amplified sites were polymorphic none was found monomorphic. The bands obtained were of different sized ranged approximately from 0.1 Kb to 2 Kbp as revealed in Table 2. Mohammadi et al., (2011) recorded the size of amplicons ranged from 0.15 to 3.5 Kb, generated by the PCR amplification through ISSR primers among the FOL isolates depending on the primers and isolate combinations and a total of 70 loci were amplified by using the ISSR primers. The maximum PIC value 0.39 was recorded in GAC that showed the high level of polymorphism. The primers (GTG)5 (0.29) and LC49 (0.29) were found at par with each other. The resolving power (RP) for the each primer was varied and ranged from 6.81 to 3.00. The maximum resolving power was observed for the primer GAC i.e. 6.81. Little work is done on the variability of lentil wilt pathogen using ISSR primers and results obtained by Mohammadi et al., (2011) revealed the mean PIC value of ISSR primers for Fusarium oxysporum f.sp. lentis isolates as 0.234. The results revealed that the genetic variation is present among the isolates of the Fusarium oxysporum f.sp. lentis using ISSR primers. All the ISSR primers used produced the scorable bands with a high degree of polymorphism. The per cent of the polymorphism was hundred percent in all the ISSR primers. Some primers also produced unique bands at different loci.

The minimum similarity coefficient obtained was 0.51 and maximum similarity coefficient obtained was 0.87. The results of pairwise combination indicated the closest relationship between the isolates FOL4 and FOL5 i.e. 0.87 followed by the isolates FOL18 and FOL16 (0.82) and between the isolates FOL5, FOL3 and FOL4 (0.81). The minimum similarity coefficient or maximum diversity was observed in between the isolates FOL3, FOL13 and FOL15 i.e. 0.51.
 
Based on Jaccard’s similarity matrix, dendrogram (Fig 3) was drawn using SAHN option. Twenty-two isolates at 62 per cent similarity level were clustered in the two major clusters (A and B). Cluster A consisted nine isolates. Cluster A is further separated into four sub-clusters, similarly, cluster B was also sub clustered into four sub-clusters. The present study revealed that the ISSR primers are useful for the detection of genetic variation among the isolates of Fusarium oxysporum f.sp. lentis. The recent studies on the genetic diversity showed a high degree of genetic variation among the isolates of the Fusarium oxysporum f.sp. lentis from lentil.
 

 
All the SSR primers, except primer MB5F and MB5R, produced the scorable bands with the isolates. The region of amplification for this primer was not available in all the isolates. Annealing temperature (Table 3) for the primers were found very high i.e. 62°C for the primers MB11 and MB2. Eight loci were amplified by the four SSR primers (MB11, MB13, MB2 and MB18). Monomorphic bands were absent for all the primers used. Primers also gave unique bands at different loci. Primer MB13 gave two unique bands of the size 0.3 and 0.4 kb, similarly, Primer MB2 gave two unique bands of the size 0.6 and 0.8 kb. Primer MB18 produced three unique bands of size 0.21, 0.25 and 0.26 kb. The PIC value for the primers varied from 0.68 to 0.87. The Maximum PIC value 0.87 was observed for the primer MB13. PIC value for the SSR primers varies from 0.0 to 1 and the PIC values showed a high level of genetic variability among the isolates observed. All the isolates exhibited a high degree of polymorphism up to 100 per cent showed that all the isolates used had a high level of genetic variability among them.

The binary data recorded by scoring the bands were used for the analysis of the similarity coefficient as well as the UPGMA. The range of Jaccard’s similarity coefficient across the isolates ranged from 0.41 to 1.0. At 58 per cent similarity level, the dendrogram (Fig 4) grouped the isolates into one major cluster 1 with a single isolate FOL22 (Naugaon). Cluster 1 consisted of 21 isolates. The studies were as per the Datta et al., (2011) who found the genetic diversity among the hundred isolates of Fusarium oxysporum f.sp. lentis where SSR primers amplified 21 alleles and a similarity coefficient 73 per cent between two isolates. Al-Husien et al., (2017) reported the genetic diversity among the 96 isolates of Fusarium oxysporum f.sp. lentis in Syria by using SSR, ISSR and RAPD primers.
 

 
Genetic diversity among the populations
 
The existing genetic diversity was recorded between the two populations of the pathogen collected from Uttarakhand and Uttar Pradesh using GENALEX software. The results showed the huge diversity among the isolates of Uttarakhand. Among the two populations the diversity was found very less i.e. only 8 per cent, however, diversity within the population was found high i.e. 92 per cent (Fig 5). Hence it can be concluded that more diversity exists within the individuals of same population and less diversity is reported among the individuals of two populations.