Abstract
Background:
Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by angiogenesis, cell proliferation and bone and cartilage damage in the affected joint. Many genetic and environmental factors contribute to RA susceptibility. ITGAV is a member of the integrin family, which plays a major role in bone destruction, angiogenesis and macrophage-dependent inflammation and has been suggested that it may be an RA susceptibility gene. In this study, we investigated association of two single nucleotide polymorphisms in ITGAV (rs3738919 and rs3768777) with susceptibility to RA.
Methods:
Iranian patients with confirmed RA, aged over 50 years, were compared with healthy controls for allelic and genotypic frequencies of these polymorphisms. The subjects and controls were matched through their race, age and sex. After whole genome extraction, we compared genotype frequencies of analyzed alleles in RA patients and controls using a polymerase chain reaction (PCR)-restriction fragment length polymorphism assay. Association of rs3738919 and rs3768777 with RA was tested in these two sample sets using the χ2-test.
Results:
Statistical analysis indicated no association between RA and rs3738919 allele frequencies (C and A alleles), single genotype frequencies (AA, AC, CC) and combined genotype frequencies of (AC+CC vs. AA). We also found no evidence of association between rs3768777 SNP allele frequencies, single genotype frequencies and combined genotype frequencies and RA susceptibility.
Conclusions:
This study did not find any association between RA and ITGAV rs3738919 and rs3768777 polymorphisms in Iranian patients. However, this finding is not conclusive due to the limited sample size. A subsequent study with a larger sample size is recommended.
Introduction
Rheumatoid arthritis (RA) is the most common autoimmune disease with complex etiology that is associated with increased mortality risk [1]. This inflammatory disease affects approximately 1% of worldwide population with many clinical symptoms which include hyperplasia of synovial lining cells, synovial fibroblasts and macrophage proliferation, bone destruction and structural cartilage damage [2]. Interaction of genetic and environmental parameters contribute to individual susceptibility to this chronic and systemic disease [3]. Indeed, genetic background plays an important role in RA and it is estimated to be responsible for 50%–60% of the risk of developing RA. The genetic risk factors that contribute to the susceptibility to RA are detected from twins, families and genome-wide association studies, and it does indicate an increased risk (2–17 folds) than in the general population [4], [5]. Studies show the involvement of many genetic elements such as HLA-DRB1, TRAF/C5 (tumor necrosis factor receptor-associated factor 1 region), PTPN22 (protein tyrosine phosphatases non-receptor 22), CTLA (cytotoxic T lymphocyte antigen 4), STAT4 (signal transducer and activator of transcription 4), CD40, CCL21 and IL2RB genes with susceptibility to RA disease [6].
In recent years, a number of studies demonstrated that integrin αv (ITGAV) gene polymorphisms may play an important role in RA disorder in some populations [7]. This gene encodes the integrin αv chain (CD51), a subunit of the integrin family, which plays a key role in angiogenesis, proliferation, migration and differentiation of vascular cells. It is well documented that the integrin family and their ligands such as laminin, collagen and fibronectin (the extracellular matrix proteins) have a significant role in cell-matrix adhesion and cell signaling [8]. Synovial tissue angiogenesis stimulated in RA is involved in hyperplasia of the synovial membrane and increased destructive activities of pannus and even progression of the disease. Studies also showed that macrophages, T lymphocytes, αvβ3 ligands and proangiogenic mediators are abundant in the RA synovial fluid [9]. According to these findings, the current work is designed to determine the association of ITGAV rs3738919 and rs3768777 polymorphisms with susceptibility to RA in Iranian patients.
Materials and methods
Subjects
This study was approved by the Ethics Committee of Baqiyatallah University of Medical Sciences. The project was designed as a case-control population-based association. All cases and controls were selected by simple sampling between late 2014 and early 2015. Eighty-four patients and 85 healthy individuals aged over 50 years that matched through their race, age and sex were entered into this study. Patients were selected from Tehran Hospitals (Iran) if they fulfilled American College of Rheumatology (ACR) criteria for RA. Individuals with any history of autoimmune disease such as diabetes, lupus and inflammatory diseases were not entered into this study.
A questionnaire was completed for all patients and controls to collect baseline information including demography, medical status and family history by a face-to-face interview on the first visit. All participants were informed about the research project and then a written consent was obtained.
Genotyping
Ten milliliter venous whole blood samples from patients and healthy controls were collected and divided in two separate tubes each of 5 mL with or without ethylene diamine tetra acetic acid (EDTA) anti-coagulant. Genomic DNA was extracted from EDTA-containing samples using the standard salting out method as described previously [10].
The segments of the ITGAV gene containing the target polymorphic sites were polymerase chain reaction (PCR) amplified with suitable primers. The PCR was carried out in a total volume of 50 μL containing DNA template 200 ng, primers 20 pM each, MgCl2 3 mM, 400 μM of each dNTP and Taq DNA polymerase 2.0 U. DNA amplification was performed in a Mastercycler5330 (Eppendorf, Hamburg, Germany) by following a thermal profile for both segments: DNA denaturation at 95°C for 10 min, and 35 cycles of template denaturation at 94°C (60 s), primer annealing at 60°C (30 s) and extension at 72°C (60 s). A final extension at 72°C was performed for 6 min [11]. Five microliters of PCR products were run on 1% agarose gel to see the targets band before setting the restriction digestion reaction. After PCR performance, the genotyping was followed by the restriction fragment length polymorphism method.
| rs3768777 | Forward: 5′-ATTTGCACATTTGAGGTTGAACA-3′ |
| Reverse: 5′- GTAGAAGATGGTCCTATCCACGTA -3′ | |
| rs3738919 | Forward: 5′- AGCACTGTTTCTCTACAGCA -3′ |
| Reverse: 5′- CCTCTCCTTAGGCTTCATC -3′ |
The first amplicon (rs3738919) contained two AluI restriction enzyme recognition sites with C at position +229 and one AluI recognition site with A at this position. The second amplicon (rs3768777) contained an NlaIII restriction enzyme recognition site with A at position +290 and no NlaIII recognition site with G at this position. Fifteen microliters of these PCR products were digested with 5 units of AluI and NlaIII restriction enzymes for 16 h at 37°C, respectively [12]. The digestion products were visualized by ethidium bromide staining in 12% polyacrylamide gel. The allelic frequencies of our data were compared with the frequencies that were reported in other Caucasian populations.
Statistical analysis
Allele frequencies were determined by counting alleles and calculating the proportions. Hardy-Weinberg equilibrium was confirmed in the study groups using an χ2-test to compare the observed and expected genotype frequencies in cases and controls. Differences of genotypic and allelic frequencies of ITGAV SNPs between RA patients and controls were analyzed with an χ2-test.
Results
In this study, 84 patients with confirmed active RA and 85 healthy people at the same age were evaluated for detection of any association between ITGAV rs3738919 and rs3768777 polymorphisms and RA susceptibility in the Iranian population. The demographic data of patient and control groups are shown in Table 1.
Baseline characteristics of RA and control groups.
| RA patients (n=84) | Controls (n=85) | |
|---|---|---|
| Sex, M/F | 34/50 | 39/44 |
| Age, years | 59.5±9 | 63.2±11.8 |
| Smoking, n (%) | 25 (29.6) | 39 (45.8) |
| Serology test (Pos), % | 55.9 | 0 |
| Pain (severe/mild), % | 41.6/55.9 | – |
| X-ray test abnormality, % | 53.5 | – |
Both groups were matched for these demographic data and no significant difference was found between the two groups in these parameters.
Genotyping
The PCR-amplified product of rs3738919 polymorphism was a 502 bp amplicon. After digestion with AluI restriction enzyme, homozygote CC genotype was identified by the presence of 107, 124 and 271 bp bands, homozygote AA by 107 and 395 bp bands and heterozygote CA by the presence of four bands of 107, 124, 271 and 395 bp.
The segment that was amplified for investigation of rs3768777 polymorphism was a 510 bp amplicon that was digested by NlaIII restriction enzyme. After digestion, homozygote AA genotype was detected by the presence of 292 and 218 bp bands. The homozygote GG genotype showed only one 510 bp band and heterozygote GA was identified by the presence of all three bands of 510, 292 and 218 bp. The association between the rs3738919 SNP and RA risk was examined as presented in Table 2.
Genotype and allelic frequencies of rs3738919SNP in RA patients and controls.
| Number | Genotype (%) | Allele (%) | |||||
|---|---|---|---|---|---|---|---|
| CC | AC | AA | AC+CC | C | A | ||
| Patients | 84 | 20 (23.8) | 48 (57.2) | 16 (19) | 68 (81) | 88 (52.4) | 80 (47.6) |
| Controls | 85 | 29 (34.1) | 38 (44.7) | 18 (21.2) | 67 (78.8) | 96 (56.5) | 74 (43.5) |
| p-Value | 0.244 | 0.2 | 0.25 | ||||
The genotype frequencies for this polymorphism were in Hardy-Weinberg equilibrium. There was no association between genotype frequencies, and also frequency of C and A alleles and RA. Also genotype frequencies of rs3768777 polymorphism were in Hardy-Weinberg equilibrium and its association with RA risk was evaluated as presented in Table 3.
Genotype and allelic frequencies of rs3768777SNP in RA patients and controls.
| Number | Genotype (%) | Allele (%) | |||||
|---|---|---|---|---|---|---|---|
| GG | AG | AA | AG+GG | G | A | ||
| Patients | 84 | 25 (29.8) | 47 (56) | 12 (14.2) | 72 (85.8) | 97 (57.8) | 71 (42.2) |
| Controls | 85 | 27 (31.8) | 42 (49.4) | 16 (18.8) | 69 (81.2) | 96 (56.5) | 74 (43.5) |
| p-Value | 0.63 | 0.5 | 0.81 | ||||
There was no association between genotype frequencies and frequency of G and A alleles and RA.
The association between the combined genotype AC+CC vs. AA genotype of rs3738919 and the combined AG+GG vs. AA frequencies of rs3768777 was assessed in RA and control groups, but no significant association was found.
Comparison with other reports
Table 4 shows rs3768777 and rs3738919 genotype frequencies in other studies on Caucasian populations. There was no difference between our study and other reported series.
Comparison of allele frequencies of rs3768777 and rs3738919SNP in different reports.
| Reference study | rs3738919 alleles | rs3768777 alleles | ||
|---|---|---|---|---|
| F (C) | F (A) | F (G) | F (A) | |
| Present study | 0.554 | 0.446 | 0.814 | 0.186 |
| Jacq et al. [13] | 0.665 | 0.335 | 0.640 | 0.360 |
| Shakiba et al. [7] | 0.660 | 0.340 | 0.681 | 0.319 |
| Iikuni et al. [14] | 0.910 | 0.90 | – | – |
| χ2 | 1.273 | 2.78 | ||
| p-Value | 0.256 | 0.55 | ||
Discussion
We studied the ITGAV gene as a good candidate for susceptibility to RA for its strong functional hypothesis in angiogenesis which is involved in hyperplasia of the synovial membrane in the RA pannus and its chromosomal location in 2q31 that has been implicated by an RA genome scan. The results presented herein show that rs3768777 and rs3738919 SNPs of ITGAV genes are not associated with RA in our sample of Iranian patients. However, it is too soon to reach an ideal conclusion regarding lack of association among the above-mentioned genes and susceptibility to RA in the Iranian population. Meanwhile, we are planning to find out more in our on-going project which is covering a greater population. So far, more than 70 polymorphisms in ITGAV were reported and studied in regard to association with different conditions including chronic hepatitis, hepatocellular carcinoma, priapism in sickle cell disease, progression of primary biliary cirrhosis, risk and lymph node metastasis of oral squamous cell carcinoma, progression and spread of colorectal cancer [15], [16], [17], [18], [19].
The polymorphisms of ITGAV have attracted particular interest for researchers because of its association with a wide spectrum of diseases. ITGAV polymorphisms’ association with mechanisms of angiogenesis, cell proliferation and inflammation has been reported as well. According to the above pathophysiological background, the relationship between ITGAV polymorphisms and RA disease has been studied by different research groups. For example, in Iranian patients, it has been shown that ITGAV-rs3911238 polymorphism is associated with disease activity and the presence of anti-cyclic citrullinated peptide in RA [7]. In the European Caucasian patients, in a family-based study, it has been shown that ITGAVrs3738919-C allele is associated with RA. But the genetic association and linkage evidence that were provided by their study remained nevertheless statistically modest, suggesting at most a minor RA susceptibility marker and additional studies will be needed to definitively reveal association and linkage of the ITGAVrs3738919-C allele to RA [13].
In another study that tested New Zealand and Oxford (UK) RA cases, association of ITGAV SNP rs7378919 with RA was not replicated. In this meta-analysis study that evaluates 3527 cases and 4126 controls, there is no evidence for a role of the ITGAV SNP rs3738919 in the development of RA [20]. In another project, Iikuni and colleagues investigated the association between ITGAV and RA in a Japanese population. In contrast to the European population, in the Japanese case, the rs3738919-C allele was more frequent in control individuals, such as the European population, but no significant differences were observed in allele frequencies for Japanese RA patients and controls [14]. This difference between Japanese and European allele frequency is clearly acceptable. These studies are in agreement with our finding that there was no association between rs3768777 and rs3738919 SNPs of ITGAV and susceptibility to RA. There are several factors that may be different between these studies that fail to corroborate previously identified associations. One of these factors is ethnic differences that can result in differences in allele frequencies, susceptibility to disease itself may vary between ethnic groups [21]. Different patterns of linkage disequilibrium (LD) in different populations is another factor that can cause inconsistent results in studies on different populations. In other words, it is possible to assume that the real causative genetic variations in this region are not rs3768777 and rs3738919 SNPs of ITGAV themselves, but (an) other variation(s) with LD with different alleles of rs3768777 and rs3738919 in some populations [22]. To confirm this hypothesis, it must evaluate all polymorphism around these SNP regions resulting in susceptibility to RA. Also population stratification is an important factor that affects association studies in the Iranian population, which consists of many ethnicities with possible different gene pools. To avoid this problem and many inconsistent results, it is suggested that performing family-based association studies instead of population-based studies would gain more reliable results in association studies of multifactorial diseases [23], [24]. Furthermore, environmental factors, sample size, inclusion and exclusion criteria may be other possibilities to explain the different ITGAV polymorphism roles in RA in various experiments.
Finally, when we compared the frequencies of alleles of rs3738919 polymorphism (A and C) and rs3768777 (A and G) with other reports from different populations (Table 4), we found that our reported frequencies are in the range expected for Caucasians [7], [13], [14].
The limitation of the present study is that our sample size was too small (85 RA patients and 84 healthy blood donors) and further association studies with large sample sizes and different ethnicities are needed to confirm our findings.
In conclusion, we have studied the association of rs3738919 and rs3768777 single nucleotide polymorphism of the ITGAV gene with risk of development of RA and found that they are not significantly associated. But this finding is not conclusive due to limitation of sample size and ethnicity. A further study with a larger sample size and family base is recommended to establish whether lack of association is due to ethnical dependence of this observation or presence of confounder(s) in the previous study that reported a positive relationship.
Acknowledgments
This article is extracted from MSc thesis approved at the Baqiyatallah University of Medical Sciences. The authors wish to thank their colleagues in the Immunology Laboratory for their kind help. The authors would like to express their thanks to the Molecular Biology Research Center, Baqiyatallah University of Medical Sciences for supporting us during this project.
Author contributions: All the authors have accepted responsibility for the entire content of this submitted article and approved submission.
Research funding: None declared.
Employment or leadership: None declared.
Honorarium: None declared.
Competing interests: The funding organization(s) played no role in the study design; in the collection, analysis, and interpretation of data; in the writing of the report; or in the decision to submit the report for publication.
References
1. Yamamoto K. Genetic factors of rheumatoid arthritis. Clin Calcium 2015;25:1763–8.10.2169/naika.101.2818Search in Google Scholar
2. Jiang Y, Tuan RS. Origin and function of cartilage stem/progenitor cells in osteoarthritis. Nat Rev Rheumatol 2015;11:206–12.10.1038/nrrheum.2014.200Search in Google Scholar
3. Padyukov L, Silva C, Stolt P, Alfredsson L, Klareskog L. A gene–environment interaction between smoking and shared epitope genes in HLA–DR provides a high risk of seropositive rheumatoid arthritis. Arthritis Rheum 2004;50:3085–92.10.1002/art.20553Search in Google Scholar
4. Diogo D, Okada Y, Plenge RM. Genome-wide association studies to advance our understanding of critical cell types and pathways in rheumatoid arthritis: recent findings and challenges. Curr Opin Rheumatol 2014;26:85–92.10.1097/BOR.0000000000000012Search in Google Scholar
5. MacGregor AJ, Snieder H, Rigby AS, Koskenvuo M, Kaprio J, Aho K, et al. Characterizing the quantitative genetic contribution to rheumatoid arthritis using data from twins. Arthritis Rheum 2000;43:30–7.10.1002/1529-0131(200001)43:1<30::AID-ANR5>3.0.CO;2-BSearch in Google Scholar
6. Korczowska I. Rheumatoid arthritis susceptibility genes: An overview. World J Orthop 2014;5:544–9.10.5312/wjo.v5.i4.544Search in Google Scholar
7. Shakiba E, Tavilani H, Goodarzi MT, Kiani A, Pourmotabbed T, Vaisi-Raygani A. The ITGAV-rs3911238 polymorphism is associated with disease activity in rheumatoid arthritis. Iran J Allergy Asthma Immunol 2014;13:356–63.Search in Google Scholar
8. Plow EF, Meller J, Byzova TV. Integrin function in vascular biology: a view from 2013. Curr Opin Hematol 2014;21:241–7.10.1097/MOH.0000000000000042Search in Google Scholar
9. McInnes IB, Schett G. The pathogenesis of rheumatoid arthritis. N Engl J Med 2011;365:2205–19.10.1056/NEJMra1004965Search in Google Scholar
10. Samadikuchaksaraei A, Fasihi Ramandi M, Khatami S, Hashemi MJ, Haqparast S, Fard-Esfahani P. E23K polymorphism in Iranian patients with coronary heart disease. ARYA Atheroscler 2009;5:55–60.Search in Google Scholar
11. Ghadiri M, Nourmohammadi I, Fasihi Ramandi M, Moazen Zadeh E. Association involving serotonin transporter gene linked polymorphic region and bipolar disorder type 1 in Iranian population. Asia Pac Psychiatry 2016;8:92–7.10.1111/appy.12179Search in Google Scholar
12. Haqparast S, Ramandi MF, Samadikuchaksaraei A, Pazhakh V. A single nucleotide polymorphism-1131T> C in the apolipoprotein A5 gene modulates the levels of triglyceride. Lab Med 2011;42:171–4.10.1309/LM3FQYGRW64HTINWSearch in Google Scholar
13. Jacq L, Garnier S, Dieude P, Michou L, Pierlot C, Migliorini P, et al. The ITGAV rs3738919-C allele is associated with rheumatoid arthritis in the European Caucasian population: a family-based study. Arthritis Res Ther 2007;9:R63.10.1186/ar2221Search in Google Scholar PubMed PubMed Central
14. Iikuni N, Kobayashi S, Ikari K, Tomatsu T, Hara M, Yamanaka H, et al. ITGAV polymorphism and disease susceptibility in a Japanese rheumatoid arthritis population: Arthritis Res Ther 2007;9:405.10.1186/ar2303Search in Google Scholar PubMed PubMed Central
15. Inamine T, Nakamura M, Kawauchi A, Shirakawa Y, Hashiguchi H, Aiba Y, et al. A polymorphism in the integrin αV subunit gene affects the progression of primary biliary cirrhosis in Japanese patients. J Gastroenterol 2011;46:676–86.10.1007/s00535-010-0351-0Search in Google Scholar PubMed
16. Lee SK, Kim MH, Cheong JY, Cho SW, Yang SJ, Kwack K. Integrin alpha V polymorphisms and haplotypes in a Korean population are associated with susceptibility to chronic hepatitis and hepatocellular carcinoma. Liver Int 2009;29:187–95.10.1111/j.1478-3231.2008.01843.xSearch in Google Scholar PubMed
17. Fasihi-Ramandi M, Amani J, Salmanian AH, Moazzeni SM, Ahmadi K. Production and characterization of new anti-human CD20 monoclonal antibody. Iran J Allergy Asthma Immunol 2015;14:502–8.Search in Google Scholar
18. Waisberg J, Viana LDS, JUNIOR RJA, SILVA SRM, DENADAI MVA, Margeotto FB, et al. Overexpression of the ITGAV gene is associated with progression and spread of colorectal cancer. Anticancer Res 2014;34:5599–607.Search in Google Scholar
19. Ma X-R, Cheng H, Wang X-Y, Liu H, Zhao D. Single-nucleotide polymorphisms of integrins are associated with the risk and lymph node metastasis of oral squamous cell carcinoma. Med Oncol 2012;29:2492–8.10.1007/s12032-012-0167-2Search in Google Scholar PubMed
20. Hollis-Moffatt JE, Rowley KA, Phipps-Green AJ, Merriman ME, Dalbeth N, Gow P, et al. The ITGAV rs3738919 variant and susceptibility to rheumatoid arthritis in four Caucasian sample sets. Arthritis Res Ther 2009;11:R152.10.1186/ar2828Search in Google Scholar PubMed PubMed Central
21. Kimura T. East meets West: ethnic differences in prostate cancer epidemiology between East Asians and Caucasians. Chin J Cancer 2012;31:421–9.10.5732/cjc.011.10324Search in Google Scholar PubMed PubMed Central
22. Li H, Teo YY, Tan EK. Patterns of linkage disequilibrium of LRRK2 across different races: implications for genetic association studies. PLoS One 2013;8:e75041.10.1371/journal.pone.0075041Search in Google Scholar PubMed PubMed Central
23. Saad M, Wijsman EM. Combining family-and population-based imputation data for association analysis of rare and common variants in large pedigrees. Genet Epidemiol 2014;38:579–90.10.1002/gepi.21844Search in Google Scholar PubMed PubMed Central
24. Ionita-Laza I, Cho MH, Laird NM. Statistical challenges in sequence-based association studies with population-and family-based designs. Stat Biosci 2013;5:54–70.10.1007/s12561-012-9062-9Search in Google Scholar
©2016 Walter de Gruyter GmbH, Berlin/Boston
This article is distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
