Identification of KDM4C as a gene conferring drug resistance in multiple myeloma

2.1 Cell culture and transfection

The human MM cell lines KM3 and KM3/BTZ were provided by Qilu Hospital of Shandong University. KM3 cells were cultured in RPMI-1640 medium, supplemented with 10% fetal bovine serum. The cells were maintained at a temperature of 37°C in a 5% CO₂ humidified atmosphere. KM3/BTZ cells were established as follows [6]: parent KM3 cells in logarithmic growth phase were subjected to gradient induction with BTZ at concentrations ranging from 5 to 160 ng/mL, then sustained in 5 ng/mL. After 10 months of this treatment, the BTZ-resistant cell line, KM3/BTZ, was successfully established. Lentivirus for overexpression and knockdown of KDM4C (NM_015061) were obtained from Shanghai Genechem Co., Ltd. Cells were plated at a density of 5 × 10⁴ cells/well in 500 μL of complete medium in 24-well plates. The lentivirus was added to the cells at a multiplicity of infection ratio of 1:100. After 12 h, the medium was replaced. The shRNA sequences used for targeting KDM4C were as follows: scramble sequence: TTCTCCGAACGTGTCACGT; sh1: AGGAGTTCCGGGAGTTCAACA; sh2: GCAAGTACTGGAAGAACTTAA.

2.2 Real-time quantitative PCR

Total RNA was isolated from cell lysates utilizing the RNA-easyTM isolation reagent (Nanjing Vazyme BioTech CO., Ltd, R711-01). Complementary DNA was then synthesized from the extracted RNA using the HiscriptII Q RT Supermix for qPCR (Vazyme, R223-01). The mRNA expressions of target genes were quantified using a SYBR green PCR master mix (abm, G891-1). The PCR amplification was carried out on a QuantaStudio5 real‐time PCR system (Applied biosystems by Thermo Fisher Scientific). Each PCR experiment was conducted in triplicate. The relative mRNA levels of target genes were calculated using the 2^−ΔΔCt method, with β-ACTIN as the internal control.

Primer sequences were as follows:

KDM4C-F: 5′-CATGGAGTCTAAAGGAGCCCA-3′;

KDM4C-R: 5′-TGTACTGAGTGAACAGTCCTGA-3′;

MDR1-F: 5′-CCCATCATTGCAATAGCAGG-3′;

MDR1-R: 5′-GTTCAAACTTCTGCTCCTGA-3′;

β-ACTIN-F: 5′-CTGGAACGGTGAAGGTGACA-3′;

β-ACTIN-R: 5′-AAGGGACTTCCTGTAACAACGCA-3′.

2.3 Western blotting

Cells were lysed using pierce IP lysis buffer (Thermo scientific, REF: 89900), supplemented with phosphatase inhibitors (MCE, HY-K0021), protease inhibitor (MCE, HY-K0010), and phenylmethanesulfonyl fluoride (MCE, HY-B0296/CS-2617). Proteins were separated by SDS-PAGE gel based on their molecular weight. The gel was then transferred onto a polyvinylidene fluoride (PVDF) membrane using a semi-dry method. After the transfer, the PVDF membrane was blocked with 5% BSA in tris buffered saline with tween 20 (TBST). The membrane was then incubated with primary antibodies, including anti-MDR1 (CST, #13978S), KDM4C (ABclonal, A8485), β-TUBULIN (CST, #81253SF), β-ACTIN (CST, #4970S) diluted with 1% BSA at 4°C overnight. After incubation, the membrane was washed three times with TBST and then incubated with HRP-conjugated secondary antibody for 1 h at room temperature. Enhanced chemiluminescence substrates were added to the membrane and images were captured and developed by a FluoChem E system (Proteinsimple). The protein levels were normalized by β-TUBULIN or β-ACTIN. All experiments were performed three times.

2.4 IC₅₀ assay

The drug susceptibility of the cells was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Solarbio, 298-93-1) assay. MM cells (5 × 10³ cells/well) were seeded into 96-well plates (Nest), and were incubated with different concentrations of BTZ at 37°C in a humidified incubator containing 5% CO₂ for 48 h. The BTZ concentrations for KM3 and KM3/BTZ were 0, 5, 10, 20, 50, 100, 200, and 400 ng/mL. BTZ concentrations for empty vector (EV) and overexpression (OE) cells were 0, 5, 10, 20, 40, and 80 ng/mL. BTZ concentrations for scramble, sh1, and sh2 cells were 0, 60,120, 240, 480, and 960 ng/mL. After the incubation period, 20 µL of MTT (5 mg/mL in phosphate-buffered saline) was added to each well and incubated for 4 h. The supernatant was then carefully removed, and 100 µL of dimethyl sulfoxide was added to dissolve the formazan crystals that had formed. The absorbance of each well was then measured at 490 nm using a CLARIOstar^Plus spectrophotometer. Cell survival and inhibitory rates were derived as (optical density [OD]_treated/OD_control)  ×  100% and (1 − OD_treated/OD_control)  × 100%, respectively. IC₅₀ was calculated by GraphPad Prism 9 software. All experiments were carried out in triplicate.

2.5 Intracellular ADM detection by flow cytometry

Intracellular ADM (Adriamycin) accumulation was evaluated by flow cytometry (BD FACS Celesta). 1.0 × 10⁶ cells were cultured with or without 1 μg/mL ADM for 9 h. The ADM fluorescence intensity was analyzed by FlowJo Software Version 10. Each experiment was repeated three times.

2.6 Statistical analysis

Data are presented as the mean ± standard deviation. Differences between groups were evaluated with T-test by GraphPad Prism 9 software. p < 0.05 was considered to be a statistically significant difference (*p < 0.05, **p < 0.01, *** p < 0.001).

1. Ethical approval: The conducted research is not related to either human or animals use.

3.1 KDM4C was upregulated in the BTZ-resistant MM cell line KM3/BTZ

KM3/BTZ is a BTZ-resistant human MM cell line, derived from the MM cell line KM3. The BTZ IC₅₀ was found to be 290.29 ng/mL for KM3/BTZ. This is 11.17 times higher than that of the original parent cell line, KM3 (p < 0.001, Figure 2a). Furthermore, KM3/BTZ shows cross-resistance to ADM (Figure 2b). ADM accumulation in drug-resistant KM3/BTZ cells was significantly lower than in the KM3 cells (Figure 2c and d). MDR1, also known as P-glycoprotein /ABCB1, is a prominent member of ABCB (encoded by ABCB1 gene) subfamily and is a membrane-embedded drug transporter. MDR1, commonly overexpressed in cancers, is considered as a primary factor in the induction of multidrug resistance. It is the leading causes of various mechanisms of multidrug resistance [7]. As we anticipated, the levels of MDR1 mRNA and protein were significantly elevated in KM3/BTZ (Figure 2e and f). Meanwhile, we identified that the histone demethylase KDM4C was significantly elevated in KM3/BTZ (Figure 2e and f). KDM4C (also known as JMJD2C/GASC1) consists of a conserved JmjC catalytic domain and has been shown to demethylate lysine 9 of histone H3 (H3K9me2 and H3K9me3) and lysine 36 of histone H3 (H3K36me2 and H3K36me3). KDM4C could activate target genes by binding to their promoters and removing trimethyl (me3) and dimethyl (me2) groups [8,9]. KDM4C is amplified or overexpressed in many human cancers and is closely associated with the degree of malignancy of the tumors [10–19]. Given the elevated levels of KDM4C in KM3/BTZ, we questioned whether KDM4C plays a role in BTZ resistance in MM cells.

Figure 2

KDM4C was upregulated in KM3/BTZ cells. (a) Survival curves and BTZ IC₅₀ values of KM3 and KM3/BTZ. (b) Survival curves and IC₅₀ values of KM3 and KM3/BTZ for ADM. (c) Representative plots showing intracellular ADM accumulation in KM3 and KM3/BTZ. (d) ADM fluorescence intensity in KM3 and KM3/BTZ cells were determined by flow cytometry. (e) mRNA levels of KDM4C and MDR1 in KM3 and KM3/BTZ. (f) Protein levels of KDM4C and MDR1 in KM3 and KM3/BTZ.

3.2 KDM4C overexpression enhanced BTZ resistance in KM3

To explore whether KDM4C is connected to BTZ resistance in MM cells, KM3 cells were transfected with either an EV or a KDM4C OE lentivirus (Figure 3a). RT-PCR and western blot assays were used to confirm that the KDM4C level in the OE group was significantly higher than that in the EV group (Figure 3b and c). As anticipated, we observed a significantly higher expression of MDR1 in the OE group (Figure 3b and c). Similarly, the MTT assay showed that the IC₅₀ of BTZ in the OE group was significantly higher than that in the EV group (32.77 ng/mL vs 7.87 ng/mL, p < 0.01, Figure 3d). The intracellular ADM fluorescence intensity was found to be decreased in the OE group (Figure 3e and f). These findings suggest that KDM4C may be associated with BTZ resistance in MM cells.

Figure 3

KDM4C overexpression in KM3 promoted BTZ resistance. (a) Lentivirus transfection efficiency in KM3 cells, assessed by fluorescence microscopy (magnification, ×100; scale bar  =  100 μm). (b and c) KDM4C overexpression was associated with increased MDR1 mRNA and protein expression. (d) Survival curves and BTZ IC₅₀ of OE and EV. (e) Representative flow cytometry plots showing ADM accumulation in EV and OE group. (f) ADM fluorescence intensity was decreased in OE group.

3.3 KDM4C knockdown reduced the resistance to BTZ in KM3/BTZ

To further investigate the role of KDM4C in BTZ resistance, two different KDM4C knockdown cell lines were developed using two different lentivirus-mediated shRNAs in KM3/BTZ. A scramble group was used as a control (Figure 4a). The knockdown of KDM4C in KM3/BTZ, as predicted, led to a decrease in MDR1 expression (Figure 4b and c), The knockdown also decreased the IC₅₀ of BTZ (from 221.03 ng/mL to either 88.77 or 104.35 ng/mL, both p values <0.05, Figure 4d) and increased ADM accumulation (Figure 4e and f). The collected data strongly suggest that KDM4C plays a role in promoting resistance to BTZ in MM cells.

Figure 4

KDM4C knockdown attenuated BTZ resistance in KM3/BTZ. (a) Verification of lentivirus transfection efficiency, with mCherry expression observed in >90% of cells using fluorescence microscopy (magnification, ×100; scale bar  =  100 μm). (b and c) mRNA and protein levels of MDR1 after KDM4C knockdown in KM3/BTZ. (d) Survival curves and BTZ IC₅₀ of scramble, sh1 and sh2 groups. (e) Representative flow cytometry plots showing ADM accumulation in scramble, sh1 and sh2 groups. (f) Intracellular ADM accumulation was increased in sh1 and sh2.

The BTZ-resistant MM cell line KM3/BTZ showed an upregulation of KDM4C. Furthermore, overexpression of KDM4C resulted in an increase in the BTZ IC₅₀ for the wild type MM cell line KM3. Conversely, knockdown of KDM4C led to a decrease in BTZ IC₅₀ in the BTZ-resistant MM cell line KM3/BTZ. Consequently, we have established a connection between KDM4C and BTZ resistance in MM cells.