Riparin-B as a Potential Inhibitor of AdeABC Efflux System from <i>Acinetobacter baumannii</i>

Leão, Patrícia Virna Sales; Ferreira, Ana Laura da Silva; Oliveira, Felipe Araújo de Alcântara; Mesquita, Avilnete Belém de Souza; Lima-Net, José de Sousa; Gutierrez, Stanley Juan Chavéz; Nogueira, Carlos Emídio Sampaio; Cruz-Martins, Natália; Arcanjo, Daniel Dias Rufino; Barreto, Humberto Medeiros; Lima Ferreira, Josie Haydée

doi:https://doi.org/10.1155/2023/1780838

Evidence-Based Complementary and Alternative Medicine

On this page

Abstract Introduction Results Discussion Materials and Methods Conclusions Data Availability Additional Points Conflicts of Interest Authors’ Contributions Acknowledgments References Copyright Related Articles

Special Issue

Traditional Ethnomedicinal Plants as Potent Biofilm Inhibitors to Prevent Antimicrobial Resistance and Mitigate the Microbial Infections

View this Special Issue

Research Article | Open Access

Volume 2023 | Article ID 1780838 | https://doi.org/10.1155/2023/1780838

Riparin-B as a Potential Inhibitor of AdeABC Efflux System from Acinetobacter baumannii

Patrícia Virna Sales Leão,¹Ana Laura da Silva Ferreira,¹Felipe Araújo de Alcântara Oliveira,¹Avilnete Belém de Souza Mesquita,¹José de Sousa Lima-Net,²Stanley Juan Chavéz Gutierrez,²Carlos Emídio Sampaio Nogueira,³Natália Cruz-Martins,^4,5Daniel Dias Rufino Arcanjo,⁶Humberto Medeiros Barreto,¹and Josie Haydée Lima Ferreira¹

Academic Editor: Srinivasan Ramanathan

Received13 Jul 2022

Revised07 Jan 2023

Accepted02 Feb 2023

Published08 Apr 2023

Abstract

Acinetobacter baumannii is an important opportunistic pathogen that causes serious health-related infections, especially in intensive care units. The present study aimed to investigate the antimicrobial activity of Riparin-B (Rip-B) alone and in association with norfloxacin against multidrug-resistant clinical isolates of A. baumannii. For this, the minimum inhibitory concentrations were determined by the microdilution method. For the evaluation of resistance-modulating activity, MIC values for antibiotics were determined in the presence or absence of subinhibitory concentrations of Rip-B or chlorpromazine (CPZ). The AdeABC-AdeRS efflux system genes from these isolates were detected by PCR. Docking studies were also carried out to evaluate the interaction of Riparin-B and the AdeABC-AdeRS efflux system. The study was conducted from 2017 to 2019. The results showed that Rip-B showed weak intrinsic activity against the strains tested. On the other hand, Rip-B was able to modulate norfloxacin’s response against A. baumannii strains that express efflux pump-mediated resistance. Docking studies provided projections of the interaction between Rip-B and EtBr with the AdeB protein, suggesting that Rip-B acts by competitive inhibition with the drug. Results found by in vitro and in silico assays suggest that Rip‐B, in combination with norfloxacin, has the potential to treat infections caused by multidrug-resistant A. baumanni with efflux pump resistance.

1. Introduction

Infections caused by multidrug-resistant micro-organisms are a current problem of public health all over the world and they have increased the morbidity and mortality rates in the population [1, 2]. Previous data from the National Network for Monitoring Microbial Resistance in Health Services, Brazil, showed that Acinetobacter spp. is the most critical of all the types, including multidrug-resistant bacteria, which are particularly dangerous in hospital areas, retirement houses, and among patients whose care demands the use of ventilators and intravenous catheters [3].

The A. baumannii is an aerobic, nonfermented, Gram-negative, coccobacillus labeled as an opportunistic pathogen widely associated with infection outbreaks related to health assistance, verified in intensive center unity environments [4]. Infections caused by that pathogen are intricately linked to pneumonia, septicemia, meningitis, urinary tract infections, surgical wounds, previous antibiotic therapy, burns, and immunosuppression diagnoses [5].

A. baumannii shows unconventional resistance to multiple drugs, and it may also bear countless protection mechanisms against most regular antibiotic substances used in its treatment [6]. This resistance might come from uncounted mechanisms, intrinsic or acquired because of an overproduction of efflux pumps, permeability reduction of the outer membrane, amendment of the target site, and production of beta-lactamases [7]. Similar mechanisms are also verified for resistance to biocides acquired by clinical isolates of A. baumannii [8].

The search for alternative therapies to resistant micro-organisms inspires research on the microbicidal potential of some plants and its metabolites [9, 10] such as the substance alcamida, separated from the unripe fruit of Aniba riparia (Nees) Mez belonging to Lauraceae family. Riparins I, II, and III are substances that occur naturally isolated from A. riparia. These chemical compounds derived from Riparins showed diverse biological activities. In addition to the natural occurrence of molecules originating in A. riparia, synthetic Riparins such as Riparin-B (Rip-B) was obtained by the Schotten–Bauman reaction [11].

Previous research carried out by our group pointed out that Rip-B was enhanced the action of norfloxacin and ciprofloxacin by inhibition of NorA efflux pump of Staphylococcus aureus [12]. This result motivated us to investigate if Rip-B could modulate the resistance of clinical isolates of A. baumanni carrying the AdeABC-AdeRS efflux system.

2. Results

2.1. Intrinsic Antimicrobial Activity of Riparin-B

In the present study, the synthetic derivative Rip-B (Figure 1) was investigated for its potential antimicrobial activity against different A. baumannii strains isolated from an urgency hospital of Teresina, Piauí, Brazil. Rip-B is a nonheterocyclic alkaloid, more specifically, a natural alkamide. It is formed from the union of tyramine, a phenylalanine and benzoic acid. It adds a substitution in the ring of benzoic acid, adding a hydroxyl, and the tyramine ring presents a methyl linked to oxygen forming an ether function.

Our results showed that Rip-B did not have intrinsic antimicrobial activity against multidrug-resistant A. baumannii strains tested (Table 1).

2.2. Evaluation of the Drug-Resistance Modulation

In the tests where Rip-B was added at subinhibitory concentration there was a significant reduction in the MIC values for norfloxacin, as it happens when a known efflux pump inhibitor (CPZ) is put in combination with norfloxacin (Figure 2). These results indicate that Rip-B is a modulating agent of the drug resistance in A. baumannii strains.

Ethidium bromide (EtBr) is a genotoxic dye that intercalates into DNA double-helix leading, to DNA damage and cell death, and the only known mechanism of resistance to EtBr in bacteria is mediated by the efflux pump [13]. Thus, this intercalating agent has been used as an indicator of the resistance mediated by efflux pumps [14]. In the present study, the modulating effect of Rip-B on the resistance to EtBr was verified only in the strains expressing resistance mediated by efflux pump phenotype (Figure 3). These results are strong evidence that modulating of the antibiotic resistance by Rip-B could be due to efflux pump inhibition.

2.3. Antimicrobial Susceptibility Profile and Distribution of the AdeABC-AdeRS Efflux System Genes

Table 2 shows the presence of genes from the AdeABC-AdeRS efflux system among the resistant strains of A. baumannii multidrug (MDR) used in this study. It was observed that the strains tested have genes from the AdeABC-AdeRS efflux system. The three strains also amplified the oxa-51 gene, confirming that it is A. baumannii. Table 2 also provides information on the resistance profile of the clinical isolates of A. baumanii. All A. baumannii clinical isolates tested were multidrug-resistant (MDR) and were resistant to norfloxacin.

2.4. Docking

To the best of our knowledge, there are no docking studies involving Rip-B on the AdeABC efflux pump. Thus, to check if this substance could indeed act as an AdeABC inhibitor and to get some insights on the inhibition mechanism, we have carried out the docking of Riparin-B and the known substrate EtBr with the AdeABC structure as a target. The AdeABC efflux system is comprised of three parts: the AdeA periplasmic protein, the AdeB efflux pump protein, and the AdeC outer membrane protein. AdeB has a 3-fold symmetrical structure with two periplasmic multidrug binding sites: distal and proximal. A drug supposedly enters the protein through a periplasmic cleft and binds to the proximal site, passes through a gate loop (G-loop), and is then delivered to the distal site for extrusion [15]. These sites are shown in Figure 4, labeled P (proximal) and D (distal). Figure 4 displays the best poses of both EtBr and Rip-B docked on the binding site of the AdeABC efflux pump. A 2D protein-ligand diagram for EtBr is provided in Figure 5 and 2D protein-ligand diagram for Riparin-B is provided in Figure 6.

3. Discussion

Due to the high prevalence of infections caused by multidrug-resistant A. baumannii, mainly in hospital environments, the research of new antimicrobial agents effective against this pathogen has been considered as a priority. To contribute to this context, we analyzed the intrinsic antimicrobial activity of Rip-B against A. baumannii clinical isolates, as well as its modulating activity on the resistance to norfloxacin. The molecular and susceptibility profile characterization of the clinical samples used in this study shows a multidrug-resistance profile and confirms the presence of genes from the AdeABC efflux system. Our previous study reported a high percentage of extremely drug-resistant (XDR) strains (81.1%) that was verified among A. baumannii clinical isolates at a northeast Brazilian Emergency Hospital, with greater prevalence of resistance to gentamicin (98.0%), ceftriaxone (94.3%), ceftazidime (92.0%), ciprofloxacin (90.5%), and levofloxacin (90.5%) [16]. Several studies report the prevalence of multi-resistant and extremely resistant clinical isolates among strains of hospital origin, showing a great diversity of mobile genetic elements and the ability to acquire and expand expressed of the antimicrobial resistance factors [17–21].

Rip-B did not show intrinsic antimicrobial activity; however, enhanced the activity of norfloxacin against clinic strains of A. baumannii, showing that it could be useful as an adjuvant of norfloxacin in the treatment of infections caused by multidrug-resistant A. baumannii. The antibacterial activity of natural Riparins I, III, and XII isolated from A. riparia against multidrug-resistant S. aureus and E. coli strains has already previously reported [22]. Moreover, while the synthetic analog Rip-E showed a good antibacterial activity against S. aureus strains, the synthetic derivative Rip-B was inactive against S. aureus [11]. In the present study, we also verified that Rip-B was inactive against all A. baumannii strains tested once MIC values were found higher than 1000 μg/mL (Table 1) which is considered as clinically insignificant [23]. These results show that Rip-B it is not recommended for use as an antimicrobial agent.

The natural Rip-III isolated from A. riparia was able to induce plasmid elimination in S. aureus strains changing the Penicillin resistance phenotype to sensitive [24]. Furthermore, Rip-B was reported as being an inhibitor of the NorA, an efflux pump of S. aureus belonging to the Major Facilitator Family [12]. These studies motivated us to investigate if Rip-B were able to potentiate the norfloxacin activity against A. baumannii strains expressing-resistance mediated by efflux pump phenotype, with the goal of suggesting a possible use of Rip-B as an adjuvant of this antibiotic in the treatment of A. baumannii infections. The results in Figure 2 suggest that Rip-B inhibits the efflux pump mechanism by decreasing MIC values for norfloxacin, modulating the action of this drug in the clinical strains of A. baumannii. This hypothesis was corroborated by results obtained for the known NorA inhibitor CPZ [25] that also modulated the antibiotic resistance in the A. baumanii strains expressing the AdeABC-AdeRS genes.

Since the presence of efflux pumps is the only known resistance mechanism for EtBr, assays using ethidium bromide (Figure 3) reinforce the evidence that the modulation of norfloxacin resistance by Rip-B occurs due to efflux inhibition. In fact, a previous study reported that Rip-B is an inhibitor of NorA, a proton-motive force dependent efflux pump of S. aureus belongs to the major facilitator superfamily (MFS), able to compete with antibiotic by the same binding pocket formed by ILE19, ILE23, PHE26, PHE47, ALA48, GLN51, MET109, THR113, SER133, ILE136, THR211, ARG310, ILE313, THR314, ASN332, SER333, THR336, SER337, ASN340, and PHE341 [12]. NorA extrudes hydrophilic fluoroquinolones, such as norfloxacin and Ciprofloxacin, and other biocides as quaternary ammonium compounds and EtBr [26].

In A. baumannii, resistance to Norfloxacin can be mediated by the multidrug efflux pump AdeABC, a proton-motive force dependent efflux pump belongs to the Resistance and Nodulation Cell Division (RND) [27–31]. It is observed that in the strain HUT90 the presence of all genes of the AdeABC-AdeRS complex was detected, while in strains HUT 89 and 105 the presence of the AdeB gene was detected, however, there was no amplification of the regulatory AdeR and AdeS genes (Table 2). High frequencies of overexpression of AdeABC genes were reported for clinical isolates of A. baumannii from Brazil [31] and France [32]. However, the distribution of genes in this system was not homogeneous among strains. Frequencies of 92.4%, 98.5%, 92.4%, 90.9%, and 92.4%, respectively, for the AdeA, AdeB, AdeC, AdeR, and AdeS genes were found in A. baumannii strains resistant to carbapenems, meanwhile in strains sensitive to carbapenems, such as 105 strain tested in the present study, the presence of AdeRS genes occurred in 50–55% of the strains evaluated [33]. A previous study also point out that the expression of the AdeA, AdeB, and AdeC genes are inconsistent and that despite variations in detection rates, there is a predominance of amplification of the AdeB gene in clinical isolates of A. baumannii [28].

Another important point to consider is that functional mutations have been found in conserved domains of AdeRS in all strains that overexpress AdeABC [28, 34]. Furthermore, it is known that functional mutations in the insertion sequence (IS) in AdeRS can also affect the regulation of the AdeABC system, leading to overexpression of the system [35]. The way in which the AdeR and AdeS genes regulate the overexpression of the AdeABC system is not fully understood. The analysis of the interaction between AdeR and AdeABC by electrophoresis mobility shift rehearsal and found that the promoters AdeR and AdeABC did not interact [36]. Even if AdeS was present, AdeR was not found to link to the promoting region of AdeABC. In this way, it is known that AdeRS that regulates the expression of AdeABC is defined, but the mode of action is still difficult to specify. In addition, the regulation of AdeABC gene expression is complex. Under some conditions, the insertion of ISAbaI does not lead to overexpression of this pump [37], indicating that other regulators may be involved. Lin et al. [38] also showed that the other two-component system, BaeSR, can regulate AdeA and AdeB. Thus, in strains 89 and 105, regulation of the overexpression of the AdeABC genes may be occurring by mutation in the amplification regions or by another mechanism not yet known. Multidrug-resistant strains overexpressing efflux pumps are able to extrude this antibiotic reducing its intracellular concentrations. Thus, it is possible that the strains tested in the present study, even with different genetic profiles, could overexpress AdeABC that were inhibited by Rip-B. In its turn, inhibition of efflux pumps by Rip-B could lead to a higher antibiotic accumulation in periplasm or cytoplasm where antibiotic targets are located enhancing their activity.

Previous study documented that both Holarrhena antidysenterica extract and conessine, a steroidal alkaloid compound, could restore antibiotic activity due to interference with the AdeIJK pump in A. baumannii, not interfering with the AdeABC pump [39]. However, the presence of AdeABC efflux pump genes in the strains of clinical origin in the study had not been confirmed, unlike what was done in this study. The same alkaloid, conessine, was shown to be effective as an efflux pump inhibitor in Pseudomonas aeruginosa [40]. Both studies indicated the potential of an alkaloid product as an inhibitor of the homologous resistance-nodulation-splitting (RND) family.

Docking studies of Rip-B on the NorA efflux pump of Staphylococcus aureus were already reported by Costa et al. [12]. Figure 4 shows the possible binding sites of a drug with the AdeB protein, highlighting the proximal and distal sites. As reported by Su et al. [15], residues Phe179, Phe277, Ile607, and Trp610 create a hydrophobic patch that could be connected to the stabilization of substrates. The best pose of EtBr (with a binding energy of −7.3 kcal/mol) makes close contact with Trp610 and to some residues of the G-loop, such as Gly611, Phe612, and Gly614. It also interacts through a hydrogen bond (2.24 Å) with Asp83. Rip-B also bind to this region (with binding energy of −7.3 kcal/mol), in-between both binding sites, interacting with residues 610 through 615 of the G-loop. There is also a hydrogen bond with Gly615, and close contacts with several residues, with two in particular: Thr91 and Ser134. It is reported that the antibiotic gentamicin interacts with these residues and ciprofloxacin binding site overlaps with that of gentamicin (10.1128/mBio.01295-19). Interestingly, Tyr77, Thr91, and Ser134 are conserved residues between AdeB and the MexY pump. There’s reason to believe, therefore, that these residues play a significant role in drug recognition. As both EtBr and Rip-B bind to the same region of the binding site one could argue that Rip-B could act as a competitive inhibitor, preventing the extrusion of drugs as norfloxacin and EtBr. Binding near the G-loop, Rip-B could, for instance, hinder the passing of drugs from the proximal to the distal site. Its preferred site also overlaps with that of antibiotics such as gentamicin. Thus, they could also be expelled in place of the antibiotic, acting as a competitive inhibitor.

4. Materials and Methods

4.1. Strains and Chemicals

Evaluation of the Rip-B antimicrobial activity was performed against multidrug-resistant A. baumannii strains isolated from patients attended in an urgency hospital from Teresina, Piauí, Brazil. The isolates were collected from cultures of respiratory tract specimens (HUT 89 e HUT 90) and spinal cerebral fluid aspirate (HUT 105). Bacterial strain isolation was performed in blood agar followed by subculture in MacConkey Agar (Sigma–Aldrich) using duplicates. Bacterial strain identification was performed using the BD PHOENIX 5.1 automation method (Becton Dickison Sparks, MD 21152, USA) and confirmed on blaOXA-51 polymerase chain reaction (PCR), as described in item 4.6.

Assays for evaluation of the modulating effect of Rip-B on the antibiotic resistance were performed with multidrug-resistant A. baumannii (according to item 4.2) previously screened to resistance mediated by efflux pump phenotype with carbonylcyanide m-chlorophenylhydrazone (CCCP, Sigma–Aldrich), as described in item 4.3. For a comparison, also were conducted assays with strains expressing resistance not mediated by efflux pumps. Bacterial strains were maintained on Brain Heart Infusion Agar (BHIA, Himedia, India) slants at 4°C, and prior to the assay the cells were grown overnight at 37°C in Brain Heart Infusion (BHI, Himedia, India). Norfloxacin (Nor), ethidium bromide (EtBr), and chlorpromazine (CPZ) were obtained from Sigma Chemical Corp., St. Louis. Nor was dissolved in a mixture of 1 M NaOH and sterile distilled water (1 : 9 proportion). EtBr and CPZ were dissolved in sterile water. N-[2-(3,4-dimethoxyphenyl)ethyl]-benzamide (Riparin-B, Brazil) was prepared in dimethyl sulfoxide (DMSO, Merck) and then diluted with sterile water.

4.2. Antimicrobial Susceptibility Testing

Antimicrobial susceptibilities for isolates were determined initially using the BD PHOENIX 5.1 automation method (Becton Dickison Sparks, MD 21152, USA). The resistance profile of the isolated strains was confirmed by the diffusion method according to the Clinical and Laboratory Standards Institute - CLSI [41]. The tested antimicrobials were gentamycin (GEN), ceftriaxone (CRO), ciprofloxacin (CIP), ceftazidime (CAZ), levofloxacin (LEV), amikacin (AMI), cefepime (CPM), piperacillin-tazobactam (PPT), meropenem (MER), imipenem (IPM), sulfamethoxazole-trimethoprim (SUT), tigecycline (TIG), and colistin (COL) (Laborclin, Brazil). Pseudomonas aeruginosa ATCC 27853 and A. baumanii NCTC 13304 (Controlab, Brazil) were used as controls.

4.3. Determination of the Occurrence of Resistance Mediated by Efflux Pump Phenotype

To verify the occurrence of efflux pump-mediated resistance, MIC values of amikacin, ceftazidime or norfloxacin were determined in the presence or absence of a carbonyl cyanide m-chlorophenylhydrazone (CCCP, Sigma–Aldrich) solution at the subinhibitory concentration. CCCP is a decoupler from oxidative phosphorylation that interrupts the proton gradient of membranes. Microtitration plates were incubated at 37°C for 24 hours, and following this time 20 μl of a 0.01% (w/v) aqueous Resazurin sodium (Sigma–Aldrich) solution was added to each well. These plates were incubated for 1 hour at room temperature, where following this period a reading was performed taking into account that a change in coloration from blue to pink indicated the occurrence of bacterial growth due to resazurin reduction [42, 43]. As a criterion for classifying the occurrence of resistance mediated by the efflux pump phenotype, a minimum of a 2-fold antibiotic MIC reduction in the presence of CCCP was necessary [22].

4.4. Assays for Evaluation of the Intrinsic Antimicrobial Activity

Stock solutions of Rip-B or CPZ were prepared in DMSO (Merck), followed by dilution in sterile distilled water to a final concentration of 1024 μg·mL⁻¹. Minimal inhibitory concentrations (MICs) were determined by microdilution assay in BHI broth with bacterial suspensions of approximately 105 CFU·mL⁻¹ and concentrations of Rip-B (or CPZ) solution ranging from 8 to 512 μg·mL⁻¹. Microtiter plates were incubated at 37°C for 24 h, and then 20 μL of resazurin (0.01% w/v in sterile distilled water) was added to each well to detect bacterial growth by a visual color change from blue to pink as described above.

4.5. Assays for Evaluation of the Drug-Resistance Modulation

To evaluate if Rip-B was able to modulate antibiotic resistance in A. baumannii strains expressing or not resistance mediated by efflux pump phenotype, MIC value for norfloxacin was determined in the presence or absence of Rip-B solution at subinhibitory concentration (MIC 1/8). Antibiotic concentrations ranged from 0.125 to 128 μg·mL⁻¹. Microtiter plates were incubated at 37°C for 24 h and readings were performed with resazurin as described above. To verify if the drug-resistance modulation occurred due to efflux pump inhibition, modulation assays were performed replacing antibiotics by EtBr, which is a known substrate of efflux pumps [13]. Control assays were also performed replacing Rip-B y CPZ (Sigma–Aldrich) which is a known efflux pump inhibitor [19]. Microtiter plates were incubated at 37°C for 24 h, and then 20 μL of resazurin (0.01% w/v in sterile distilled water) was added to each well to detect bacterial growth by a visual color change from blue to pink as described above.

4.6. Identification of the AdeABC-AdeRS Efflux System Genes

Bacterial DNA was extracted from A. baumannii isolates by boiling. PCR was performed using Taq DNA Polymerase (Ludwig Biotec). The primes used were: OXA-51F: TCCAAATCACAGCGCTTCAAAA; OXA-51R: TGAGGCTGAACAACCCATCCA; AdeA F: GAGGTGGCAAGACTCAAAGTTC; AdeA F: GAGGTGGCAAGACTCAAAGTTC; AdeA R: GCTAGAGCCTGACGATACTGAGC; AdeB F: TACCGGTATTACCTTTGCCGGA; AdeB R: GTCTTTAAGTGTCGTAAAAGCCA; AdeC F: ACAATCGTATCTCGTGGACTC; AdeC R: TAGAAACTGGGTTATTGGGGT; AdeR F: ACTACGATATTGGCGACATT; AdeR R: GCGTCAGATTAAGCAAGATT; AdeS F: TTGGTTAGCCACTGTTATCT; AdeS R: AGTGGACGTTAGGTCAAGTT [44–46]. PCR was performed in a 25 μL reaction mixture containing 1 μL primer, 1 μL Taq polymerase (Ludwig Biotec), 3 μL DNA template, 3.0 mM MgCl2, 2.5 μL 10 × buffer, 0.2 mM dNTPs, and nuclease-free water. Amplification conditions consisted of denaturation at 94°C for 5 min and 30 cycles of denaturation at 94°C for 1 min, annealing at 56°C for 30 s and extension at 72°C for 1 min, with a final extension at 72°C for 10 min. PCR products were detected in 2% agarose gel.

4.7. Docking Procedure

The structure for the AdeABC efflux pump was downloaded from the RCSB.org [47] site (PDB-ID: 6OWS). The structure was uploaded to the MolProbity Server for protonation [48]. Ligands were optimized using the Gaussian 09 Program [49]. Initial structures were created in the GaussView module and were then optimized using the PM6 forcefield. Partial Gasteiger charges were added to the protein (although Autodock Vina ignores it) and to the ligand atoms using the AutoDock Tools interface [50], nonpolar hydrogen atoms were mixed while all other parameters were kept at their default values. Docking procedure was carried out using the Autodock Vina software [51]. The docking poses were chosen based on the best binding score.

4.8. Statistical Analysis

Experiments were performed in triplicate and results were normalized by calculation of geometric mean values. The error deviation and standard deviation of the geometric mean were revealed. Statistical analyzes were performed using GraphPad Prism, version 5.02. Differences between treatment with antibiotics (or EtBr) alone or associated with Rip-B or CPZ were examined using one-way analysis of variance (ANOVA). The differences mentioned above were analyzed by Bonferroni posttest and were considered statistically significant.

5. Conclusions

The combination of antibiotics with efflux pump inhibitors may be a promising strategy for the treatment of infections caused by multidrug-resistant A. baumannii. Results obtained in the present study showed that Rip-B was inactive against A. baumannii strains. However, Rip-B was able to increase the activity of norfloxacin against strains of A. baumannii that exhibit efflux pump-mediated resistance. The results obtained through Rip-B/EtBr association tests suggested that the increase in antibiotic activity probably involves the inhibition of overexpressed efflux pumps in the strains tested. The clinical isolates of A. baumannii MDR had genes for the AdeABC-AdeRS efflux system, with the AdeB gene present in all tested isolates. Docking studies show the interaction of Rip-B and EtBr with the proximal and distal sites of the AdeB protein, suggesting that Rip-B could act as a competitive inhibitor for both norfloxacin and EtBr, preventing the passage of these compounds from the proximal to the distal site. As a limitation, the present study did not investigate if Rip-B could inhibit the expression of the AdeABC-AdeRS genes. Thus, Rip-B could be applied as an adjuvant of norfloxacin in the treatment of infections caused by multi-resistant strains of A. baumannii with resistance by efflux pumps. However, in vivo preclinical studies will be needed to verify if Rip-B could enhance the norfloxacin activity against A. baumannii strains expressing AdeABC-AdeRS genes genes in animal models experimentally infected.

Data Availability

The data supporting the current study are given in the article.

Additional Points

Sample of the Riparin-B and clinical strains of the A. baumanii are available from the authors.

Conflicts of Interest

The authors declare no conflicts of interest.

Authors’ Contributions

J.H.L.F. and H.M.B. conceptualized the study. J.H.L.F., H.M.B., and N.C.M. wrote and prepared the original draft. S.J.C.G. performed synthesis of Riparin-B. C.E.S.N. performed docking procedure. P.V.S.L., A.L.S.F., A.B.S.M., and F.A.A.O. performed the methodology. P.V.S.L., H.M.B., and J.H.L.F. performed data analysis and interpreted the study. N.C.M. and H.M.B. performed supervision. All the authors have read and agreed with the published version of the manuscript. Humberto Medeiros Barreto and Josie Haydée Lima Ferreira Paranaguá contributed equally to this work.

Acknowledgments

This research was funded by Brazilian agencies Conselho Nacional de Desenvolvimento Científico e Tecnológico and Fundação de Amparo á Pesquisa do Estado do Piauí (grant: 050/2019).

References

B. Strommenger, M. D. Bartels, K. Kurt et al., “Evolution of methicillin-resistant Staphylococcus aureus towards increasing resistance,” Journal of Antimicrobial Chemotherapy, vol. 69, no. 3, pp. 616–622, 2014.
View at: Publisher Site | Google Scholar
E. Lopez-Camacho, R. Gomez-Gil, R. Tobes et al., “Genomic analysis of the emergence and evolution of multidrug resistance during a Klebsiella pneumonia outbreak including carbapenem and colistin resistance,” Journal of Antimicrobial Chemotherapy, vol. 69, no. 3, pp. 632–636, 2014.
View at: Publisher Site | Google Scholar
Brazilian Health Regulatory Agency, “Patient Safety and Quality in Health Services Bulletin 16: Evaluation of National Indicators of Health Care-Related Infections (IRAS) and Microbial Resistance in 2015,” 2016, https://www.gov.br/anvisa/pt-br/centraisdeconteudo/publicacoes/servicosdesaude/publicacoes/patient-safety-and-quality-in-health-services-bulletin-number-14.
View at: Google Scholar
A. F. Martins and A. L. Barth, “Multidrug-resistant Acinetobacter - a public health challenge,” Science and Medicine, vol. 23, no. 1, pp. 56–62, 2013.
View at: Publisher Site | Google Scholar
S. Figueiredo, L. Poirel, A. Papa, V. Koulourida, and P. Nordmann, “Overexpression of the naturally occurring blaOXA-51 gene in Acinetobacter baumannii mediated by novel insertion sequence ISAba9,” Antimicrobial Agents and Chemotherapy, vol. 53, no. 9, pp. 4045–4047, 2009.
View at: Publisher Site | Google Scholar
A. P. Zavascki, C. G. Carvalhaes, R. C. Picao, and A. C. Gales, “Multidrug-resistant Pseudomonas aeruginosa and Acinetobacter baumannii: resistance mechanisms and implications for therapy,” Expert Review of Anti-infective Therapy, vol. 8, no. 1, pp. 71–93, 2010.
View at: Publisher Site | Google Scholar
C. R. Lee, J. H. Lee, M. Park et al., “Biology of Acinetobacter baumannii: pathogenesis, antibiotic resistance mechanisms, and prospective treatment options,” Frontiers in Cellular and Infection Microbiology, vol. 7, p. 55, 2017.
View at: Publisher Site | Google Scholar
R. Vijayakumar, T. Sandle, M. S. Al-Aboody et al., “Distribution of biocide resistant genes and biocides susceptibility in multidrug-resistant Klebsiella pneumoniae, Pseudomonas aeruginosa and Acinetobacter baumannii — a first report from the Kingdom of Saudi Arabia,” Journal of Infection and Public Health, vol. 11, no. 6, pp. 812–816, 2018.
View at: Publisher Site | Google Scholar
L. F. Zafalon, A. Nader Filho, J. V. Oliveira, and F. Resende, “Subclinical mastitis caused by Staphylococcus aureus: cost-benefit of antibiotic therapy in lactating cows,” Arquivo Brasileiro de Medicina Veterinária e Zootecnia, vol. 59, no. 3, pp. 577–585, 2007.
View at: Publisher Site | Google Scholar
C. Werkman, D. C. Granato, W. D. Kerbauy, F. S. Sampaio, A. A. H. Brandão, and S. M. Rode, “Therapeutic applications of Punica granatum L. (pomegranate),” Brazilian Journal of Medicine, vol. 10, pp. 104–111, 2008.
View at: Google Scholar
A. C. Mafud, M. P. Silva, G. B. Nunes et al., “Antiparasitic, structural, pharmacokinetic, and toxicological properties of riparin derivatives,” Toxicology in Vitro, vol. 50, pp. 1–10, 2018.
View at: Publisher Site | Google Scholar
L. M. Costa, E. de Macedo, F. A. A. Oliveira et al., “Inhibition of the NorA efflux pump of Staphylococcus aureus by synthetic riparins,” Journal of Applied Microbiology, vol. 121, no. 5, pp. 1312–1322, 2016.
View at: Publisher Site | Google Scholar
P. N. Markham, E. Westhaus, K. Klyachko, M. E. Johnson, and A. A. Neyfakh, “Multiple novel inhibitors of the NorA multidrug transporter of Staphylococcus aureus,” Antimicrobial Agents and Chemotherapy, vol. 43, no. 10, pp. 2404–2408, 1999.
View at: Publisher Site | Google Scholar
A. M. Braga Ribeiro, J. N. d. Sousa, L. M. Costa et al., “Antimicrobial activity of Phyllanthus amarus schumach. & thonn and inhibition of the NorA efflux pump of Staphylococcus aureus by phyllanthin,” Microbial Pathogenesis, vol. 130, pp. 242–246, 2019.
View at: Publisher Site | Google Scholar
C. C. Su, C. E. Morgan, S. Kambakam et al., “Cryo-electron microscopy structure of an Acinetobacter baumannii multidrug efflux pump,” mBio, vol. 10, no. 4, pp. 1295–1319, 2019.
View at: Publisher Site | Google Scholar
L. R. Lima, L. V. Soares, E. E. Freitas et al., “Prevalence of extremely drug resistant (xdr) Acinetobacter baumannii at a northeast Brazilian emergency hospital,” International Journal of Development Research, vol. 11, no. 11, Article ID 51432, 2021.
View at: Publisher Site | Google Scholar
P. Mohajeri, A. Farahani, M. M. Feizabadi, and B. Norozi, “Clonal evolution multi-drug resistant Acinetobacter baumannii by pulsed-field gel electrophoresis,” Indian Journal of Medical Microbiology, vol. 33, no. 1, pp. 87–91, 2015.
View at: Publisher Site | Google Scholar
R. Ranjbar and A. Farahani, “Study of genetic diversity, biofilm formation, and detection of Carbapenemase, MBL, ESBL, and tetracycline resistance genes in multidrug-resistant Acinetobacter baumannii isolated from burn wound infections in Iran,” Antimicrobial Resistance and Infection Control, vol. 8, no. 1, pp. 172–181, 2019.
View at: Publisher Site | Google Scholar
P. Mohajeri, M. Eghbalimoghadam, A. Farahani, and F. Akbar, “Frequency of Class 1 integron and genetic diversity of Acinetobacter baumannii isolated from medical centers in Kermanshah,” Journal of Natural Science, Biology and Medicine, vol. 8, no. 2, p. 193, 2017.
View at: Publisher Site | Google Scholar
P. Mohajeri, S. Sharbati, A. Farahani, and Z. Rezaei, “Evaluate the frequency distribution of nonadhesive virulence factors in carbapenemase-producing Acinetobacter baumannii isolated from clinical samples in Kermanshah,” Journal of Natural Science, Biology and Medicine, vol. 7, no. 1, p. 58, 2016.
View at: Publisher Site | Google Scholar
P. Mohajeri, A. Farahani, and R. S. Mehrabzadeh, “Molecular characterization of multidrug resistant strains of Acinetobacter baumannii isolated from intensive care units in west of Iran,” Journal of Clinical and Diagnostic Research: Journal of Clinical and Diagnostic Research, vol. 11, no. 2, pp. DC20–DC22, 2017.
View at: Publisher Site | Google Scholar
R. M. R. Catão, J. M. B. Filho, S. J. C. Gutierrez et al., “Evaluation of the antimicrobial activity of Riparinas on multi-resistant Staphylococcus aureus and Escherichia coli strains,” Rev Bras Anal Clin, vol. 37, pp. 247–249, 2005.
View at: Google Scholar
P. J. Houghton, M. J. Howes, C. C. Lee, and G. Steventon, “Uses and abuses of in vitro tests in ethnopharmacology: visualizing an elephant,” Journal of Ethnopharmacology, vol. 110, no. 3, pp. 391–400, 2007.
View at: Publisher Site | Google Scholar
R. M. R. Catão, J. M. B. Filho, E. O. Lima, M. S. V. Pereira, T. A. Arruda, and R. P. A. Miranda, “Evaluation of antimicrobial activity and biological effects of riparins on elimination of drug resistance in samples of Staphylococcus aureus,” Rev Bras Anal Clin, vol. 42, pp. 9–14, 2010.
View at: Google Scholar
A. A. Neyfakh, C. M. Borsch, and G. W. Kaatz, “Fluoroquinolone resistance protein NorA of Staphylococcus aureus is a multidrug efflux transporter,” Antimicrobial Agents and Chemotherapy, vol. 37, no. 1, pp. 128-129, 1993.
View at: Publisher Site | Google Scholar
B. D. Schindler and G. W. Kaatz, “Multidrug efflux pumps of Gram- positive bacteria,” Drug Resistance Updates, vol. 27, pp. 1–13, 2016.
View at: Publisher Site | Google Scholar
A. Ardebili, M. Talebi, L. Azimi, and A. Rastegar Lari, “Effect of efflux pump inhibitor Carbonyl cyanide 3-chlorophenylhydrazone on the minimum inhibitory concentration of ciprofloxacin in Acinetobacter baumannii clinical isolates,” Jundishapur Journal of Microbiology, vol. 7, pp. 8691–8695, 2014.
View at: Publisher Site | Google Scholar
C. F. Xu, S. R. Bilya, and W. Xu, “AdeABC efflux gene in Acinetobacter baumannii,” New Microbes and New Infections, vol. 30, Article ID 100549, 2019.
View at: Publisher Site | Google Scholar
A. Ardebili, A. Lari, and A. Hashemi, “AdeR-AdeS mutations & overexpression of the AdeABC efflux system in ciprofloxacin-resistant Acinetobacter baumannii clinical isolates,” Indian Journal of Medical Research, vol. 147, pp. 413–421, 2018.
View at: Publisher Site | Google Scholar
W. Zhu, H. Wang, and J. P. Zhang, “A comparison of adeB gene expression levels under conditions of induced resistance by different drugs in vitro in Acinetobacter baumannii,” Experimental and Therapeutic Medicine, vol. 13, no. 5, pp. 2177–2182, 2017.
View at: Publisher Site | Google Scholar
J. Provasi Cardoso, R. Cayo, R. Girardello, and A. C. Gales, “Diversity of mechanisms conferring resistance to β-lactams among OXA-23–producing Acinetobacter baumannii clones,” Diagnostic Microbiology and Infectious Disease, vol. 85, no. 1, pp. 90–97, 2016.
View at: Publisher Site | Google Scholar
E. J. Yoon, Y. N. Chabane, S. Goussard et al., “Contribution of resistance-nodulation-cell division efflux systems to antibiotic resistance and biofilm formation in Acinetobacter baumannii,” mBio, vol. 6, pp. 309–315, 2015.
View at: Publisher Site | Google Scholar
Y. Chen, L. Ai, P. Guo et al., “Molecular characterization of multidrug resistant strains of Acinetobacter baumannii isolated from pediatric intensive care unit in a Chinese tertiary hospital,” BMC Infectious Diseases, vol. 18, no. 1, pp. 614–617, 2018.
View at: Publisher Site | Google Scholar
E. J. Yoon, P. Courvalin, and C. Grillot-Courvalin, “RND-type efflux pumps in multidrug-resistant clinical isolates of Acinetobacter baumannii: major role for AdeABC overexpression and AdeRS mutations,” Antimicrobial Agents and Chemotherapy, vol. 57, no. 7, pp. 2989–2995, 2013.
View at: Publisher Site | Google Scholar
J. R. Sun, C. L. Perng, J. C. Lin et al., “AdeRS combination codes differentiate the response to efflux pump inhibitors in tigecycline-resistant isolates of extensively drug-resistant Acinetobacter baumannii,” European Journal of Clinical Microbiology & Infectious Diseases, vol. 33, no. 12, pp. 2141–2147, 2014.
View at: Publisher Site | Google Scholar
T. Y. Chang, B. J. Huang, J. R. Sun et al., “AdeR protein regulates adeABC expression by binding to a direct-repeat motif in the intercistronic spacer,” Microbiological Research, vol. 183, pp. 60–67, 2016.
View at: Publisher Site | Google Scholar
J. R. Sun, C. L. Perng, M. C. Chan et al., “A truncated AdeS kinase protein generated byISAba1insertion correlates with tigecycline resistance in Acinetobacter baumannii,” PLoS One, vol. 7, no. 11, Article ID 49534, 2012.
View at: Publisher Site | Google Scholar
M. F. Lin, Y. Y. Lin, and C. Y. Lan, “The role of the two-component system BaeSR in disposing chemicals through regulating transporter systems in Acinetobacter baumannii,” PLoS One, vol. 10, no. 7, Article ID 132843, 2015.
View at: Publisher Site | Google Scholar
T. Siriyong, P. Srimanote, S. Chusri et al., “Conessine as a novel inhibitor of multidrug efflux pump systems in Pseudomonas aeruginosa,” BMC Complementary and Alternative Medicine, vol. 17, no. 1, p. 405, 2017.
View at: Publisher Site | Google Scholar
T. Siriyong, S. Chusri, P. Srimanote, V. Tipmanee, and S. P. Voravuthikunchai, “Holarrhena antidysenterica extract and its steroidal alkaloid, conessine, as resistance-modifying agents against extensively drug-resistant acinetobacter baumannii,” Microbial Drug Resistance, vol. 22, no. 4, pp. 273–282, 2016.
View at: Publisher Site | Google Scholar
CLSI, Performance Standards for Antimicrobial Susceptibility Testing CLSI Supplement M100S, Clinical and Laboratory Standards Institute, Wayne, PA, USA, 26th edition, 2016.
A. Martin, M. Camacho, F. Portaels, and J. C. Palomino, “Resazurin microtiter assay plate testing of Mycobacterium tuberculosis susceptibilities to second-line drugs: rapid, simple, and inexpensive method,” Antimicrobial Agents and Chemotherapy, vol. 47, no. 11, pp. 3616–3619, 2003.
View at: Publisher Site | Google Scholar
C. M. Mann and J. L. Markham, “A new method for determining the minimum inhibitory concentration of essential oils,” Journal of Applied Microbiology, vol. 84, no. 4, pp. 538–544, 1998.
View at: Publisher Site | Google Scholar
S. Pagdepanichkit, C. Tribuddharat, and R. Chuanchuen, “Distribution and expression of the Ade multidrug efflux systems in Acinetobacter baumannii clinical isolates,” Canadian Journal of Microbiology, vol. 62, no. 9, pp. 794–801, 2016.
View at: Publisher Site | Google Scholar
W. Ni, Y. Han, J. Zhao et al., “Tigecycline treatment experience against multidrug-resistant Acinetobacter baumannii infections: a systematic review and meta-analysis,” International Journal of Antimicrobial Agents, vol. 47, no. 2, pp. 107–116, 2016.
View at: Publisher Site | Google Scholar
S. Pannek, P. G. Higgins, P. Steinke et al., “Multidrug efflux inhibition in Acinetobacter baumannii: comparison between 1-(1-naphthylmethyl)-piperazine and phenyl-argininebeta-naphthylamide,” Journal of Antimicrobial Chemotherapy, vol. 57, no. 5, pp. 970–974, 2006.
View at: Publisher Site | Google Scholar
H. M. Berman, J. Westbrook, Z. Feng et al., “The protein data bank,” Nucleic Acids Research, vol. 28, no. 1, pp. 235–242, 2000.
View at: Publisher Site | Google Scholar
V. B. Chen, W. B. Arendall, J. J. Headd et al., “MolProbity: all-atom structure validation for macromolecular crystallography,” Acta Crystallographica Section D Biological Crystallography, vol. 66, no. 1, pp. 12–21, 2010.
View at: Publisher Site | Google Scholar
M. J. Frisch, G. W. Trucks, H. B. Schlegel et al., “Gaussian 16, Revision C. 01,” 2016, https://gaussian.com/citation/.
View at: Google Scholar
G. M. Morris, R. Huey, W. Lindstrom et al., “AutoDock4 and AutoDockTools4: a,” Journal of Computational Chemistry, vol. 30, no. 16, pp. 2785–2791, 2009.
View at: Publisher Site | Google Scholar
O. Trott and A. J. Olson, “AutoDock Vina: i,” Journal of Computational Chemistry, vol. 31, no. 2, pp. 455–461, 2010.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2023 Patrícia Virna Sales Leão et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

694

Downloads

388

Citations