- Split View
-
Views
-
Cite
Cite
Donna Ray, Ailing Wu, J. Erby Wilkinson, Hedwig S. Murphy, Qianjin Lu, Barbara Kluve-Beckerman, Juris J. Liepnieks, Merrill Benson, Raymond Yung, Bruce Richardson, Aging in Heterozygous Dnmt1-Deficient Mice: Effects on Survival, the DNA Methylation Genes, and the Development of Amyloidosis, The Journals of Gerontology: Series A, Volume 61, Issue 2, February 2006, Pages 115–124, https://doi.org/10.1093/gerona/61.2.115
- Share Icon Share
Abstract
We previously reported that heterozygous DNA methyltransferase 1-deficient (Dnmt1+/−) mice maintain T-cell immune function and DNA methylation levels with aging, whereas controls develop autoimmunity, immune senescence, and DNA hypomethylation. We therefore compared survival, cause of death, and T-cell DNA methylation gene expression during aging in Dnmt1+/− mice and controls. No difference in longevity was observed, but greater numbers of Dnmt1+/− mice developed jejunal apolipoprotein AII amyloidosis. Both groups showed decreased Dnmt1 expression with aging. However, expression of the de novo methyltransferases Dnmt3a and Dnmt3b increased with aging in stimulated T cells from control mice. MeCP2, a methylcytosine binding protein that participates in maintenance DNA methylation, increased with age in Dnmt1+/− mice, suggesting a mechanism for the sustained DNA methylation levels. This model thus provides potential mechanisms for DNA methylation changes of aging, and suggests that changes in DNA methylation may contribute to some forms of amyloidosis that develop with aging.
THE methylation of deoxycytosine (dC) bases in CpG pairs can suppress gene expression. DNA methylation patterns are established during differentiation, and serve to suppress genes unnecessary or detrimental to the function of mature cells. However, DNA methylation patterns change with aging in a complex fashion, generally with an overall decrease in total genomic deoxymethylcytosine (dmC) content, but with localized increases in some CpG islands (1). These methylation changes are important and contribute to disease development with aging. Demethylation of certain T-cell sequences is implicated in the development of autoimmunity (2,3), and decreased expression of tumor suppressor genes contributes to the development of malignancies (4). The mechanisms causing the methylation changes are unclear. DNA methylation patterns are replicated during mitosis by the maintenance DNA methyltransferase Dnmt1, which preferentially methylates hemimethylated DNA, whereas the de novo methyltransferases Dnmt3a and Dnmt3b can methylate previously unmethylated sequences (5). The effect of age on these enzymes is not well characterized, although decreased Dnmt1 expression could lead to progressive DNA demethylation with age, whereas increased expression of the de novo methyltransferases Dnmt3a and Dnmt3b with age might contribute to CpG island hypermethylation.
DNA methylation suppresses gene expression primarily through the effects of methylcytosine binding proteins such as MeCP2, which tether chromatin inactivation complexes to the methylated sequences, causing a locally repressive chromatin configuration (6). Expression of the methylcytosine binding proteins may also change with age, affecting chromatin structure and gene expression. The expression of the methylcytosine binding proteins is not well characterized in aging.
Our group has examined immune aging in heterozygous Dnmt1-deficient (Dnmt1+/−) mice (7). We hypothesized that mice heterozygous for a null mutation in the maintenance DNA methyltransferase gene Dnmt1 would demethylate T-lymphocyte DNA more rapidly with age than would their wild-type littermates, leading to accelerated autoimmunity and immune senescence [homozygous Dnmt1 deletion is embryonic lethal (8)]. Paradoxically, the Dnmt1+/− mice developed signs of immune senescence and autoimmunity more slowly than did their wild-type littermates. This prompted comparison of total genomic dmC levels and expression of the methyltransferases and methylcytosine binding proteins with aging in both groups. As expected, T-cell DNA methylation in the controls was stable from 6 to 11 months of age, then demethylated between 11 and 18 months of age as the mice developed autoimmunity and immune senescence. Similarly, T-cell DNA from the young Dnmt1+/− mice was hypomethylated as reported by others (8). Surprisingly though, genomic T-cell dmC content in the Dnmt1+/− mice then increased from 6 to 11 months of age, approximating the controls by 11 months. This level was maintained from 11 to at least 18 months of age, along with normal immune function and a lack of autoimmunity, while T cells from the controls demethylated, and the mice acquired autoimmunity and immune senescence (7). Brain DNA was also demethylated at 18 months of age in the controls relative to the Dnmt1-deficient mice. Comparison of Dnmt 1, 3a, and 3b transcripts, and methylcytosine binding protein (MBD1, MBD2, MBD3, MBD4, and MeCP2) transcripts in the brains revealed that only MeCP2 was differentially expressed between the groups: MeCP2 decreased with age in the controls but not in the Dnmt1+/− mice (7). There was no change in brain methyltransferase expression with age in either group, and of the methylcytosine binding proteins MBD3 decreased equally with age in both groups, whereas MBD1 and MBD2 did not change (7).
Based on the observations that T-cell DNA methylation increased with age in the Dnmt1+/− mice, and that the Dnmt1+/− mice developed autoimmunity and immune senescence more slowly, we hypothesized that the Dnmt1 null mutation might alter the development of age and DNA methylation-dependent diseases such as cancer. Because DNA methyltransferase expression increases following T-cell stimulation (9), we also hypothesized that differences in the magnitude of DNA methyltransferase increases following mitogenic stimulation might contribute to the increase in dmC content observed with aging in the Dnmt1+/− strain relative to controls, and possibly to the sustained dmC levels in the mutant mice with age. MeCP2 differences between groups, if confirmed, might also contribute. We therefore performed survival studies on heterozygous Dnmt1-deficient mice and controls, and compared DNA methyltransferase and MeCP2 expression in unstimulated and stimulated T cells from adult (11 month) and old (19 month) mice.
Methods
Mice
Heterozygous male Dnmt1-deficient mice, bred onto a C57BL/6 background, and their wild-type littermates were obtained from The Jackson Laboratory (Bar Harbor, ME) and housed in a specific pathogen-free environment in the University of Michigan Unit for Laboratory Animal Medicine. Sentinel mice from this colony were tested every 3 months for antibodies to murine viral pathogens, and all tests were negative during the experimental period.
Histologic Analyses
Tissues were fixed, embedded in paraffin, sectioned, and stained with hematoxylin and eosin or Congo Red by using previously published protocols (7). Slides were read by a pathologist who was blinded to the groups being studied.
Isolation and Identification of Amyloid Protein From Formalin-Fixed Paraffin-Embedded Mouse Intestine Sections
Amyloid protein was isolated from unstained, 4 μm-thick sections of intestine cut from a formalin-fixed, paraffin-embedded mouse tissue block and placed on glass slides (10). As previously described (11), tissue sections were deparaffinized and rehydrated, and intestine sections were scraped off and treated with 6M guanidine hydrochloride containing dithiothreitol. After alkylation with iodoacetic acid, the sample was centrifuged, filtered, exhaustively dialyzed against water, and lyophilized. The extract was digested with trypsin and fractionated on a SynChropak RP-8 column (100 × 4.6 mm; Synchrom, Lafayette, IN) eluted with an acetonitrile gradient. Samples were subjected to Edman degradation analysis on an Applied Biosystems (Foster City, CA) model 491cLC protein sequencer using the manufacturer's standard cycles.
Immunohistochemical Characterization of Amyloid
Apolipoprotein AII (ApoAII) was detected immunochemically in paraffin-embedded tissues using the VECTASTAIN ABC method (Vector Laboratories, Burlingame, CA). Antiserum against mouse ApoAII was provided by Dr. K. Higuchi (Shinsh University Graduate School of Medicine) and used at a dilution of 1:1000.
T-Cell Isolation and Culture
Spleens were removed from the mice, and splenocytes were recovered as described (7). T cells were isolated with Miltenyi beads using protocols provided by the manufacturer, then stimulated with immobilized anti-CD3 and soluble anti-CD28 and cultured as previously described by our group (7).
Quantitative Reverse Transcription–Polymerase Chain Reaction
Unstimulated and stimulated T cells were suspended in Trizol (GIBCO-BRL, Gaithersburg, MD) and homogenized, and total RNA was purified according to the manufacturer's protocol. Real-time reverse transcription–polymerase chain reaction was performed with a LightCycler thermocycler (Roche, Indianapolis, IN), using previously published protocols and primers for murine Dnmt1, Dnmt3a, Dnmt3b, and MeCP2 (7). At the completion of amplification, melting characteristics of the product were determined, and water was included as a negative control to rule out primer dimer formation. A series of five dilutions of one RNA sample was included to generate a standard curve; this curve was used to obtain relative concentrations of the transcript of interest in each of the RNA samples, using LightCycler software. Results are presented relative to β-actin or histone H4 transcripts, similarly amplified using the following primers, listed as forward; reverse: H4: 5′ACAACATCCAGGGCATCACG; 5′GAACACCTTCAGCACACCGC and β-actin: 5′GAAAATCGTGCGTGACATCAAAG; 5′CATACCCAAGAAGGAAGGCTGG.
Statistical Analysis
Differences in survival between groups were tested using the Mantel–Haenszel test calculated with Systat 10 software (Evanston, IL). Differences between means were tested using Student's t test, and between groups by chi-square analysis. Effects of T-cell stimulation on Dnmt expression over time were tested using the residual maximum likelihood (REML) method.
Results
Effect of Dnmt1 Deficiency on Longevity and Cause of Death
The effect of the heterozygous Dnmt1 null mutation on longevity and cause of death was determined using 54 male mice heterozygous for Dnmt1 deficiency and 56 wild-type male littermates. Of these, 9 of the Dnmt1-deficient mice and 4 of the controls were excluded for accidental deaths, with a total of 45 Dnmt1+/− and 52 control mice analyzed. Figure 1 compares survival between the groups. The mean age at death of the controls was 29.3 months, and it was 29.0 months for the Dnmt1+/− mice; this result compared favorably with those of other studies (12). No difference in survival was seen between the groups (p =.81 by Mantel–Haenszel test).
Hypothesizing a difference in the development of malignancies between the two cohorts, we performed autopsies on 32 of the controls and 29 of the Dnmt1+/− mice. The results are shown in Table 1. No obvious cause of death was identified in 17 of the controls and 11 of the Dnmt1-deficient mice. Thirteen of the controls developed malignancies, with lymphoma the most common. In contrast, eight of the Dnmt1+/− mice developed malignancies, with four being lymphomas. The difference in the number of malignancies between the two cohorts was not significant (p >.05 by chi square). Unexpectedly, 10 of the Dnmt1+/− mice developed amyloidosis of the jejunum, compared to 2 of the controls. The increased number of Dnmt1+/− mice developing jejunal amyloidosis was significant (p <.02 by chi-square analysis, p <.04 with Bonferroni correction for the malignancy comparison). The average age at death of mice with amyloidosis was 2.5 ± 0.1 years in the Dnmt1+/− and 2.4 ± 0.3 years in the controls, whereas the average age of death in mice with lymphoma was 2.3 ± 0.3 years in the Dnmt1+/− and 2.5 ± 0.3 years in the controls (mean ± standard deviation [SD]). The similarity in age of mice dying with these conditions may contribute to the lack of differential survival between groups.
Figure 2 shows a representative jejunal specimen from a heterozygous Dnmt1-deficient mouse with amyloid stained with hematoxylin and eosin, and demonstrating increased amounts of proteinaceous material distributed diffusely throughout the villi. Figure 3 shows a jejunal section stained with Congo Red and viewed under conventional (A) and polarized (B) light. Bright apple green birefringence is seen under polarizing light, consistent with amyloid deposition. Similar Congo Red staining of the brain, kidney, heart, liver, lung, pancreas, and spleen demonstrated no significant amyloid deposition, although there were scant amounts in the loose connective tissue surrounding the esophagus and other tissues. Thus the deposition was largely confined to the jejunum.
Amyloid Characterization
To identify the amyloid subtype, protein was solubilized from formalin-fixed, paraffin-embedded jejunal tissue sections with guanidine hydrochloride and digested with trypsin, and the resulting peptides were fractionated by reverse-phase high performance liquid chromatography (HPLC). Edman analysis of one eluted peak yielded the sequence: Thr-Ser-Glu-Ile-Gln-Ser-Gln-Val-Lys. Basic Local Alignment Search Tool (BLAST) analysis of the sequence showed that it was identical to mouse ApoAII precursor residues 54–62 or mature plasma ApoAII residues 31–39. The identity of the amyloid was verified by immunohistochemistry using anti-ApoAII, provided by Dr. K. Higuchi. Figure 4A shows heavy ApoAII deposition in the jejunum of a Dnmt1+/− mouse 32 months of age. Figure 4B shows absence of staining in a control mouse 31 months of age, and C and D of Figure 4 show patchy and significantly less intense ApoAII deposition in jejunal tissue from another control 32 months of age. The results thus indicate that the amyloid is derived from ApoAII as occurs in the senescence-accelerated mouse and occasionally in other strains (13), and that its deposition is accelerated in the Dnmt1+/− strain.
We considered the possibility that the amyloid deposition contributed to the demise of the animals through malnutrition. This possibility was tested by comparing weights of mice dying from amyloidosis to mice dying from malignancies. In the Dnmt1+/− group, the average weight at death of the mice with amyloid was 23.8 ± 2.9 grams (mean ± SD), and the average weight of the mice with malignancies was 29.5 ± 6.1 grams. Similarly, the mean weight of the control mice with amyloid was 20.3 ± 3.7 grams, and 31.7 ± 8.2 grams in the mice with malignancies. Combining all mice with malignancies and mice with amyloid, the decreased weight of the mice with amyloid was significant (p =.001 by t test).
Effect of Aging on DNA Methyltransferase and MeCP2 Expression in Dnmt1-Deficient and Control Mice
The other goal of these studies was to compare the magnitude of DNA methyltransferase increases following mitogenic stimulation in adult and old Dnmt1-deficient mice and controls as well as changes in MeCP2 levels with aging in the same groups. As noted above, our earlier work demonstrated that total genomic dmC content was approximately the same in T cells from 11-month-old control and Dnmt1-deficient mice, and decreased significantly by 18 months of age in the control mice as reported by others for other murine tissues (14), but not in the Dnmt1 knockout mice. There were no significant shifts in memory and naïve or CD4+ and CD8+ subsets in either group of mice during this time (7), arguing for an intrinsic effect on the mechanisms maintaining DNA methylation levels rather than an effect due to changes in T-cell subsets. In the present studies we therefore compared DNA methyltransferase and MeCP2 transcripts in unstimulated and stimulated T cells from adult and old Dnmt1-deficient mice and controls.
Splenic T lymphocytes were isolated from 4–5 adult (11.2 ± 1.2 months, mean ± SD) or old (19.4 ± 1.4 months) heterozygous Dnmt1-deficient mice and their wild-type littermates. The purified T cells were stimulated with anti-CD3 + anti-CD28, and cells were harvested at 0, 6, and 24 hours. Dnmt1 transcripts were measured relative to histone H4, as others have reported that levels are linked to the cell cycle (15). In contrast, Dnmt3a and Dnmt3b are not cell cycle linked (9), and were measured relative to β-actin. Figure 5 shows the effect of age on the Dnmt transcripts in unstimulated and stimulated T cells from the wild-type and Dnmt1+/− mice. In the control mice (left panels), Dnmt1 levels were higher in unstimulated cells from the adult mice relative to the old, and remained higher at all time points tested (p =.002 overall). The relative decrease in Dnmt1 expression with age was also observed in the unstimulated (T = 0) cells when transcripts were quantitated relative to actin (0.96 ± 0.10 vs 0.27 ± 0.04, adult vs old, mean ± SEM, p =.001 by t test). In contrast, Dnmt3a and Dnmt3b transcripts were essentially identical in unstimulated T cells from the adult and old control mice, but increased significantly more in the old control group following stimulation (p =.0002 overall for Dnmt3a and p =.027 overall for Dnmt3b). Because T-cell DNA demethylates over this time span in these mice (7), these results raise the possibility that decreased maintenance DNA methylation, mediated by Dnmt1, may contribute to the demethylation with age, and that increases in Dnmt3a and 3b (the de novo methyltransferases) do not compensate.
Similar to those in the control mice, Dnmt1 transcripts in the heterozygous Dnmt1-deficient mice also decreased with age (p =.0005 overall). However, there was no significant effect of age on Dnmt3a or Dnmt3b transcripts. DNA methylation is maintained over this time in the Dnmt1-deficient mice, despite the decrease in Dnmt1. This sustained DNA methylation argues against decreases in Dnmt1 levels alone as causing progressive DNA demethylation with age in these mice. Further, there were no compensatory increases in the de novo methyltransferases.
We considered the possibility that differences in the relative amounts of the methyltransferases between the control and Dnmt1+/− mice could contribute to the differences in DNA methylation. Figure 6 shows the same data analyzed to compare the transcripts in adult and old control and Dnmt1+/− mice. There is no significant difference in Dnmt1 or Dnmt3a transcripts in the adult control and the Dnmt1+/− mice at any time point (left panels). However, there were significantly greater amounts of Dnmt3b 6 hours after stimulation of the Dnmt1+/− mice relative to controls (p =.04). The increase in Dnmt3b in the adult Dnmt1+/− mice suggests a possible explanation for the increase in T-cell DNA methylation seen between 6 and 11 months of age in these mice previously reported by our group (7). The right panels compare the transcripts in the old cohorts. There were no statistically significant differences between the two groups by 20 months of age for any of the three transcripts at any time point, although there is a trend toward increased expression in stimulated cells from the controls. The observation that none of the methyltransferases were significantly increased in the old Dnmt1+/− mice relative to controls argues against the possibility that DNA methylation levels are maintained in the aging Dnmt1+/− mice by increased levels of one or more of the DNA methyltransferases.
Our earlier study found that MeCP2 levels decrease with age in the brains of the control but not the Dnmt1-deficient mice (7). Others reported that MeCP2 maintains DNA methylation by binding Dnmt1 and hemimethylated DNA, focusing methyltransferase activity on the hemimethylated substrate and restoring fully methylated DNA (16). We therefore compared MeCP2 transcript levels in T cells from adult and old controls and from Dnmt1-deficient mice (Figure 7). MeCP2 transcript levels were not significantly different in the adult controls and Dnmt1+/− mice. There was a small but not statistically significant decrease in MeCP2 levels with age in the control mice (p =.22, adult vs old controls by analysis of variance and post hoc testing with Bonferroni correction). In contrast, the transcript levels increased significantly with age in the Dnmt1+/− mice (p =.004 adult vs old). The difference between the old controls and Dnmt1+/− mice was also significant (p =.03). There was no significant effect of stimulation on MeCP2 transcript levels (not shown). These observations raise the possibility that MeCP2 overexpression might contribute to the stability of DNA methylation patterns with age in the Dnmt1+/− group by tethering Dnmt1 to hemimethylated sites, despite an overall decrease in maintenance Dnmt1 levels (vide infra).
Discussion
The major conclusions from this study are that the heterozygous Dnmt1-null mutation does not significantly modify overall longevity in C57BL/6 mice, that the Dnmt1+/− mice develop jejunal ApoAII amyloidosis more frequently than do controls, that aging affects DNA methyltransferase and MeCP2 expression differently in the control and Dnmt1+/− mice, and that de novo methyltransferase transcripts increase with age in dividing T cells from normal mice. Recent reports indicate that C57BL/6 mice die most commonly from malignancies, with lymphoma the most frequent and occurring in as many as 60% (12). Lymphoma was the most commonly encountered malignancy in our control group, although fewer (∼25%) had lymphoma at death than were reported by others (12). As the overall survival in the present study compares favorably to others, the reason for the decreased incidence of malignancy in the controls is uncertain. The Dnmt1-deficient mice developed somewhat fewer malignancies, particularly lymphomas, although the difference was not statistically significant. The lack of statistical significance may be due to the lower-than-expected incidence of lymphoma and therefore lack of statistical power, because DNA hypomethylation has been reported to contribute to genomic instability and lymphoma development in mice (17,18), and DNA demethylates in the controls but not the Dnmt1+/− mice (7). Interestingly, heterozygous Dnmt1 deficiency can decrease the incidence of intestinal tumor formation in Apc(Min/+) mice (19), although only one was observed in our study, and was in a Dnmt1-deficient mouse.
The development of amyloidosis in the Dnmt1+/− mice was unexpected. The jejunal amyloidosis may have contributed to the death of the affected mice, because their weight was significantly lower than that of the mice dying from cancers. This is also supported by reports that ApoAII deposition shortens murine life span by ∼20% (20). No overall effect on survival was noted, though, probably because the amyloidosis developed late in life, and the control mice likely succumbed to other causes at the same age.
Characterization of the amyloid included isolation and sequencing of a fragment of the protein, and indicated that the protein was ApoAII. Mutations in the gene encoding this protein cause a form of hereditary amyloidosis in humans (21). A peptide corresponding to ApoAII residues 31–39 showed a valine at position 38. This indicates ApoAIIA, the allele occurring in C57BL/6 mice (13). Others have reported similar ApoAII deposition in old C57BL6 mice (13). However, the deposition is highly dependent on the conditions under which the mice are raised, with ApoAIIA deposition detected in C57BL/6 and BDF1 mice aged in some laboratories and not others (13). Our observation that deposition was increased in the Dnmt1-deficient mice relative to wild-type littermates, raised in adjacent cages in the same facility, suggests that epigenetic changes in DNA methylation patterns may contribute to variability in onset between institutions. These changes could reflect differences in nutritional factors affecting transmethylation reactions [such as folic acid, methionine, B12, choline, and others decreasing transmethylation reactions (22)], or in factors increasing pools of S-adenosylhomocysteine, an inhibitor of transmethylation reactions (23). Others have proposed that DNA methylation changes may predispose to deposition of other types of amyloid with aging, including demethylation of the amyloid A4 precursor gene in Alzheimer's disease (24); the present findings support this mechanism.
The effects of heterozygous Dnmt1 deficiency on DNA methyltransferase expression in aging is also of interest. We previously reported that T cells from young (6-month-old) Dnmt1-deficient mice are hypomethylated relative to those of age-matched littermates, but by 11 months of age increased total dmC content is equal to that of their wild-type littermates. Although the present study focused on changes occurring between adulthood and old age, and did not examine young mice, it is possible that the increase in Dnmt3b found in the Dnmt1+/− mice participated in the increase. An increase in methylation indicates de novo methylation of previously unmethylated sequences, and de novo methylation is mediated by Dnmt3a and Dnmt3b, although Dnmt1 may contribute through methylation spreading (25). No differences in Dnmt3a expression were observed, and Dnmt1 decreased with age, making the observed increase in Dnmt3b a candidate mechanism. Very little Dnmt3b is expressed in normal T cells (9), and the increase observed may represent a compensatory mechanism, as previously proposed by ourselves and others (26).
Our previous study also demonstrated that total genomic T-cell dmC content decreased between 11 and 18 months of age in the controls but did not change in the Dnmt1+/− mice. This finding could not be attributed to shifts in memory and naïve subsets, because no significant changes were observed in these subsets between 11 and 18 months in the Dnmt1+/− mice and controls (7). Similarly, no significant effects were seen on CD4+ and CD8+ T-cell subsets during this time (7). As discussed above, Dnmt1 levels decreased with age in both the controls and the Dnmt1+/− mice, and there was no increase in the de novo methyltransferases in the Dnmt1+/− mice to explain the sustained levels. Thus, changes in DNA methyltransferase transcripts do not explain the sustained overall DNA methylation between 11 and 18 months of age in the Dnmt1+/− mice, and previous studies have shown an excellent correlation between RNA and protein levels (2).
However, we found an increase in MeCP2 transcripts from 11 to 19 months of age in T cells from the Dnmt1+/− mice in this study, compared to no significant change in the controls, and we previously noted sustained MeCP2 expression in the brains of the Dnmt1+/− mice compared to a decreased expression in the controls between 6 and 18 months (7). Others have reported that MeCP2 decreases with aging in murine muscle (27). It is possible that sustained or increased MeCP2 expression may help to maintain DNA methylation patterns in aging. Dnmt1 lacks a methyl-CpG binding domain, and is targeted to the replication fork through interactions with proteins such as PCNA (28). How Dnmt1 recognizes and methylates hemimethylated DNA at sites distant from the replication fork, such as might occur during replication when Dnmt1 levels are limiting and CG pairs aberrantly missed, or during DNA repair, is not explained by the replication fork model. MeCP2 binds Dnmt1 and both fully methylated as well as hemimethylated DNA. Further, the Dnmt1–MeCP2 complex is capable of methylating hemimethylated DNA to which the MeCP2 is bound. This fact supports a model in which MeCP2 targets Dnmt1 to hemimethylated DNA occurring elsewhere than the replication fork to maintain methylation patterns (16). This model thus predicts that methylation patterns not faithfully replicated during mitosis, resulting in a methylated parent strand and an unmethylated daughter strand, can be restored postmitotically by the MeCP2–Dnmt1 complex. This model is consistent with earlier work demonstrating biphasic remethylation kinetics in experimentally demethylated cells, with some sequences rapidly remethylated during mitosis, and others remethylating up to several hours later (29). We propose that age-related demethylation requires both a decrease in Dnmt1 as well as a decrease in MeCP2, and that stable or increased MeCP2 levels are able to target Dnmt1 to hemimethylated sequences even if Dnmt1 levels are limiting during mitosis.
Finally, the increases in Dnmt3a and 3b following stimulation in T cells from the old controls are of interest. CpG islands in the promoters of some tumor suppressor genes aberrantly methylate with aging in tissues such as colonic epithelium, contributing to the development of malignancies (4). The mechanism is unknown. The present results suggest that overexpression of de novo methyltransferases during mitosis may contribute to the de novo methylation of some CpG islands with age. This hypothesis is supported by reports of CpG hypermethylation in cells overexpressing these enzymes (30,31). Further, others have reported that total genomic dmC content may increase in the livers of C57BL/6 mice after 24 months of age (32), possibly due to similar increases in de novo methyltransferases.
Together these results further support the hypothesis that changes in maintenance and de novo DNA methylation contribute to diseases such as amyloidosis, autoimmunity, and possibly cancer with aging, and suggest new and intriguing hypotheses for further investigation into the role that DNA methylation plays in diseases important in aging.
Decision Editor: James R. Smith, PhD
Abnormality . | Control (N = 32) . | Dnmt1 Knockout (N = 29) . | p Value . |
---|---|---|---|
Amyloid | 2 | 10 | <.04 |
Lymphoma | 8 | 4 | |
Histiocytic sarcoma | 3 | 2 | |
Solid tumor | 2 | 2 |
Abnormality . | Control (N = 32) . | Dnmt1 Knockout (N = 29) . | p Value . |
---|---|---|---|
Amyloid | 2 | 10 | <.04 |
Lymphoma | 8 | 4 | |
Histiocytic sarcoma | 3 | 2 | |
Solid tumor | 2 | 2 |
Abnormality . | Control (N = 32) . | Dnmt1 Knockout (N = 29) . | p Value . |
---|---|---|---|
Amyloid | 2 | 10 | <.04 |
Lymphoma | 8 | 4 | |
Histiocytic sarcoma | 3 | 2 | |
Solid tumor | 2 | 2 |
Abnormality . | Control (N = 32) . | Dnmt1 Knockout (N = 29) . | p Value . |
---|---|---|---|
Amyloid | 2 | 10 | <.04 |
Lymphoma | 8 | 4 | |
Histiocytic sarcoma | 3 | 2 | |
Solid tumor | 2 | 2 |
This work was supported by Public Health Service grants AR42525, DK42111, AG13282, DK49730 and by a Veterans Administration Merit award.
We thank Cindy Bourke for her excellent secretarial support and Dr. K. Higuchi (Shinsh University Graduate School of Medicine) for the gift of the anti-murine ApoAII.
References
Zhang Z, Deng C, Lu Q, Richardson B. Age-dependent DNA methylation changes in the ITGAL (CD11a) promoter.
Ahuja N, Li Q, Mohan AL, Baylin SB, Issa JP. Aging and DNA methylation in colorectal mucosa and cancer.
Chen T, Li E. Structure and function of eukaryotic DNA methyltransferases.
Bird AP, Wolffe AP. Methylation-induced repression–belts, braces, and chromatin.
Yung R, Ray D, Eisenbraun JK, et al. Unexpected effects of a heterozygous dnmt1 null mutation on age-dependent DNA hypomethylation and autoimmunity.
Li E, Bestor TH, Jaenisch R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality.
Deng C, Lu Q, Zhang Z, et al. Hydralazine may induce autoimmunity by inhibiting extracellular signal-regulated kinase pathway signaling.
Murphy CL, Eulitz M, Hrncic R, et al. Chemical typing of amyloid protein contained in formalin-fixed paraffin-embedded biopsy specimens.
Yazaki M, Liepnieks JJ, Callaghan J, Connolly CE, Benson MD. Chemical characterization of a lambda I amyloid protein isolated from formalin-fixed and paraffin-embedded tissue sections.
Blackwell BN, Bucci TJ, Hart RW, Turturro A. Longevity, body weight, and neoplasia in ad libitum-fed and diet-restricted C57BL6 mice fed NIH-31 open formula diet.
Korenaga T, Fu X, Xing Y, et al. Tissue distribution, biochemical properties, and transmission of mouse type A ApoAII amyloid fibrils.
Wilson VL, Smith RA, Ma S, Cutler RG. Genomic 5-methyldeoxycytidine decreases with age.
Lee PJ, Washer LL, Law DJ, Boland CR, Horon IL, Feinberg AP. Limited up-regulation of DNA methyltransferase in human colon cancer reflecting increased cell proliferation.
Kimura H, Shiota K. Methyl-CpG-binding protein, MeCP2, is a target molecule for maintenance DNA methyltransferase, Dnmt1.
Gaudet F, Hodgson JG, Eden A, et al. Induction of tumors in mice by genomic hypomethylation.
Eden A, Gaudet F, Waghmare A, Jaenisch R. Chromosomal instability and tumors promoted by DNA hypomethylation.
Eads CA, Nickel AE, Laird PW. Complete genetic suppression of polyp formation and reduction of CpG-island hypermethylation in Apc(Min/+) Dnmt1-hypomorphic Mice.
Higuchi K, Wang J, Kitagawa K, et al. Accelerated senile amyloidosis induced by amyloidogenic Apoa-II gene shortens the life span of mice but does not accelerate the rate of senescence.
Benson MD, Liepnieks JJ, Yazaki M, et al. A new human hereditary amyloidosis: the result of a stop-codon mutation in the apolipoprotein AII gene.
Poirier LA. The effects of diet, genetics and chemicals on toxicity and aberrant DNA methylation: an introduction.
Kredich NM, Martin DV, Jr. Role of S-adenosylhomocysteine in adenosine-mediated toxicity in cultured mouse T lymphoma cells.
Abdolmaleky HM, Smith CL, Faraone SV, et al. Methylomics in psychiatry: modulation of gene-environment interactions may be through DNA methylation.
Aubol BE, Reich NO. Murine DNA cytosine C(5)-methyltransferase: in vitro studies of de novo methylation spreading.
Deng C, Yang J, Scott J, Hanash S, Richardson BC. Role of the ras-MAPK signaling pathway in the DNA methyltransferase response to DNA hypomethylation.
Weindruch R, Kayo T, Lee CK, Prolla TA. Gene expression profiling of aging using DNA microarrays.
Iida T, Suetake I, Tajima S, et al. PCNA clamp facilitates action of DNA cytosine methyltransferase 1 on hemimethylated DNA.
Woodcock DM, Adams JK, Cooper IA. Characteristics of enzymatic DNA methylation in cultured cells of human and hamster origin, and the effect of DNA replication inhibition.
Hsieh CL. In vivo activity of murine de novo methyltransferases, Dnmt3a and Dnmt3b.
Chedin F, Lieber MR, Hsieh CL. The DNA methyltransferase-like protein DNMT3L stimulates de novo methylation by Dnmt3a.
Author notes
Departments of 1Medicine and 2Pathology, University of Michigan, Ann Arbor.
Departments of 3Pathology and Laboratory Medicine and 4Medicine, Ann Arbor Veterans Administration Health Service, Michigan.