Characterization of Mutant MUTYH Proteins Associated With Familial Colorectal Cancer

doi:10.1053/j.gastro.2008.04.035

Gastroenterology

Volume 135, Issue 2, August 2008, Pages 499-507.e1

https://doi.org/10.1053/j.gastro.2008.04.035 Get rights and content

Background & Aims: The human mutyh gene encodes a base excision repair protein that prevents G:C to T:A transversions in DNA. Biallelic mutations in this gene are associated with recessively inherited familial colorectal cancer. The aim of this study was to characterize the functional activity of mutant-MUTYH and single-nucleotide polymorphism (SNP)-MUTYH proteins involving familial colorectal cancer. Methods: MUTYH variants were cloned and assayed for their glycosylase and DNA binding activities using synthetic double-stranded oligonucleotide substrates by analyzing cleavage products by polyacrylamide gel electrophoresis. Results: In this study, we have characterized 9 missense/frameshift mutants and 2 SNPs for their DNA binding and repair activity in vitro. Two missense mutants (R260Q and G382D) were found to be partially active in both glycosylase and DNA binding, whereas 3 other missense mutants (Y165C, R231H, and P281L) were severely defective in both activities. All of the frameshift mutants (Y90X, Q377X, E466X, and 1103delC) were completely devoid of both glycosylase and DNA binding activities. One SNP (V22M) showed the same activity as wild-type MUTYH protein, but the other SNP (Q324H) was partially impaired in adenine removal. Conclusions: This study of MUTYH mutants suggests that certain SNPs may be as partially dysfunctional in base excision repair as missense-MUTYH mutants and lead to colorectal carcinogenesis.

Section snippets

Construction of Vectors of N-Terminal Glutathione S-Transferase (GST)-Tagged MUTYH Proteins

The MUTYH gene was amplified using polymerase chain reaction from a Hela cell complementary DNA library (Stratagene, La Jolla, CA) using the primers: 5′CATATTGAATTCATGACACCGCTCGTCTCC3′ and 5′CATACGTCGACTCACTGGGCTGCACTGTTGA3′ with Phusion high-fidelity DNA polymerase (Invitrogen, Carlsbad, CA). Polyacrylamide gel electrophoresis (PAGE)-purified oligonucleotides were purchased from Operon (Huntsville, AL). Gel-purified products were digested with EcoRI and SalI restriction enzymes (Invitrogen)

Expression and Purification

MUTYH is a human DNA glycosylase that removes A preferentially from A:GO pairs in DNA to prevent G:C to T:A transversions. In this study we characterized the adenine removal and DNA substrate binding activities of a series of MUTYH variants (ie, Y90X, Y165C, R231H, R260Q, P281L, Q377X, G382D, E466X, and 1103delC), which are derived from MAP-phenotype patients.

Initially, we expressed these mutant proteins in vitro from a pTNT expression vector (Promega) using the TNT SP6 Quick Coupled

Discussion

Compound heterozygotes in the mutyh gene have been shown to be associated with familial CRC in human beings. In this work, we studied 9 bacterially expressed mutant MUTYH proteins for their DNA glycosylase and binding activities. In vitro assay using synthetic DNA substrates revealed that missense mutants (R260Q and G382D) are partially active in glycosylase activity (rate constants k₂, 1.28 ± 0.122 min⁻¹ and 1.033 ± 0.0979 min⁻¹, respectively, compared with 4.507 ± 0.5812 min⁻¹ of WT) and DNA

References (42)

R. Olinski et al.
Oxidative DNA damage: assessment of the role in carcinogenesis, atherosclerosis, and acquired immunodeficiency syndrome
Free Radic Biol Med
(2002)
D. Dreher et al.
Role of oxygen free radicals in cancer development
Eur J Cancer
(1996)
K.C. Cheng et al.
8-Hydroxyguanine, an abundant form of oxidative DNA damage, causes G---T and A---C substitutions
J Biol Chem
(1992)
A. Parker et al.
Human homolog of the MutY repair protein (hMYH) physically interacts with proteins involved in long patch DNA base excision repair
J Biol Chem
(2001)
J.R. Sampson et al.
Autosomal recessive colorectal adenomatous polyposis due to inherited mutations of MYH
Lancet
(2003)
L. Wang et al.
MYH mutations in patients with attenuated and classic polyposis and with young-onset colorectal cancer without polyps
Gastroenterology
(2004)
T. Venesio et al.
High frequency of MYH gene mutations in a subset of patients with familial adenomatous polyposis
Gastroenterology
(2004)
K.W. Kinzler et al.
Lessons from hereditary colorectal cancer
Cell
(1996)
J.P. Cheadle et al.
MUTYH-associated polyposis—from defect in base excision repair to clinical genetic testing
DNA Repair (Amst)
(2007)
S.H. Wooden et al.
Identification of critical residues required for the mutation avoidance function of human MutY (hMYH) and implications in colorectal cancer
Cancer Lett
(2004)

H. Bai et al.

Functional characterization of human MutY homolog (hMYH) missense mutation (R231L) that is linked with hMYH-associated polyposis

Cancer Lett

(2007)

C. Colussi et al.

The mammalian mismatch repair pathway removes DNA 8-oxodGMP incorporated from the oxidized dNTP pool

Curr Biol

(2002)

Y.C. Yeh et al.

Two nicking enzyme systems specific for mismatch-containing DNA in nuclear extracts from human cells

J Biol Chem

(1991)

K. Sakumi et al.

Cloning and expression of cDNA for a human enzyme that hydrolyzes 8-oxo-dGTP, a mutagenic substrate for DNA synthesis

J Biol Chem

(1993)

R.D. Kolodner

Mismatch repair: mechanisms and relationship to cancer susceptibility

Trends Biochem Sci

(1995)

S. Frelon et al.

High-performance liquid chromatography—tandem mass spectrometry measurement of radiation-induced base damage to isolated and cellular DNA

Chem Res Toxicol

(2000)

S. Shibutani et al.

Insertion of specific bases during DNA synthesis past the oxidation-damaged base 8-oxodG

Nature

(1991)

M.M. Slupska et al.

Cloning and sequencing a human homolog (hMYH) of the Escherichia coli mutY gene whose function is required for the repair of oxidative DNA damage

J Bacteriol

(1996)

H. Ide et al.

Human DNA glycosylases involved in the repair of oxidatively damaged DNA

Biol Pharm Bull

(2004)

M.L. Michaels et al.

The GO system protects organisms from the mutagenic effect of the spontaneous lesion 8-hydroxyguanine (7,8-dihydro-8-oxoguanine)

J Bacteriol

(1992)

A.R. Parker et al.

Cells with pathogenic biallelic mutations in the human MUTYH gene are defective in DNA damage binding and repair

Carcinogenesis

(2005)

Cited by (86)

Exome sequencing identifies novel genes and variants in patients with Hirschsprung disease
2023, Journal of Pediatric Surgery
Hirschsprung disease (HSCR) is a complex genetic disease characterized by the absence of ganglion cells in the intestines, leading to a functional obstruction in infants. At least 24 genes have been identified for the pathogenesis of HSCR. They contributed to approximately 72% of HSCR cases. We aimed to elucidate further the genetic basis of HSCR in Indonesia using the whole-exome sequencing (WES) approach.
WES was performed in 39 sporadic non-syndromic HSCR patients and 16 non-HSCR subjects as controls. Variants presented in controls were excluded, followed by in silico prediction tools and population allele frequency databases to select rare variants. We determined the minor allele frequency (MAF) using gnomAD (MAF <0.1%).
We involved 24 (61.5%) males and 15 (38.5%) females. Most patients (62%) had short-segment aganglionosis and underwent the Duhamel procedure (41%). We identified several candidate novel variants in HSCR-related genes, including UBR4, GDNF, and ECE1. Moreover, we also identified some novel candidate genes, including a possible compound heterozygous variant in the MUTYH gene: the first variant, a known protein-truncating variant associated with colorectal cancer (CRC), p.Glu452Ter and the second variant is novel, p.Ala39Val. Moreover, the type of variants was not associated with the aganglionosis type.
We identified several novel genes and variants, including the variant associated with CRC, that might contribute to the pathogenesis of HSCR. No genotype–phenotype associations were noted. Our study further confirms the complex network involved in enteric nervous system development and HSCR pathogenesis.
Level III.
Concurrent Pathogenic Variants of BRCA1, MUTYH and CHEK2 in a Hereditary Cancer Family
2022, Cancer Genetics
Concurrent pathogenic variants (PVs) in cancer predisposition genes have been reported in 0.1–2% of hereditary cancer (HC) patients. Determining concurrent PVs is crucial for the diagnosis, treatment, and risk assessment of unaffected family members. Next generation sequencing based diagnostic tests, which are widely used in HCs, enable the evaluation of multiple genes in parallel. We have screened the family members of a patient with bilateral breast cancer who was found to have concurrent PVs in BRCA1 (NM_007294.3;c.5102_5103del, p.Leu1701Glnfs*14) and MUTYH (NM_001128425.1;c.884C>T, p.Pro295Leu). Further analysis revealed concurrent PVs in CHEK2 (NM_007194.4;c.1427C>T, p.Thr476Met) and MUTYH (NM_001128425.1;c.884C>T, p.Pro295Leu) in the maternal uncle of the index case. Eight additional family members were found to have PVs in BRCA1 and MUTYH among 26 tested relatives. The sister and the brother of the index case who were diagnosed with breast and colon cancers, respectively, presented with the same genotype as the index case. Each family member was evaluated individually for clinical care and surveillance. This is the first report describing a family with BRCA1, MUTYH and CHEK2 concurrent PVs. Our findings provide valuable information for the assessment and management considerations for families with concurrent PVs.
Recent advances in biosensor for DNA glycosylase activity detection
2022, Talanta
Base excision repair (BER) is vital for maintaining the integrity of the genome under oxidative damage. DNA glycosylase initiates the BER pathway recognizes and excises the mismatched substrate base leading to the apurinic/apyrimidinic site generation, and simultaneously breaks the single-strand DNA. As the aberrant activity of DNA glycosylase is associated with numerous diseases, including cancer, immunodeficiency, and atherosclerosis, the detection of DNA glycosylase is significant from bench to bedside. In this review, we summarized novel DNA strategies in the past five years for DNA glycosylase activity detection, which are classified into fluorescence, colorimetric, electrochemical strategies, etc. We also highlight the current limitations and look into the future of DNA glycosylase activity monitoring.
Defective repair capacity of variant proteins of the DNA glycosylase NTHL1 for 5-hydroxyuracil, an oxidation product of cytosine
2019, Free Radical Biology and Medicine
The NTHL1 gene encodes DNA glycosylase, which is involved in base excision repair, and biallelic mutations of this gene result in NTHL1-associated polyposis (NAP), a hereditary disease characterized by colorectal polyposis and multiple types of carcinomas. However, no proper functional characterization of variant NTHL1 proteins has been done so far. Herein, we report functional evaluation of variant NTHL1 proteins to aid in the accurate diagnosis of NAP. First, we investigated whether it would be appropriate to use 5-hydroxyuracil (5OHU), an oxidation product of cytosine, for the evaluation. In the supF forward mutation assay, 5OHU caused an increase of the mutation frequency in human cells, and the C→T mutation was predominant among the 5OHU-induced mutations. In addition, in DNA cleavage activity assay, 5OHU was excised by NTHL1 as well as four other DNA glycosylases (SMUG1, NEIL1, TDG, and UNG2). When human cells overexpressing the five DNA glycosylases were established, it was found that each of the five DNA glycosylases, including NTHL1, had the ability to suppress 5OHU-induced mutations. Based on the above results, we performed functional evaluation of eight NTHL1 variants using 5OHU-containing DNA substrate or shuttle plasmid. The DNA cleavage activity assay showed that the variants of NTHL1, Q90X, Y130X, R153X, and Q287X, but not R19Q, V179I, V217F, or G286S, showed defective repair activity for 5OHU and two other oxidatively damaged bases. Moreover, the supF forward mutation assay showed that the four truncated-type NTHL1 variants showed a reduced ability to suppress 5OHU-induced mutations in human cells. These results suggest that the NTHL1 variants Q90X, Y130X, R153X, and Q287X, but not R19Q, V179I, V217F, or G286S, were defective in 5OHU repair and the alleles encoding them were considered to be pathogenic for NAP.
Characterization of Trypanosoma cruzi MutY DNA glycosylase ortholog and its role in oxidative stress response
2017, Infection, Genetics and Evolution
Trypanosoma cruzi is a protozoan parasite and the causative agent of Chagas disease. Like most living organisms, it is susceptible to oxidative stress, and must adapt to distinct environments. Hence, DNA repair is essential for its survival and the persistence of infection. Therefore, we studied whether T. cruzi has a homolog counterpart of the MutY enzyme (TcMYH), important in the DNA Base Excision Repair (BER) mechanism. Analysis of T. cruzi genome database showed that this parasite has a putative MutY DNA glycosylase sequence. We performed heterologous complementation assays using this genomic sequence. TcMYH complemented the Escherichia coli MutY- strain, reducing the mutation rate to a level similar to wild type. In in vitro assays, TcMYH was able to remove an adenine that was opposite to 8-oxoguanine. We have also constructed a T. cruzi lineage that overexpresses MYH. Although in standard conditions this lineage has similar growth to control cells, the overexpressor is more sensitive to hydrogen peroxide and glucose oxidase than the control, probably due to accumulation of AP sites in its DNA. Localization experiments with GFP-fused TcMYH showed this enzyme is present in both nucleus and mitochondrion. QPCR and MtOX results reinforce the presence and function of TcMYH in these two organelles. Our data suggest T. cruzi has a functional MYH DNA glycosylase, which participates in nuclear and mitochondrial DNA Base Excision Repair.
Repair of 8-oxoG:A mismatches by the MUTYH glycosylase: Mechanism, metals and medicine
2017, Free Radical Biology and Medicine
Reactive oxygen and nitrogen species (RONS) may infringe on the passing of pristine genetic information by inducing DNA inter- and intra-strand crosslinks, protein-DNA crosslinks, and chemical alterations to the sugar or base moieties of DNA. 8-Oxo-7,8-dihydroguanine (8-oxoG) is one of the most prevalent DNA lesions formed by RONS and is repaired through the base excision repair (BER) pathway involving the DNA repair glycosylases OGG1 and MUTYH in eukaryotes. MUTYH removes adenine (A) from 8-oxoG:A mispairs, thus mitigating the potential of G:C to T:A transversion mutations from occurring in the genome. The paramount role of MUTYH in guarding the genome is well established in the etiology of a colorectal cancer predisposition syndrome involving variants of MUTYH, referred to as MUTYH-associated polyposis (MAP). In this review, we highlight recent advances in understanding how MUTYH structure and related function participate in the manifestation of human disease such as MAP. Here we focus on the importance of MUTYH's metal cofactor sites, including a recently discovered “Zinc linchpin” motif, as well as updates to the catalytic mechanism. Finally, we touch on the insight gleaned from studies with MAP-associated MUTYH variants and recent advances in understanding the multifaceted roles of MUTYH in the cell, both in the prevention of mutagenesis and tumorigenesis.

View all citing articles on Scopus

: This work was supported by the National Cancer Institute, National Institutes of Health under RFA grant #CA-95-011, U01-CA74783 (S.G.), and 1203-1 (R.B.). Work in the Department of Biochemistry and Microbiology, University of Victoria, Victoria, British Columbia, Canada, laboratory by C.C. was supported by a grant from the Canadian Institutes for Health Research. R.B. is a Canadian Cancer Society Research Scientist.

: The content of this article does not necessarily reflect the views or policies of the National Cancer Institute, nor does mention of trade names, commercial products, or organizations imply endorsement by the US Government or the Consortium of Familial Registries.

View full text

Basic—Alimentary TractCharacterization of Mutant MUTYH Proteins Associated With Familial Colorectal Cancer

Section snippets

Construction of Vectors of N-Terminal Glutathione S-Transferase (GST)-Tagged MUTYH Proteins

Expression and Purification

Discussion

Free Radic Biol Med

Eur J Cancer

J Biol Chem

J Biol Chem

Lancet

Gastroenterology

Gastroenterology

Cell

DNA Repair (Amst)

Cancer Lett

Cancer Lett

Curr Biol

J Biol Chem

J Biol Chem

Trends Biochem Sci

High-performance liquid chromatography—tandem mass spectrometry measurement of radiation-induced base damage to isolated and cellular DNA

Chem Res Toxicol

Insertion of specific bases during DNA synthesis past the oxidation-damaged base 8-oxodG

Nature

Cloning and sequencing a human homolog (hMYH) of the Escherichia coli mutY gene whose function is required for the repair of oxidative DNA damage

J Bacteriol

Human DNA glycosylases involved in the repair of oxidatively damaged DNA

Biol Pharm Bull

The GO system protects organisms from the mutagenic effect of the spontaneous lesion 8-hydroxyguanine (7,8-dihydro-8-oxoguanine)

J Bacteriol

Cells with pathogenic biallelic mutations in the human MUTYH gene are defective in DNA damage binding and repair

Carcinogenesis

Basic—Alimentary Tract
Characterization of Mutant MUTYH Proteins Associated With Familial Colorectal Cancer