Regulation of micro- and small-exon retention and other splicing processes by GRP20 for flower development

Wang, Jun; Ma, Xinwei; Hu, Yi; Feng, Guanhua; Guo, Chunce; Zhang, Xin; Ma, Hong

doi:10.1038/s41477-023-01605-8

Download PDF

Article
Open access
Published: 09 January 2024

Regulation of micro- and small-exon retention and other splicing processes by GRP20 for flower development

Nature Plants volume 10, pages 66–85 (2024)Cite this article

3339 Accesses
1 Citations
28 Altmetric
Metrics details

Subjects

Abstract

Pre-mRNA splicing is crucial for gene expression and depends on the spliceosome and splicing factors. Plant exons have an average size of ~180 nucleotides and typically contain motifs for interactions with spliceosome and splicing factors. Micro exons (<51 nucleotides) are found widely in eukaryotes and in genes for plant development and environmental responses. However, little is known about transcript-specific regulation of splicing in plants and about the regulators for micro exon splicing. Here we report that glycine-rich protein 20 (GRP20) is an RNA-binding protein and required for splicing of ~2,100 genes including those functioning in flower development and/or environmental responses. Specifically, GRP20 is required for micro-exon retention in transcripts of floral homeotic genes; these micro exons are conserved across angiosperms. GRP20 is also important for small-exon (51–100 nucleotides) splicing. In addition, GRP20 is required for flower development. Furthermore, GRP20 binds to poly-purine motifs in micro and small exons and a spliceosome component; both RNA binding and spliceosome interaction are important for flower development and micro-exon retention. Our results provide new insights into the mechanisms of micro-exon retention in flower development.

Genome organization around nuclear speckles drives mRNA splicing efficiency

Article 08 May 2024

Genomes of multicellular algal sisters to land plants illuminate signaling network evolution

Article Open access 01 May 2024

Genomic analyses reveal the stepwise domestication and genetic mechanism of curd biogenesis in cauliflower

Article Open access 07 May 2024

Main

Pre-messenger RNA (mRNA) splicing (hereafter RNA splicing) is one of the most important post-transcriptional processes for eukaryotic gene expression¹ and is required for plant and animal development^2,3. Compared with animal development, plant development not only depends heavily on proper environmental conditions, but also is negatively impacted by adverse environments^4,5. The effects of environmental factors on plant development involve the functions of multiple plant hormones including auxin (indole-3-acetic acid) and abscisic acid (ABA)^4,5. The hormonal regulation of environmental effects on development is largely controlled by transcription factors⁴, as well as epigenetic processes involving microRNA, DNA methylation and histone methylation^4,5. RNA splicing is carried out by the spliceosome, a complex of small nuclear ribonucleoproteins⁶ and involves the recognition of GU-AG or AU-AC consensus at the exon–intron boundaries by splicing factors (SRs)⁷. Splicing factors and regulators are important for several plant processes, including flowering time⁸, circadian rhythms⁹, stress response¹⁰ and plant defence¹¹. However, relatively little is known about transcript-specific regulation of splicing for genes that are essential for development. Furthermore, molecular mechanisms of specialized factors for regulation of RNA splicing remain largely unknown.

The exon ends are recognized by SRs to ensure accurate splicing in plants and animals^6,12. In addition, SRs bind to specific motifs in pre-mRNAs, termed exon splicing enhancers and/or intron splicing enhancers, to initiate spliceosome assembly^13,14. Exon sizes are less variable than intron sizes, averaging 150 nucleotides in vertebrates and 180 nucleotides in plants^15,16,17,18. Exons with typical sizes and exon splicing enhancers can associate with the spliceosome for efficient splicing^19,20, whereas shorter exons generally lack sufficient sequence motifs and require additional regulators for accurate splicing²¹. Unusually short exons (<51 nucleotides), called micro exons, are widely found in both plants (for example, >8,000 in ~6,000 Arabidopsis genes) and animals (~13,000 in humans)^22,23. Such micro exons have been found to be essential^15,16,24; for example, in humans and mice, conserved micro exons have been found in brain-specific transcripts and implicated in neurogenesis and brain functions^22,23.

In plants, the importance of micro exons in gene functions has been suggested by their identification in 10 diverse species²⁵ and by their presence in genes crucial for transcriptional regulation, cell division, stress response, protein modification and metabolism^{22,23,25,26,27}. Specifically, micro exons are generally found in MIKC (MADS domain, I region, K domain, and C-terminal domain)-type MADS-box (an acronym of MCM1, AGAMOUS, DEFICIENS and SRF) genes and AP2 (APETALA2) family members encoding putative transcription factors from analyses of 63 plant species²⁷. These genes include all core floral homeotic genes, AGAMOUS (AG), APETALA1 (AP1), APETALA2 (AP2), APETALA3 (AP3), PISTILLATA (PI), SEPALLATA3 (SEP3) and SEPALLATA4 (SEP4), and their micro exons are conserved across angiosperms²⁷. Micro exons in MADS-box genes encode portions of the K domain²⁷, which is important for tetramerization^28,29. Indeed, the reduced inclusion of such a micro exon in the floral MADS-box gene SEP3 caused abnormal flower development^28,30. In addition, AP2 family genes containing conserved micro exons include those in the AP2 subfamily (such as TARGET OF EAT1 (TOE1)) and the ERF subfamily (such as SMALL ORGAN SIZE1 (SMOS1)), which are also required for normal development in Arabidopsis and rice^27,31. Moreover, a conserved nine-nucleotide micro exon encoding a portion of the AP2 domain in WRI1 (WRINKLED1) is crucial to fatty acid synthesis in Arabidopsis and plants^27,32. However, regulators for micro-exon retention have not been reported for any transcripts in plants.

Only a few studies have identified factors regulating micro-exon splicing in animals. In humans and mice, transcriptome analyses of multiple tissues identified >2,500 alternative splicing (AS) events and the micro exons of 3–27 nucleotides affected by AS are highly conserved and potentially regulatory in brain development²². The retention of such micro exons was increased in tissue culture expressing the neuronal splicing factor nSR100/SRRM4, suggesting that nSR100 promotes micro-exon inclusion in some mRNAs; this was further supported by the finding that brains of individuals with autism have both reduced nSR100 levels and misregulated splicing of micro exons²². The RNA-binding protein RBFOX1 was found to bind to intronic sequences adjacent to 145 brain-specific micro exons, suggesting a role in regulating the inclusion of micro exons; in addition, a poly-pyrimidine-binding protein, PTBP1, was reported to reduce the retention of micro exons²³. However, the mechanisms of these three RNA-binding proteins in regulating micro-exon splicing remain unclear. Moreover, animal splicing factors for micro exons of 27–50 nucleotides have not been reported. Furthermore, exons slightly larger than micro exons (51–100 nucleotides) are also found in plant and animal genomes (for example, Arabidopsis, rice and human)^15,16,18 and defined as small exons in this study. Splicing of small exons might also be facilitated by additional factors; for example, the N1 exon in the mouse c-src gene and the IDX exon in the human LGH gene are inefficiently spliced in vitro by reconstituted spliceosomes, whereas artificially extending the N1 exon to 109 nucleotides increased its retention efficiency^20,33. These observations suggest that the proper splicing of small exons also benefits from additional regulation³³, but such regulators have not been reported in either plants or animals.

Pre-mRNA sequence characteristics also impact accurate splicing, such as intronic poly-pyrimidine tracts, which are generally required for splicing and recognized by known SRs: SRp40, SF2, SRp55, SC35 and U2AF65 in humans¹⁴. For micro exons, the aforementioned nSR100, RBFOX1 and PTBP1 proteins are suggested to bind poly-pyrimidine (poly(Y)) motifs in the neighbouring introns to regulate micro-exon splicing for a small fraction (hundreds) of animal genes with micro exons^22,23. Notably, the replacement in imperfect poly(Y) tracts of a purine by a pyrimidine in the upstream introns improved retention of short internal exons¹⁹, suggesting the importance of such sequence characteristics in diverse transcripts for normal splicing. However, sequence motifs in the exons and their binding proteins for micro-exon splicing in plants and animals remain unknown.

Results

GRP20 encodes a predicted non-classical RNA-binding protein

Glycine-rich proteins (GRPs) are important for seed germination, root development, stress response and pollen development^34,35. Two hnRNP (heterogeneous nuclear ribonucleoproteins)-like GRPs, GRP7 and GRP8, were found to bind to RNAs and affect the AS of nearly 100 transcripts using RT (reverse transcription)-PCR³⁶. GRP7 also regulates the splicing of its own pre-mRNA in feedback control associated with the circadian clock³⁷ and promotes AS of FLM to control flowering time³⁸. These observations suggest that other GRPs might function in RNA binding and splicing. Our early transcriptomic analyses identified GRP20 as expressed in all tissues tested and more highly in flowers (Fig. 1a), suggesting a role in the flower and possibly other processes. Moreover, the similar expression levels in leaves between GRP20 and a constitutively expressed gene EF1α (Supplementary Fig. 1a) suggest that the level of GRP20 expression in leaves is not very low, just much lower than its level in flowers. To obtain clues about the molecular functions of GRP20, we examined the domain organization of GRP20. GRP20 has a putative nuclear localization signal (NLS, residues 12 to 25; Fig. 1b); however, there were no annotated domains in the C-terminal region. We used the catRAPID and RNAbindPlus programs to investigate whether GRP20 could potentially bind to RNA (Extended Data Fig. 1a). The two programs predicted GRP20 as an RNA-binding protein, with a predicted RNA-binding domain (RBD; residues 92 to 115; Fig. 1b,c and Extended Data Fig. 1b,d), and probably belonging to a non-classical type of RNA-binding protein (Extended Data Fig. 1c). We further used two other programs (DRNApred and PPRInt) to identify likely core amino acid residues for RNA binding (Extended Data Fig. 1a) and identified several aromatic (W/Y) and charged (K/R/D) amino acids as potentially having higher affinities for RNA (Extended Data Fig. 1e–g). Moreover, we annotated a highly disordered region (HDR, residues 119 to 153) in the C-terminal region of GRP20 (Fig. 1b). The relatively high floral expression and multiple predicted protein domains (Supplementary Fig. 1b–d), as well as preliminary mutant phenotypes, suggested that GRP20 is an excellent candidate for functional investigation.

**Fig. 1: Pre-mRNA splicing events in WT and *grp20*.**

GRP20 regulates splicing of genes for development and response

The putative RNA-binding domain suggests that GRP20 might regulate RNA processing. To test a possible role of GRP20 in RNA splicing, we used two T-DNA (transfer-DNA of the Ti plasmid of Agrobacterium tumefaciens) insertional grp20 alleles (Extended Data Fig. 1h,j) with greatly reduced GRP20 expression (Extended Data Fig. 1i). We examined possible effects of grp20-1 on RNA splicing in flowers and leaves by transcriptomic analyses and identified 839, 508 and 685 genes with various defects in splicing detected only in the flower, in both the flower and leaf, and only in the leaf, respectively (Fig. 1c). For convenience, the most abundant transcript detected in the wild type (WT) is referred to as the ‘typical transcript’, whereas other transcripts are referred to as alternative transcripts (sometimes also called ‘defective transcripts’ if detected only in the grp20 mutant). Gene Ontology (GO) category analyses revealed that categories for chromatin modification and organization, cell cycle regulation, flower organ formation, phospholipid and pigment synthesis, and response to auxin and heat are highly enriched in defective transcripts found only in flowers (Fig. 1d). In addition, categories of biosynthesis and metabolism, transcriptional regulation, circadian rhythm and RNA metabolism are enriched in defective (alternatively spliced) transcripts detected in both flowers and leaves (Fig. 1d). Furthermore, signal transduction and diverse environmental response including response to temperature (heat and cold), osmotic, salt, light, drought, lipid and immune stresses are enriched in transcripts showing defects only in leaves (Fig. 1d). Therefore, GRP20 is an important splicing regulator of genes that probably play roles in plant growth and environmental responses.

Our analyses indicate that there were five types of alternative transcripts (Extended Data Fig. 2a) in flowers (Fig. 2a, Extended Data Fig. 2b,d and Supplementary Table 1) and leaves (Fig. 2b, Extended Data Fig. 2c,d and Supplementary Table 1). In particular, increased floral transcripts in grp20 with exon skipping were detected for several MADS-box genes (AP1, AP3, AG, STK and SEP4) and AP2 (Figs. 1d and 2c, and Extended Data Figs. 2e–g and 3), suggesting the importance of GRP20 in the splicing of flower transcripts. Also, splicing changes were observed for genes regulating cell division, such as CYCH;1 (exon skipping (ES)) and HOBBIT (alternatively spliced intron (ASI); Fig. 1d and Extended Data Fig. 3), and for epigenetic regulation, such as LHP1 (alternative 3′ splicing sites (A3SS)) and SUVH9 (ES) in flowers (Figs. 1d and 2c, and Supplementary Table 1). Moreover, genes related to hormonal signalling and stress responses, including auxin responsive factors and heat shock proteins, were enriched among genes with increased alternative transcripts in both grp20 flowers and leaves (Figs. 1d and 2c), whereas transcripts of housekeeping genes, such as meristem stem cell regulator WUS, were similar to the wild type in flowers, suggesting that GRP20 regulates proper splicing of a specific subset of florally expressed pre-mRNAs. Notably, alternatively spliced transcripts with ES, ASI, A3SS and alternative 5′ splicing site (A5SS) were observed in leaves for genes that are responsive to diverse stresses, such as AP2 family genes for abiotic stresses, NPR4 for disease response and others (Fig. 2d and Supplementary Table 1), suggesting that GRP20 has a broad impact on splicing of genes involved in environmental responses. Moreover, notably increased numbers of reads for alternatively spliced transcript were detected in grp20 leaves compared with the WT for epigenetic regulators and those of flowering time, such as HDT4 and MADS-box genes (Fig. 2d and Supplementary Table 1). In addition, alternative transcripts were detected in grp20 leaves, but not in the WT, for genes in circadian rhythm and protein ubiquitination (Fig. 2d and Supplementary Table 1). The differences in splicing of transcripts of crucial genes in grp20 indicate that GRP20 is a novel regulator of RNA splicing for genes important for development and predicted for environmental responses. Transcriptional regulatory genes are generally affected in both grp20 flowers and leaves. Among 1,717 annotated transcription factors in 58 gene families, distinct families are enriched among those with alternative transcripts in the flower and/or leaf (Extended Data Fig. 2f). In addition to MIKC-type MADS-box genes, LOB (lateral organ boundaries) domain genes related to reproduction were highly enriched in the grp20 flower (Extended Data Fig. 2f,g). However, stress-responsive and leaf developmental factor genes including WRKY (WRKYGQK heptapeptide) and NAC (an acronym of NAM, ATAF1-2 and CUC2) family members were enriched among genes with alternative transcripts in the grp20 leaf (Extended Data Fig. 2f,h). Moreover, MYB-related, bHLH, bZIP and AP2 family members were observed with alternative transcripts in both flowers and leaves (Extended Data Fig. 2f,i), supporting the idea that GRP20 affects the splicing of transcripts for multiple regulators of transcription (Extended Data Fig. 4a,b). We then estimated the levels of the typical transcripts for MADS-box genes, AP2 and LOB domain gene AS2 using RT-qPCR (RT-quantitative PCR) and found that they were reduced significantly in the grp20 flower to about 40–60% of the WT levels (Figs. 2e and 3a). In addition, the levels of typical transcripts in the grp20 leaf for ING2, WRKY and RHC1A genes were also reduced to about 50–80% of the WT levels (Fig. 2f), supporting the changes in splicing observed in transcriptomic analyses.

**Fig. 2: Splicing events in WT and *grp20* flowers and leaves.**

**Fig. 3: Micro- and small-exon skipping in *grp20* flowers and leaves, and RNA expression of floral homeotic and LOB domain genes.**

We also investigated the differential gene expression level between WT and grp20 stage 1–12 flowers and leaves with three biological replicates (Extended Data Fig. 4c and Supplementary Table 2), allowing the identification of 217 downregulated genes including GRP20 and 493 upregulated genes (Extended Data Fig. 4d) (~2% of total genes, 710 of 35,000) in flowers. Specifically, the expression levels of known homeotic genes and other MADS-box genes, LOB domain genes and other flower developmental genes were not significantly different between the wild-type and grp20 flowers (Extended Data Fig. 4e). Thus, the grp20 mutation does not affect the mRNA levels of most floral regulatory genes, but specifically affects RNA splicing. However, about 2,800 downregulated genes including GRP20 and 1,600 upregulated genes were identified in grp20 leaves (Extended Data Fig. 4f and Supplementary Table 2). It is possible that splicing defects for various environmental stress-responsive genes in leaves led to feedback on gene expression and greater numbers of the differentially expressed genes in the leaves than in the flowers.

GRP20 regulates micro-exon and small-exon splicing

To assess the parameters of GRP20-targeted transcripts for ES, we examined the lengths of affected exons in grp20 flowers and leaves. The results indicated that the average length of affected exons was 50 nucleotides in both flowers and leaves, much shorter than that of all exons in flowers and leaves (Fig. 3b,c) and below the average exon length of 180 nucleotides in plants. The Arabidopsis genome contains 150,204 exons in 23,910 genes with more than one exon and 12,867 genes without an intron. Among 150,204 exons, as mentioned before, >8,000 are micro exons found in ~6,000 genes; in addition, 39,025 small exons (51–100 nucleotides) are present in 12,525 genes (Fig. 3d,e and Extended Data Fig. 5a,b). Among the Arabidopsis micro exons, 185 (in 183 genes) have fewer than 10 nucleotides, 1,132 (999 genes) have 10–25 nucleotides and 6,745 (4,962 genes) have 26 to 50 nucleotides (Fig. 3d,e, Extended Data Fig. 5a,b and Supplementary Table 3). As a further test for mapping efficiency of the transcriptome datasets, we examined the results for additional micro exons with ≤25 nt. Among 1,186 genes with 1,317 annotated micro exons of ≤25 nt, 863 genes showed expression in flowers with detected reads. The reads for 851 genes were mapped to gene regions including micro exons, resulting in the detection of 922 micro exons, whereas reads for 12 genes were mapped to regions lacking micro exons. In the grp20 mutant flowers, reads for 839 genes were mapped to regions including micro exons (reads for 24 genes were in regions lacking micro exons), with detection of 912 micro exons, although no additional micro exons had notable difference in splicing between WT and grp20. These results indicate that nearly all micro exons with ≤25 nt of florally expressed genes were detected in both WT and grp20 transcriptome datasets.

We found that 238 exons were skipped in 211 grp20 floral transcripts (Extended Data Fig. 5), including 59% (140 of 238) micro exons (120 with 26–50 nucleotides) and 20% (48 of 238) small exons (51–100 nucleotides; Fig. 3d,f and Supplementary Table 3). In addition, 265 exons were skipped in 226 leaf transcripts (Extended Data Fig. 5), with 26% (69 of 265) and 53% (140 of 265) being micro exons and small exons, respectively (Fig. 3e,f and Supplementary Table 3). Among exons of different sizes in the genome, the skipped micro exons in flowers and both the skipped micro and small exons in leaves were enriched (Fig. 3g). Only small numbers of micro exons and small exons were skipped in both floral and leaf transcripts (Extended Data Fig. 5c,d). These results indicate that GRP20 preferentially promotes proper retention of micro and small exons with largely distinct sets of targets in flowers and leaves. To obtain additional clues regarding the functions of affected transcripts with missing micro or small exons, we identified several enriched GO categories (Fig. 3h and Supplementary Table 3) including floral organ identity, meiosis, transcriptional regulation, RNA modification and metabolism for floral transcripts, and transcriptional regulation, stomatal opening, autophagy, cell differentiation, cell death and environmental responses for leaf transcripts (Fig. 3h and Supplementary Table 3). The results suggested that GRP20 is a major regulator for micro-exon and small-exon splicing for genes involved in or annotated for plant growth and environmental responses. Moreover, other exons affected by GRP20 are in genes also implicated in normal development and predicted for response to environment (Supplementary Table 3).

As GRP20 is expressed at lower levels in the leaf than in the flower, it is possible that leaf transcripts might show micro-exon skipping more frequently. To test this idea, we compared 20,810 genes expressed in both the WT flower and leaf and detected reads supporting skipping of 23 micro exons in the leaf and skipping of 21 other micro exons in the flower. It is possible that the regulation of micro-exon retention in the leaf might involve other unknown factors.

Micro exons with 10 to 50 nucleotides (Fig. 3d) are enriched in floral homeotic genes in flowers, and some of them had alternative transcripts with skipped micro exons in grp20 flowers (Fig. 3h), including a micro exon encoding a part of the K domain in several floral homeotic MADS-box genes (AP1, SEP4, SEP3, AG, STK and AP3). In addition, a micro exon encoding a part of the AP2 domain in AP2 and TOE2 was skipped in some grp20 floral transcripts (Extended Data Fig. 3). In particular, 5–22% reads for MADS-box and AP2 transcripts lacking the micro exons were detected in grp20, but not in the WT (Extended Data Fig. 3). Also, transcripts lacking micro exons were observed for genes regulating cell division, such as CYCH;1 (Extended Data Fig. 3). The levels of alternative transcripts showing micro-exon skipping in AP3 and AP2, and A5SS in LBD2, were found to significantly increase in grp20 relative to that in WT (Fig. 3i,j). The increased production of such alternative transcripts in grp20 flowers missing an exon and containing other splicing differences might have caused a reduction of the annotated WT protein level and activity.

Identification of putative GRP20 homologues among plants

As a first step to learn whether GRP20 function in RNA splicing might be conserved among plants, we retrieved the sequences of putative GRP20 homologues from 14 representative angiosperms. Earlier in this study, we described three GRP20 functional domains, NLS, RBD and HDR (Fig. 1b). A comparison of GRP20 with its putative homologues indicates that the GRP20 RBD exhibits sequence similarity to corresponding regions in the GRP20 homologues (Fig. 4a). Moreover, the putative GRP20 homologues also have predicted NLS with positively charged amino acid residues (Fig. 4a), suggesting that they might also be nuclear proteins. Although the GRP20 HDR, by its disordered nature, does not require a specific sequence for function, we analysed the corresponding regions of putative GRP20 homologues for their disordered propensity by using a computational program with V_model and β_model, which supported the C-terminal region of each of the 14 putative GRP20 homologues with disorder characteristics (V_model < 0.56 and β_model > 0.9; Fig. 4a).

A crucial function of GRP20 is to promote micro- and small-exon retention; thus, we examined the orthogroups including genes with affected micro exons and small exons. Among the orthogroups with at least one gene that has a micro exon affected in grp20, a majority have only 1–5 genes (61 of 90 flowers and 33 of 63 leaves; Fig. 4b,c, Extended Data Fig. 5e and Supplementary Tables 3 and 4); this pattern is also found for orthogroups containing genes whose small exons are affected (Extended Data Fig. 5e and Supplementary Tables 3 and 4). Specifically, affected micro exons were present in MADS-box gene (ABCE genes and others) and AP2 gene family members (AP2, TOE2 and WRI4) and are conserved (Fig. 4b and Extended Data Fig. 5f), suggesting that these transcripts also needed to be properly spliced for normal function in other plants. In addition, other conserved genes affected by micro-exon skipping include cell division and differentiation genes (CYCH;1, NOT9B and Rcd1L), epigenetic factor, transcription factors and others (Fig. 4b and Supplementary Tables 3 and 4). Moreover, drought-responsive proteins, epigenetic factor and meiotic gene are among the genes with small-exon skipping in flowers (Supplementary Table 3). On the other hand, genes with leaf transcripts affected by micro-exon skipping are those for transcriptional regulation, hormone response and splicing (Fig. 4c and Supplementary Tables 3 and 4); for genes affected by small-exon skipping in the leaf, the implicated functions include response to hormone and stresses, leaf morphology, induction of cell death and poly-pyrimidine tract binding (Supplementary Tables 3 and 4).

GRP20 is required for normal floral organ development

The effects of GRP20 on floral RNA splicing, especially micro-exon retention of crucial floral homeotic MADS-box and AP2 genes (Figs. 3a,j and 4b, and Extended Data Fig. 3), suggest that GRP20 might be involved in flower development. Thus, we investigated flower development of the grp20 mutants (Extended Data Fig. 1h). Compared with wild-type flowers (Fig. 5a and Extended Data Fig. 6a), about 30% of grp20 flowers showed organ defects, including altered numbers of sepals, petals, stamens and carpels (Fig. 5a,b, Extended Data Fig. 6a,b and Supplementary Table 5); the total number of grp20 floral organs also varied from 12 to 20 (Fig. 5c and Supplementary Table 5). Other grp20 floral organ abnormalities included reduced petal length and angle between the distal margins, stamens with fused filaments or anthers, abnormally large anther with a shorter filament and others (Extended Data Fig. 6c,d). Moreover, organ identity defects were found in grp20 flowers, including chimeric (fused) organs with petal-like and stamen-like portions, stamen–carpel portions and sepal–carpel parts (Fig. 5d and Extended Data Fig. 6e–g); finally, floral meristem defect was also infrequently seen with a complete floral bud occupying the position of the sepal (Extended Data Fig. 6a, bottom left panel), resembling an ap1 mutant flower. To verify that the defects were caused by the grp20 mutation, we introduced a fusion of the GRP20 promoter with its coding region into the grp20 mutant background (Extended Data Fig. 6h) and found that flowers of transgenic plants were normal (Fig. 5b,c and Extended Data Fig. 6a,c,d). Therefore, GRP20 is required for normal flower development and affects organ patterning.

**Fig. 5: Floral phenotypes in the wild type and *grp20* mutants.**

To further test whether the grp20 floral defects were related to the reduced function of floral regulatory genes exhibiting splicing defects, we generated relevant double mutants and examined their floral phenotypes. For example, the grp20-1 pi-1 double mutant showed a relatively reduced number of sepal-like organs in the second whorl (Fig. 6a,b and Supplementary Table 5), consistent with the idea that a part of grp20 defects was due to reduced PI WT transcript. In addition, the grp20-1 pi-1 flower produced unfused carpels with more than four stigmata, more severe than pi-1 single mutants (Fig. 6a,b and Supplementary Table 5), in agreement with the observation that genes other than PI also were alternatively spliced in grp20 flowers. Similarly, the grp20-1 ag-1 double mutant also showed floral defects different from those of ag-1, including a decreased number of first-whorl sepals (Fig. 6a,b and Supplementary Table 5). Double mutants of grp20-1 and as2-1 reduced the number of stamens and flower (organ) size compared with single mutant as2-1 (Fig. 6a,b and Supplementary Table 5). In addition, double mutants of grp20-1 with mutations in other floral homeotic and LOB domain genes including ap1, ap2 and lbd7 also showed more severe defects than the corresponding single mutants in some aspects of floral organ identity and morphology (Extended Data Fig. 6i), supporting the idea that GRP20 regulates flower development, at least in part by affecting the splicing of some homeotic genes and organ boundary genes (Extended Data Fig. 4a).

**Fig. 6: RBD is required for flower development.**

To further test whether the grp20 floral defects were related to the skipping of micro exons in transcripts of floral regulatory genes, we generated transgenic plants that contain fusions of the native promoter to the normal floral gene coding complementary DNA (cDNA; containing micro exons) for one of the A, B and E functions, including (1) A function, AP1 and AP2; (2) B function, AP3 and PI; and (3) E function, SEP3 and SEP4, in the grp20-1 background (Supplementary Fig. 2a–c). These transgenic plants produced flowers with partially restored phenotypes consistent with the increased levels of one of the ABE functions, including floral organ number and morphology compared with those of grp20 (Supplementary Fig. 2e,f), suggesting that they are able to partially rescue the defects in grp20 mutants. As controls, transgenic plants were also generated expressing the corresponding transgenes (AP1 and AP2, AP3 and PI, SEP3 and SEP4) lacking the micro exons. Although these transgenes were expressed at similar levels (Supplementary Fig. 2c,d), the transgenic plants showed flower defects similar to those of the grp20 mutants (Supplementary Fig. 2e,f). These results indicate that the function of GRP20 in flower development is at least in part dependent on micro-exon (and small exon) splicing of floral regulatory genes.

Similarly, we introduced transgenes for either the full-length AS2 coding sequence (CDS) or a 5′ alternatively spliced AS2 transcript into the grp20-1 background (Supplementary Fig. 2a,b,d). We found that the defects of size and morphology are partially rescued in transgenic plants with full-length AS2 CDS (Supplementary Fig. 2e), but the transgenic plants with the 5′ alternatively spliced AS2 transcript showed similar flower size and morphology to those of grp20-1 (Supplementary Fig. 2e). The results further support the idea that proper splicing regulated by GRP20 is important for normal flower development.

As the floral homeotic genes encode transcription factors, we wondered whether some of the genes differentially expressed in grp20 flowers were due to the defects in homeotic genes. Hence, we searched 9,279 potential target genes of ABCE MADS-box proteins (usually activators) and 1,703 potential target genes of the AP2 protein (a known repressor) supported by public ChIP–seq (chromatin immunoprecipitation-sequencing) results (Extended Data Fig. 7a–d and Supplementary Table 6)^39,40 and found 87 downregulated genes (40%) among putative MADS-box protein targets and 59 upregulated genes (12%) among putative AP2 targets (Extended Data Fig. 7e,f and Supplementary Table 6), suggesting that the splicing defects in these floral regulatory genes might have in turn caused differential expression of some of their target genes in grp20 flowers. Therefore, GRP20 probably affects floral organ patterning by regulating splicing of nearly all ABCE floral homeotic genes. Moreover, as floral homeotic genes and GRP20 are highly conserved among flowering plants, it is possible that the role of GRP20 in the regulation of RNA splicing and flower development is conserved among at least some angiosperms.

To test the above hypothesis, we transformed grp20-1 with fusions of the Arabidopsis GRP20 promoter to cDNAs of GRP20 homologues from cabbage (Brassica rapa, BrGRP20), soybean (Glycine max, GmGRP20), rice (Oryza sativa, OsGRP20) and Amborella (Amborella trichopoda, AmGRP20; Supplementary Fig. 3a,b). The GRP20 homologues showed slightly lower expression levels compared with that of AtGRP20 (Supplementary Fig. 3c); nevertheless, the BrGRP20 transgenic plants showed almost normal flowers, and GmGRP20 transgenic plants showed less severe defects in floral organ number and morphology when compared with grp20 (Supplementary Fig. 3d,e), supporting the idea that BrGRP20 is able to rescue the floral defects of the grp20 mutant and that GmGRP20 could partially replace the function of AtGRP20. However, we did not observe obvious rescue of floral defects in OsGRP20 and AmGRP20 transgenic plants. Furthermore, we tested whether the BrGRP20 homologue could rescue grp20 phenotypes in transcript splicing of floral homeotic genes using RT-qPCR in the above transgenic plants. The levels of transcripts of AP1, AP3, SEP3 and AP2 are similar in AtGRP20 and BrGRP20 flowers (Supplementary Fig. 3f). In addition, GmGRP20 transgenic plants showed significantly decreased levels of transcripts lacking micro exons compared with those in grp20 (Supplementary Fig. 3f). These results suggest that the GRP20 function in flower development and RNA splicing of floral regulatory genes is probably conserved between Arabidopsis and cabbage.

GRP20 binds to purine-rich motifs in micro and small exons

To learn how GRP20 regulates flower development and RNA splicing, we tested whether the predicted RBD (Fig. 1b) is important for GRP20 function in flower development and splicing. In RBD, the W, Y, and K residues are highly conserved among angiosperms and predicted to be important for RNA binding (Fig. 3a); we generated a mutant GRP20 coding sequence (RBDm) with changes at these and other conserved residues (Extended Data Fig. 8a). We transformed the grp20-1 mutant with a fusion of the native promoter to the GRP20 cDNA with the RBD mutation (Pro_GRP20–GRP20–RBDm), with the wild-type GRP20 transgene (Pro_GRP20–GRP20) as a positive control (Extended Data Fig. 8a). Although both GRP20 and GRP20–RBDm transgenic plants showed similar protein expression levels (Fig. 6c), the Pro_GRP20–GRP20–RBDm transgenic plants showed flower defects similar to those of the grp20 mutants, unlike the Pro_GRP20–GRP20 transgenic plant with normal flower organs (Fig. 6d,e and Supplementary Table 5), indicating that RBD is crucial for flower development. Furthermore, we tested whether RBD is needed for RNA splicing using RT-qPCR for specific transcripts in plants carrying the Pro_GRP20–GRP20 or Pro_GRP20–GRP20–RBDm transgenes in the grp20-1 background. The levels of transcripts containing the relevant exons for several floral homeotic genes (for example, AG, SEP4, AP1, AP2 and others; Fig. 5a) and LOB domain genes (AS2) were found to be reduced in transgenic plants with defective RBD, but similar to the WT in the Pro_GRP20–GRP20 transgenic plants (Fig. 3a), indicating that the RBD-defective transgene was not able to rescue the grp20 phenotype of ES and alternative 5′ site transcript. In addition, the Pro_GRP20–GRP20–RBDm transgenic plants exhibited a significant increase of AP3 and AP2 transcripts with micro-exon skipping and also alternative LBD2 transcript with A5SS similar to those in grp20 (Figs. 3i,j and 7a). These results indicate that the GRP20 RBD is required for flower organ patterning and RNA splicing of floral regulatory genes.

**Fig. 7: RNA consensus motifs, binding of GRP20 to GA-rich consensus and the regulation of micro-exon splicing in floral homeotic genes.**

To investigate whether the regulation of splicing by GRP20 is related to sequence characteristics (motifs) in affected floral and leaf transcripts, we examined the regions of pre-mRNAs that exhibit altered splicing from 50 nucleotides upstream to 50 nucleotides downstream of the affected region (including the affected region), according to the splicing types (Extended Data Fig. 2a). The results revealed that a GA-rich consensus (poly-purine motif) was found in 45% of the skipped exons and 44% of the ASIs (Fig. 7b and Extended Data Fig. 8b), higher than the other motifs including GA-rich and A-rich motifs in introns, GAU-rich motif in exons, AU-rich motif in 3′ regions and A-rich motif in 5′ regions (Fig. 7b and Extended Data Fig. 8b), suggesting that the exonic poly-purine motifs (poly(R)) might be important for regulating splicing by GRP20. As most of the skipped exons in grp20 flowers and leaves were micro and small exons, we examined their sequences and found that 74% of micro exons and 69% of small exons skipped in grp20 flowers have the GA-rich motifs (Extended Data Fig. 8c). In addition, the GA-rich consensus was also found in 70% of micro exons and 11% of small exons skipped in grp20 leaves (Extended Data Fig. 8c). To further test whether the GA-rich motif is enriched in the putative targets of GRP20, we performed an enrichment test between the affected exons in grp20 and all annotated exons. The significant enrichment with a P value of 2.3 × 10⁻⁸⁴ supports the idea that the poly-purine motifs are important for regulating exon retention by GRP20. In particular, the binding of GRP20 to poly-purine motifs in exons might be crucial for micro- and small-exon retention. In any case, the RBD is required for the wild-type level of transcripts containing the micro exon for MADS-box genes and AP2 (Figs. 3a and 7a), whereas increased levels of the transcripts lacking the micro exons in AP3 and AP2 (Figs. 3i,j and 7a) were observed in grp20 and RBD-defective transgenic plants. Furthermore, the affected micro exons in floral homeotic genes all contain one to two GA-rich motifs (Fig. 7a,c and Extended Data Fig. 8d,e), suggesting that the GA-rich motifs can mediate GRP20-dependent splicing of a subset of micro exons (and small exons) in floral transcripts.

To test whether the GRP20 protein with a putative RBD (Fig. 1b) can bind to RNA, including the GA-rich motif, we used an RNA electrophoretic mobility shift assay (EMSA) with the recombinant GRP20 to show that it could bind to the AP3 pre-mRNA weakly (Extended Data Fig. 8g), but not to the ACTIN7 pre-mRNA (Extended Data Fig. 8h). Further RNA EMSA tests indicated that GRP20 could bind to four synthetic RNA probes, with relatively high affinity for one (P1) with the GA-rich consensus (Extended Data Fig. 8i,j), similar to sequence motifs found in defective transcripts (Extended Data Fig. 8i,j). To test whether the in vitro RNA binding is dependent on the RBD, we expressed recombinant wild-type and mutant GRP20 proteins (Extended Data Fig. 8a) and tested their binding to the GA-rich probe (P1). The results showed that deletion of RBD or a mutation in the RBD blocked RNA binding by GRP20, indicating that the RBD is required for GRP20 to bind to the poly-purine motif (Fig. 7d). However, the GRP20 with deletion of the HDR could still bind to the GA-rich probe, suggesting that this domain is not crucial for RNA binding by GRP20 (Fig. 7d). The in vivo binding of GRP20 to micro-exon-containing regions of the AP1, AP3, SEP3 and AP2 transcripts was also confirmed by RNA immunoprecipitation (Supplementary Fig. 4a). In addition, we tested the in vitro binding of GRP20 with the GA-rich motif of the AP1 transcript and found that GRP20 is able to bind to the AP1 GA-rich motif, but not a mutant version with changes of three G’s to three U’s, further supporting the specific recognition between GRP20 and GA-rich RNA motifs (Supplementary Fig. 4b). The presence of one or more of the GA-rich motifs in the affected transcripts supports the hypothesis that 65% of ES and various amounts of other defects in grp20 floral transcripts are caused by the lack of GRP20 binding directly to these transcripts; however, other defective transcripts lacking such motifs might be regulated indirectly via additional factors, such as SR1, SR33 and SmB (small nuclear ribonucleoprotein core protein), which are also affected in grp20 (Supplementary Table 1).

GRP20 is able to form condensates

GRP20 contains an HDR (Fig. 1b and Extended Data Fig. 9a), which is annotated by the disorder confidence program, rich in proline and alanine residues and highly hydrophilic⁴¹. To investigate the role of the HDR in vivo for flower development and RNA splicing, the transgenic plants were generated that contain a fusion of the GRP20 promoter to the GRP20 cDNA lacking the HDR (GRP20ΔHDR) in the grp20 background (Extended Data Fig. 9b). Although the GRP20ΔHDR transgenic plants expressed the GRP20 protein at a level higher than that in the wild type (Extended Data Fig. 9c), they showed floral phenotypes similar to those of grp20 (Extended Data Fig. 9d,e and Supplementary Table 5), suggesting that the HDR is needed for normal flower development. In addition, the GRP20ΔHDR transgenic plants in the grp20 background showed the reduced levels of transcripts containing the relevant exons for several floral homeotic genes (for example, AG, SEP4, AP1, AP2 and others) and LOB domain gene (AS2), similar to those in grp20 and the GRP20 (RBDm) transgenic line (Fig. 3a). Moreover, the GRP20ΔHDR transgenic plants also exhibited a significant increase in the level of AP3 and AP2 transcripts lacking the relevant micro exon and also the alternative LBD2 transcript with A5SS similar to those in grp20 (Fig. 3j). These results further suggest that the HDR is also important for RNA splicing during flower development.

HDRs have been linked to liquid–liquid-phase separation (LLPS)⁴², which involves the formation of condensates of proteins or other macromolecules⁴³ and can be visualized as punctate signals in the cell⁴⁴, leading to the hypothesis that GRP20 can also form condensates. We found that the GRP20–YFP (yellow fluorescent protein) fusion protein formed condensates in Arabidopsis petal cells and tobacco epidermal cells (Extended Data Fig. 9f,g). Then, we showed that the GRP20–YFP condensates could be restored following photo bleaching (Extended Data Fig. 9h,i). Moreover, a fusion protein of the HDR with YFP also formed condensates, which was restored after the photo bleaching (Extended Data Fig. 9h,i). In addition, the observations of condensate formation of GRP20 (RBDm)–YFP (Extended Data Fig. 9j) and RNA binding of GRP20ΔHDR (Fig. 7d) support the idea that RNA binding and condensate formation are separate activities of GRP20.

GRP20 interacts with the U5 subunits of the spliceosome

Our results suggest that GRP20 can bind to some micro exons and small exons in pre-mRNAs in part through poly-purine motifs and probably recruits specific pre-mRNAs for splicing. To test whether known components of spliceosome machinery and regulators can bind to GRP20, we performed immunoprecipitation–mass spectrometry with a GRP20–YFP protein expressed in plants. Among putative interactive proteins, spliceosome U5 components Prp18, Snu114 and CLO were identified (Extended Data Fig. 10a). Importantly, U5 is a highly conserved core subunit of the spliceosome⁷. The physical interaction between GRP20 and Prp18 was further confirmed in vitro by a GST pull-down assay (Fig. 8a), by bimolecular fluorescence complementation (BiFC) in tobacco cells (Fig. 8b and Extended Data Fig. 10b) and by co-immunoprecipitation in Arabidopsis plants (Extended Data Fig. 10c). To investigate which part of GRP20 is required for interaction with Prp18, we generated truncated proteins (Extended Data Fig. 8a) and found that deletion of the HDR completely disrupted the interaction with Prp18 and that the HDR could bind to Prp18 weakly (Fig. 8c and Extended Data Fig. 10d), suggesting that HDR is crucial for the interaction. Furthermore, we obtained co-localization of GRP20 and Prp18 in the tobacco nucleus. The co-localization signals were particularly strong in the nuclear condensates (Fig. 8d and Extended Data Fig. 10e), and the stronger YFP signals were also observed in nuclear condensates from the interaction between GRP20–YFPn and Prp18–YFPc (Extended Data Fig. 10f). Such interactions among GRP20, the spliceosome and pre-mRNAs, especially those containing micro and small exons, probably facilitate splicing of these RNAs.

**Fig. 8: The interaction of GRP20 and spliceosome in vitro and in vivo, and a model showing the mechanism of GRP20 in RNA splicing.**

To examine whether the interaction between GRP20 and Prp18 is important for GRP20 function in flower development and proper retention of micro exons in floral homeotic genes, we generated a GRP20 deletion mutant (GRP20Δ143–153) lacking the C-terminal 11 amino acid residues and a mutant GRP20 cDNA (HDRm) with changes at lysine and proline residues (Supplementary Fig. 5a). These mutant GRP20 proteins failed to interact with Prp18 (Supplementary Fig. 5b). In contrast, both mutant GRP20 proteins could still form condensates (Supplementary Fig. 5c), providing a means to test the role of GRP20 interaction with Prp18 without affecting condensate formation. We transformed the grp20-1 mutant with a fusion of the native promoter to the GRP20 cDNA with the HDR mutation (Pro_GRP20–GRP20–HDRm), with the wild-type GRP20 transgene (Pro_GRP20–GRP20) as a positive control (Supplementary Fig. 5a,d). Although both GRP20 and GRP20–HDRm transgenic plants showed similar protein expression levels (Supplementary Fig. 5d), the Pro_GRP20–GRP20–HDRm transgenic plants showed flower defects similar to those of the grp20 mutants, unlike WT plants (Supplementary Fig. 5e,f), indicating that the interaction to Prp18 (component of U5 of the spliceosome) is crucial for GRP20 function in flower development. Furthermore, we tested whether the interaction to the spliceosome is needed for RNA splicing using RT-qPCR for specific transcripts in plants carrying the Pro_GRP20–GRP20–HDRm transgene in the grp20-1 background. The Pro_GRP20–GRP20–HDRm transgenic plants exhibited significantly increased levels, compared with the WT, of AP1, AP3 and AP2 transcripts lacking the micro exons that were skipped in the grp20 mutant, similar to those in grp20; also, the levels of alternative AS2 transcript with A5SS were similar in Pro_GRP20–GRP20–HDRm transgenic plants and grp20 (Supplementary Fig. 5g). These results indicate that the interaction between GRP20 and the spliceosome is required for flower organ patterning and RNA splicing of floral regulatory genes.

On the basis of results here, we propose a model with specific mechanisms of GRP20-mediated micro-exon (and small-exon) retention (Fig. 8e). GRP20 specifically binds to micro-exon-containing regions of floral homeotic transcripts and facilitates the proper retention of the micro exons by interacting with Prp18, a component of the U5 portion of the spliceosome. Furthermore, the observations that micro exons of floral homeotic genes were retained, albeit at reduced levels, in grp20 mutants and that most micro exons were retained indicate that there are probably other factors for micro-exon (and small-exon) splicing (Fig. 8e).

Discussion

Pre-mRNA splicing depends on interactions with the spliceosome, splicing factors and regulators⁴⁵. For most introns, the GU-AG nucleotides at the ends of the intron are involved in spliceosome binding and promote accurate splicing; also, the sequence information in typical exons with an average length of 150 nucleotides in vertebrates and 180 nucleotides in plants facilitates the binding of general splicing factors^6,17. However, micro exons usually lack sequence motifs for binding by general splicing factors and probably require additional factors. In this study, we identified a highly conserved RNA-binding protein, GRP20, in angiosperms that functions in RNA splicing, including the proper splicing of micro and small exons. GRP20 can bind to RNAs containing GA-rich and other motifs in micro and small exons and other exons of pre-mRNA through an RBD recognized here, thereby facilitating the proper splicing of subsets of genes that are expressed in the flower and/or leaf. This is the first report of a specialized splicing regulator of genes with known or predicted functions in plant development and environmental responses. Furthermore, GRP20 interacts with specific pre-mRNAs through its RBD and with the spliceosome involving its C-terminal portion; GRP20 might coordinate with the spliceosome machinery and pre-mRNAs to promote typical RNA splicing (Fig. 8e). Moreover, GRP20 is the first identified eukaryotic regulator of micro-exon and small-exon splicing with a newly recognized domain for binding to exonic poly-purine motifs and likely interaction with the spliceosome component. Overall, our results provide new mechanistic insights into the regulation of plant gene expression, at the level of RNA splicing, for genes important for flower development and possibly other processes.

In Arabidopsis, mutants defective in the splicing factors SC35 and SR45 genes encoding SR proteins exhibit intron retention defects in many transcripts and ES in fewer transcripts^46,47, but whether they play roles in micro-exon and small-exon splicing is not known. SC35 and SR45 can bind to purine-rich (GA) motifs in introns, not exons^46,47, and SR45 also binds to pyrimidine-rich motifs⁴⁸, but the role of RNA-binding activities of these proteins in splicing has not been tested in vivo, nor is additional information about their mechanisms available. The binding of plant SRs and other RNA-binding proteins to exons with a particular size range (micro and small exons or other sizes) has not been reported. GRP20 is capable of binding to micro exons and acts as a eukaryotic regulator of small exon splicing; the binding to poly-purine motifs in the exons is a newly reported mechanism for exon retention in eukaryotes. Moreover, the skipping of the micro exon could be reduced when purines in the intronic poly-pyrimidine tract are replaced by pyrimidines¹⁹. Therefore, a single or a few nucleotide changes between purine and pyrimidine might lead to RNA splicing defects, resulting in mutant proteins, providing an explanation for alternative RNA splicing associated with SNPs.

In Arabidopsis, ~5.5% of exons (8,118 of 150,240) are micro exons and ~25.9% (39,025 of 150,240) are small exons (Fig. 2d); moreover, ~16.3% of Arabidopsis genes (5,693 of 35,000) contain micro exons and ~35.8% (12,525 of 35,000) contain small exons (Extended Data Fig. 5). In addition, ~23% of rice genes possess micro exons²⁶. These data support the idea that micro and small exons are important gene-structural elements in plants, as proposed for micro exons in humans²³. The gene structures of AP1, AP3, AG and AP2 homologues in diverse angiosperms, including the early-divergent Amborella, monocots barley and rice, and eudicots tomato and soybean, all contain the micro exons corresponding to those that are skipped in grp20 floral transcripts (Fig. 7c and Extended Data Fig. 5h), suggesting that the proper splicing of these micro exons is conserved and probably important for flower development across angiosperms. The combination of GRP20 and micro exons in floral homeotic genes might be a key component in the regulatory programme for flower development during angiosperm evolution.

Arabidopsis has other GRPs related to GRP20; to test whether some of them also have some functions similar to those of GRP20, in flower development and RNA splicing, we investigated closely related GRP20 paralogs GRP17, GRP19 and GRP21, and a more distant gene GRP7 (Supplementary Figs. 1 and 6), using their corresponding T-DNA insertion mutants (Supplementary Fig. 6a). Although the RNA expression levels of each gene were significantly decreased in the corresponding mutant (Supplementary Fig. 6b), the mutants showed similar floral phenotypes to the WT (Supplementary Fig. 6c,d). In addition, the AP1, AP3, SEP3 and AP2 transcripts lacking the micro exons affected in the grp20 mutant were not detected in grp17, grp19, grp21 and grp7 flowers, unlike the floral and splicing phenotypes of grp20 (Supplementary Fig. 6e–h). These results and the differences in protein domains suggest that GRP17, GRP19, GRP21 and GRP7 probably do not play similar roles to GRP20 in flower development and RNA splicing.

Furthermore, nearly all of the micro exons in MIKC-type MADS-box genes encode a part of the K domain²⁷, which allows the formation of multimeric complexes of MADS-box proteins as the molecular basis for the floral quartet model⁴⁹. The crystal structure and biochemical studies of SEP3 showed that the N- and C-terminal regions of the second amphipathic helix encoded by the two micro exons in SEP3 are essential for dimerization and tetramerization, respectively²⁹. In our study, all affected micro exons in ABCE family genes encode the C-terminal region of the second helix, similar to that in SEP3, and share leucine and isoleucine residues for tetramer formation (Extended Data Fig. 8f), suggesting that the proper retention of the micro exons is essential for the multimeric complex, an essential aspect of the quartet model for flower development. It was found that a circular RNA containing the second micro exon of SEP3 increased the level of the splicing variant without the second micro exon³⁰, and the overexpression of this SEP3 splicing variant induced changes in petal and stamen number similar to those of grp20 (ref. ³⁰), supporting the idea that the micro exon is important for normal floral organ patterning. Although GRP20 is crucial for proper retention of micro exons in floral developmental genes, GRP20 affects a portion of micro and small exons in floral and leaf transcripts (Fig. 3d,e), suggesting that other factors are needed to regulate splicing of other micro and small exons and biological processes. In addition, GRP20 also promotes the retention of longer exons and affects 5′ and 3′ splicing junctions in some transcription factor family genes, LOB domain genes and other developmental and responsive genes. These splicing defects might also contribute to abnormal organ shape, blue dots on petals and other abnormal floral phenotypes in grp20 flowers. Further studies are required to investigate the possible role of GRP20 in other plant development and response processes. We showed that GRP20 can form condensates and that the HDR of GRP20 is required for condensate formation, suggesting that GRP20-dependent splicing might involve LLPS. Condensate formation and LLPS have been implicated in RNA metabolism including splicing⁴³ and regulation of gene expression⁵⁰; such processes have also been suggested to involve LLPS in plants^51,52. Our results here on GRP20 and the general presence of micro and small exons in plant genes suggest that splicing regulators specialized for micro and small exons are probably important for normal gene expression.

Methods

Plant materials and growth conditions

The Arabidopsis thaliana mutants used in this study were obtained from the Arabidopsis Biological Resource Center and are as follows: grp20-1 (SALK_134093), grp20-2 (SALK_026077), ap1-1 (CS127), ap2-1 (CS148), pi-1 (CS77), ag-1 (CS25), as2-1/lbd6-1 (CS3117), lbd7-1 (SALK_075629), grp17-1 (SALK_133589), grp19-1 (SALK_034288), grp19-2 (CS923713), grp21-1 (SALK_032127), grp21-2 (SALK_127070) and grp7-1 (SALK_039556). The single mutants were crossed with Col-0, and the genotypes were identified by PCR using corresponding primers listed in Supplementary Table 7. The double mutants were generated by relevant crosses and identified in the F2 generation by PCR. Arabidopsis and Nicotiana benthamiana were grown in a plant growth room at 21 °C, with a 16 h light and 8 h dark photoperiod and 60% humidity.

Bioinformatic analyses of GRP20 protein domain

The predictions of potential RNA-binding ability and RNA-binding regions in GRP20 were conducted by using the software catRAPID⁵³ and RNAbindPlus⁵⁴. The category of RNA-binding protein for GRP20 was also predicted by using the catRAPID signature program. The putative RNA-binding residues were identified by using two programs: DRNApred⁵⁵ and PPRInt⁵⁶. The cut-off values for catRAPID, RNAbindPlus, DRNApred and PPRInt were 0.5, 0.1, 0.05 and −0.2, respectively.

The protein disordered confidence analysis was performed using Phyre2 with structure prediction. The cut-off in this program for the protein disordered confidence was 0.6. The ‘ParSe: Predict Phase-Separating Protein Regions from the Primary Sequence’ program⁵⁷ (http://folding.chemistry.msstate.edu/utils/parse.html) was used in the prediction for the LLPS of GRP20 homologues among angiosperms. The disorder confidence scores along HDRs and whether HDRs can undergo LLPS of GRP20 homologues are shown by V_model and β_model (β-turn propensity). V_model < 0.56 and β_model > 0.9 indicate that the domain is intrinsically disordered and prone to undergo LLPS or fold to a stable conformation.

Plant phenotypic analyses

Flowers from WT, mutants and transgenic lines were examined. Six T3 lines were characterized for the complementation experiment. The number of flowers for various statistical analyses of phenotypes is indicated in the figure legends. The chimeric organs and other defects were shown as examples of mutant phenotypes. Petal morphology including length, top angle and width was measured in the same way for WT, mutants and transgenic plants. Flower photographs were obtained using a Nikon microscope (SMZ-U) and an AmScope microscope digital camera (catalogue number MU1803-HS); the numbers of flower organs were counted using the same Nikon microscope, in four whorls. The chimeric organs of the petal and stamen in the second whorl were counted as petals, whereas the chimeric organs of the petal and stamen in the third whorl were counted as stamens. For scanning electron microscope observations, a fresh unopened single flower was prepared, and the sepals were removed using needles. The scanning electron microscope photographs were taken using a variable-pressure detector in a Zeiss SIGMA VP-FESEM under 10 kV.

Confocal image analyses

For the observation of YFP protein and other confocal images, stable transgenic lines were used to provide fresh whole flowers or organs including petals, sepals and anthers, which were then used for confocal imaging (LSM880, Zeiss). DAPI (4′,6-diamidino-2-phenylindole, catalogue number 14285; 0.05 mg ml⁻¹) was used for nuclear staining. For transient transformation and protein expression, leaves of 4- to 6-week-old N. benthamiana were infiltrated by Agrobacterium GV3101 containing corresponding plasmids and grown in the dark for 24 h and then in the light for the following 24 h. The images of bottom (abaxial) epidermal cells were obtained using a Zeiss LSM880 confocal microscope or an Olympus FV1000 confocal microscope. The DAPI and YFP signals were captured, respectively, under 405 nm and 514 nm lasers in similar gain settings.

Transcriptomic analyses and qRT-PCR

For each of three biological replicates, Arabidopsis stage 1–12 flowers were collected separately from Col-0 and grp20. The RNA extraction and analyses were executed as described previously⁵⁸. RNA sequencing (RNA-seq) was conducted using an Illumina NextSeq 2000 instrument with 2 × 150 bp paired-end outputs. The statistical significance of RNA-seq data was calculated using the q value (an adjusted P value) cut-off <0.05 and |fold-change| ≥ 2 in the DESeq2 package. Upregulated genes in transcriptomic data were categorized using log₂(fold change) ≥ 1, q value < 0.05, and downregulated genes were categorized using log₂(fold change) ≤ −1, q value < 0.05 in Supplementary Table 2. Venn maps were generated using Venny (version 2.1.0) and R software (version 3.5.2). GO enrichment analysis was conducted using Gene Ontology, and statistics were compiled by FDR (false discovery rate) correction and Fisher’s test. The heat maps and volcano diagrams were generated using Origin (version 2020b) and R (version 3.5.2) software. The primers used for gene expression estimates were designed using qPrimerDB⁵⁹ and Primer3Plus, and listed in Supplementary Table 7. qRT-PCR was performed as described previously⁶⁰, with three biological replicates. The GoTaq qPCR and RT-qPCR systems (catalogue number A6010, Promega) were used for reverse transcription and qPCR. The qRT-PCR experiments were performed using Applied Biosystems StepOnePlus real-time PCR systems (catalogue number 4376600, ThermoFisher) with standard PCR procedure.

Analyses of RNA splicing and detection of affected transcripts by RT-qPCR

RNA splicing analyses were conducted based on multivariate analysis of transcript splicing assay (rMATS version 4.1.1)⁶¹, and the results were verified manually in Integrative Genomics Viewer (IGV version 2.9.4). RNA-seq data from WT and grp20 stage 1–12 flowers with three replicates were used in the analyses. The Hisat2 program is used to map reads for the analyses of splicing as referenced in plants^25,26,27 and animals⁶². In our analyses, 2 × 150 bp paired-end read sequences were used and the average usable read length is 130 bp after removing the adaptor sequences. In addition, the annotated Arabidopsis gene structures were used as a reference in the mapping process, such that annotated micro exons and small exons in the transcript reads have a low probability of being not detected bioinformatically. The read maps and counts were illustrated based on the IGV output. The reference for gene structures used as the input in IGV was the TAIR10 GFF3 file, which was downloaded from the TAIR website (https://www.arabidopsis.org/download/index.jsp). For P value calculation as referenced^61,63, the rMATS program was used with a hierarchical framework to simultaneously account for estimation uncertainty in individual replicates and variability among replicates (https://github.com/Xinglab/rmats-turbo/blob/v4.1.2/README.md). rMATS uses a hierarchical framework to model exon inclusion levels, similar to percent spliced in (PSI), which is shown in Supplementary Table 1. The illustration of gene structure and support reads in Extended Data Fig. 3 for each transcript was according to the results from IGV. Detailed information on read numbers, TAIR gene IDs and, if available, gene names and symbols is provided in Supplementary Table 1. qRT-PCR was used to confirm the defects in splicing. The primers used to detect the WT transcripts in affected regions are shown in Supplementary Table 7, and the primers used for the detection of transcripts with micro-exon skipping or A5SS are indicated in Fig. 3i and Supplementary Table 7. The definition of micro exon (<51 nucleotides) is based on a previous study²⁴, and the small exon (51–100 nucleotides) is defined in this study as it is larger than micro exons and smaller than average exons. The short exons (<101 nucleotides), including micro exons (<51 nucleotides) and small exons (51–100 nucleotides), were identified by searching the Arabidopsis genome (TAIR10) and categorized into four groups by size: 1–9 nucleotides, 10–25 nucleotides, 26–50 nucleotides and 51–100 nucleotides.

Although the rMATS program can detect statistical significance in AS between WT and grp20, it is not very sensitive in detecting intron retention; therefore, to obtain additional evidence for intron retention, we analysed our datasets using the SUPPA2 tool⁶⁴. In flowers, 3,712 genes were found to have intron retention by the SUPPA2 tool, including 887 genes detected by the above analyses and 2,825 additional genes (see details in Supplementary Table 1).

RNA motif analyses, RNA binding using EMSA and RNA immunoprecipitation

RNA motif analyses were carried out using the MEME program (version 5.4.1)⁶⁵ for transcripts with different types of splicing defects. The sequences from 50 nucleotides upstream to 50 nucleotides downstream of the affected regions (including the affected region) in the flower-specific group of transcripts according to the splicing types were included as inputs for consensus detection. Single-strand RNA probes corresponding to consensus motifs were synthesized by Integrated DNA Technologies. The RNA powder was diluted in RNase-free water to 200 fmol μl⁻¹. EMSA for RNA binding was performed as previously described⁶⁶. To transcribe full-length pre-mRNA for EMSA, the DNA templates of AP3 and ACTIN7 were amplified using PCR with the Q5 High-Fidelity DNA Polymerases (catalogue number M0491, New England BioLabs), with Arabidopsis genomic DNA and one of the primers fused to the promoter for T7 phage polymerase (TAATACGACTCACTATAGGGAGA). The Arabidopsis genomic DNA was extracted using the CTAB assay and further purified using a genomic DNA clean and concentration kit (catalogue number D4010, ZYMO RESEARCH). The DNA templates of AP3 and ACTIN7 were recovered from agarose gel using a NucleoSpin Gel and PCR Clean‑up kit (catalogue number 740609, MACHEREY-NAGEL). The primers are listed in Supplementary Table 7. The AP3 and ACTIN7 pre-mRNAs were transcribed in vitro with the corresponding DNA template using the T7 phage polymerase and other reagents in the MAXIscript SP6/T7 transcription kit (catalogue number AM1322, ThermoFisher). The RNA transcripts were treated with DNase I and purified using an RNA clean and concentration kit (catalogue number 1015, ZYMO RESEARCH). Purified GRP20 (1 mg or 2 mg) was incubated with 500 ng purified pre-mRNA in 1× EMSA buffer (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 2 mM DTT, 10% glycerol, 1 mM PMSF) at room temperature for 30 min, respectively. Binding to RNA probe using EMSA was conducted using an EMSA kit (catalogue number E33075, Molecular Probes), including incubation of 400 fmol RNA probes and 17 μg GRP20 proteins in 1× binding buffer at room temperature for 30 min. The total samples with the RNA EMSA loading buffer were loaded onto a 5% polyacrylamide native gel, after a pre-run of 1 h at 45–60 V. The gel was run for about 1 h at 6–15 mA and then was stained using SYBR Green EMSA nucleic acid gel stain (1:10,000 dilution in 0.5× TBE (RNase-free water)) in the EMSA kit (catalogue number E33075, Molecular Probes), and the stained RNA was detected and recorded using a ChemiDoc image system (Bio-Rad).

RNA immunoprecipitation was performed as referenced⁶⁷. The whole inflorescences and leaves were collected from Pro_GRP20::GRP20-eYFP and Pro_35S::eYFP transgenic plants. The nuclei of the samples were preliminarily obtained with extraction buffer (20 mM Tris–HCl pH 7.5, 150 mM NaCl, 2.5 mM MgCl₂, 0.5% Triton X-100, 10% glycerol, 0.5 mM DDT, 2 mM PMSF and 20 U ml⁻¹ RNase inhibitor) including RNase inhibitor (catalogue number AM2696, Invitrogen). The anti-GFP antibody (mAb: catalogue number AE012, ABclonal, 1:50) and protein G magnetic beads (catalogue number S1430S, New England BioLabs) were added into the total nuclear RNA lysis for overnight. The protein A/G magnetic beads were washed at least three times with washing buffer (20 mM Tris–HCl pH 7.5, 150 mM NaCl, 2.5 mM MgCl₂, 0.2% Triton X-100, 10% glycerol, 0.5 mM DDT, 1× protease inhibitor cocktail and 20 U ml⁻¹ RNase inhibitor) and dilution buffer (20 mM Tris–HCl pH 7.5, 150 mM NaCl, 2.5 mM MgCl₂, 10% glycerol, 1 mM PMSF and 20 U ml⁻¹ RNase inhibitor). The precipitated complexes were resuspended by protease buffer and treated with RNase inhibitor and proteinase K. Homogenization buffer (100 mM Tris–HCl pH 8.0, 5 mM EDTA pH 8.0, 100 mM NaCl, 0.5% SDS and 0.01 volume β-ME) was added to the precipitated complexes, and RNA was extracted using the phenol–chloroform–isoamyl alcohol method. cDNA was synthesized with purified RNA and ABScript III RT master mix for qPCR with a gDNA remover kit (catalogue number RK20429, ABclonal). Then, qPCR was performed as described previously⁶⁰, with three biological replicates. The 2× Universal SYBR green fast qPCR mix systems (catalogue number RK21203, ABclonal) were used for qPCR. The qRT-PCR experiments were performed using Applied Biosystems StepOnePlus real-time PCR systems (catalogue number 4376600, ThermoFisher) following the instructions.

Recombinant protein purification

The CDSs of GRP20, GRP20ΔHDR (residue 1 to 118), HDR (residue 119 to 153) and GRP20Δ143-153 (residue 1 to 142) were cloned into pSUMO (pET28a–SUMO) vector between the BamHI and XhoI restriction sites. The coding sequences of GRP20ΔRBD (deletion of residue 92 to 115), GRP20 (RBDm) (M102A, W103A, Y105A, K106A and K107A) (m, mutation with indicated amino acid changes) and GRP20 (HDRm) (K143A, P144A, P147A, K150A and P151A) were also cloned into pSUMO (pET28a–His–SUMO) and then mutated using a Q5 site-directed mutagenesis kit (catalogue number E0552S, New England BioLabs). The CDSs of the primers for the mutagenesis experiment were designed using NEBaseChanger (New England BioLabs) and listed in Supplementary Table 7. The plasmids were transformed into Escherichia coli Rosetta (DE3). The positive strains were grown at 37 °C to OD = 0.6, then transferred to 18 °C for further growth for 16–20 h. The cells were harvested, resuspended in NEBExpress E. coli lysis reagent (catalogue number P8116S, New England BioLabs) and sonicated gently using a Diagenode Bioruptor (UCD-300, Diagenode). The recombinant proteins including His–SUMO, His–SUMO–GRP20, His–SUMO–GRP20ΔRBD, His–SUMO–GRP20 (RBDm) and His–SUMO–GRP20ΔHDR were purified with Ni-NTA magnetic beads (1:1 mixture of two kinds of beads: catalogue number S1423S, New England BioLabs, and catalogue number 786-910, G-Biosciences) and ÄKTA Pure 150L FPLC and Frac-950 Fraction Collector (GE Healthcare) with a HiLoad 16/600 Superdex 200-pg column (GE Healthcare). Protein concentration was quantified using a Pierce BCA protein assay kit (catalogue number 23225, ThermoFisher).

In vivo and in vitro interaction assay

For the BiFC experiment, full-length CDSs of GRP20 and Prp18 were cloned into the pXY104 (YFPn) and the pXY106 (YFPc) vectors, respectively. Then, the constructs were co-transformed into Agrobacterium cells (GV3101) for subsequent infiltration into N. benthamiana leaves as referenced⁶⁸. The transformed leaves were analysed using LSM880 confocal microscopy (Zeiss, Germany). The co-transformations of pXY104–GRP20 and pXY106, pXY104 and pXY106–Prp18, and pXY104 and pXY106 were used as the negative controls. The co-infiltration of pXY104–MMD1 and pXY106–JMJ16 was used for a positive control. His pull-down assay or GST pull-down was performed as previously described⁶⁹. The recombinant full-length GRP20 (residue 1 to 153), truncated GRP20ΔHDR (residue 1 to 118), HDR (residue 119 to 153), truncated GRP20Δ143–153 (residue 1 to 142) and mutated GRP20 (HDRm) proteins, fused with an N-terminal 6× histidine plus SUMO tag (His–SUMO), were purified from E. coli using Ni-NTA magnetic beads (catalogue number S1423S, New England BioLabs). The recombinant full-length Prp18 protein fused with an N-terminal GST tag (GST) was expressed in E. coli and purified using the Pierce glutathione purification beads (catalogue number 78601, Thermo Scientific). His–SUMO and GST proteins were also purified for negative controls. The concentration of purified proteins was determined by A280. The pull-down proteins were incubated with GST magnetic beads or Ni-NTA magnetic beads and detected using western blot with anti-His (mAb, 1:3,000 dilution, catalogue number MA1-21315, Invitrogen) and anti-GST (mAb, 1:5,000 dilution, catalogue number AE001, ABclonal) antibodies. Co-immunoprecipitation was conducted as described⁷⁰; the CDS of Prp18 was cloned into pCAMBIA1306 with the 35S promoter and transformed into the transgenic plants Pro35S::GRP20-YFP and Pro35S::YFP. The IP was incubated with protein G magnetic beads (catalogue number S1430S, New England BioLabs) and anti-GFP antibody (rabbit Ab, pAb, catalogue number AE011, ABclonal, 1:100), and the proteins were eluted using 5× SDS-PAGE loading buffer. The input and IP (immunoprecipitation) samples were detected using western blot with anti-GFP (pAb, catalogue number AE001, ABclonal, 1:1,000) and anti-FLAG (mAb, catalogue number AE005, ABclonal, 1:1,000) antibodies. For co-localization, full-length CDSs of GRP20 and Prp18 were cloned into the pGWB441 (YFP-tag) and pH7RWG2 (RFP-tag) vectors, respectively. The constructs were co-transformed into Agrobacterium cells (GV3101) for subsequent infiltration into N. benthamiana, and the co-localization was analysed using LSM880 confocal microscopy (Zeiss) by YFP and RFP channels.

Plant protein extraction and western blot

Protein extraction and western blot analysis were performed as described previously⁶⁹. Total protein and nuclear protein were extracted using protein extraction buffer (20 mM Tris–HCl pH 8.0, 300 mM NaCl, 1 mM EDTA, 10% glycerol, 1 mM PMSF and 1× protease inhibitor cocktail (catalogue number 11836170001, Roche)) from flower buds. The nuclei were passed through a 40 μm cell strainer (catalogue number 76327-098, VWR) and centrifuged at 3,500 rpm at 4 °C for 30 min. Antibodies (GST tag (mAb): catalogue number AE001, ABclonal, 1:1,000; His tag (mAb): catalogue number MA1-21315, Invitrogen, 1:1,000; GFP tag (pAb): catalogue number AE011, ABclonal, 1:1,000) were used in western blotting. Goat anti-rabbit secondary antibodies (catalogue number 31460, Invitrogen, 1:2,000) or goat anti-mouse secondary antibodies (catalogue number 62-6520, Invitrogen, 1:2,000) were used against the primary antibodies. Signals were visualized with a ChemiDoc image system (Bio-Rad). Anti-β-tubulin (pAb, catalogue number AC008, ABclonal, 1:1,000 dilution) and anti-histone 3 (pAb, catalogue number AS10710, Agrisera, 1:2,000 dilution) antibodies were used as the loading controls.

Constructs for complementation and GRP20 mutant domains

The GRP20 CDS was cloned into Pro35S::pGWB441 (eYFP tag, enhanced YFP) by Gateway BP Clonase II Enzyme mix (catalogue number 11789100, ThermoFisher) and Gateway LR Clonase II Enzyme mix (catalogue number 11791020, ThermoFisher). The GRP20 CDS was also cloned into Pro_35S::pCAMBIA1306 (FLAG tag) by KpnI/BamHI. The 35S promoter in Pro_35S::GRP20-pGWB441 was replaced by the GRP20 promoter by digestion with MfeI/XbaI and ligation. The 35S promoter in Pro_35S::GRP20-pCAMBIA1306 was replaced by the GRP20 promoter by digestion with EcoRI/KpnI and ligation. The 35S-driven GRP20–eYFP, 35S-driven GRP20–FLAG, GRP20-driven GRP20–eYFP and GRP20-driven GRP20–FLAG were transformed into WT and grp20-1, respectively. The background for transgenic plants was grp20-1 for most experiments in this study and is referred to as grp20, unless otherwise indicated. The expression of GRP20-driven GRP20–eYFP was confirmed by western blotting with anti-GFP antibody (catalogue number AE011, ABclonal, 1:1,000 dilution) and anti-FLAG antibody (catalogue number AE005, ABclonal, 1:1,000 dilution).

Mutagenesis was conducted using a Q5 Site-Directed Mutagenesis Kit (catalogue number E0552S, New England BioLabs). The primers for mutagenesis were designed based on NEBaseChanger and are listed in Supplementary Table 7. The mutant GRP20 plasmids were transformed into Agrobacterium GV3101, including GRP20-driven GRP20 (RBDm)–eYFP, GRP20-driven GRP20ΔHDR–eYFP, 35S-driven GRP20ΔHDR–eYFP, 35S-driven HDR–eYFP, 35S-driven GRP20 (RBDm)–eYFP and GRP20-driven GRP20 (HDRm)–eYFP (m, mutation). The mutant constructs were transformed into WT and grp20-1. The expression of mutant GRP20 was confirmed by western blotting. At least five individual transgenic lines were analysed for each construct.

The normal CDSs of floral regulatory genes (AP1, AP2, AP3, PI, SEP3, SEP4 and AS2) were cloned into Pro35S::pGWB441 (eYFP tag, enhanced YFP) by Gateway reactions or Pro35S::N1-cYFP vector by enzymatic digestion and ligation. Then, the 35S promoter in these constructs was replaced by native promoters of floral regulatory genes by enzymatic digestion and ligation. The deletion of micro exons that were affected by GRP20 in floral homeotic genes was constructed through the Q5 Site-Directed Mutagenesis Kit. The alternative 5′ site fragments of AS2 were amplified from the grp20-1 flower cDNA library and then inserted into Pro35S::N1-cYFP. The 35S promoter of this construct was then replaced by the native promoter of AS2. For each transgenic line, at least two individual lines were obtained.

The cDNA of GRP20 homologues (B. rapa, G. max, O. sativa and A. trichopoda) was amplified from the cDNA library of B. rapa or genomic DNA of G. max, O. sativa and A. trichopoda, and then inserted into Pro_AtGRP20::N1-cYFP vectors. The complementation constructs of Pro_AtGRP20::BrGRP20, Pro_AtGRP20::GmGRP20, Pro_AtGRP20::OsGRP20 and Pro_AtGRP20::AmGRP20 were transformed into GV3101 and induced into Arabidopsis with grp20-1 background. For each transgenic plant, at least two individual lines were obtained.

The similar expression levels of GRP20, GRP20 (RBDm) and GRP20ΔHDR proteins in transgenic plants (Fig. 6c and Extended Data Fig. 9b) and in E. coli (Supplementary Fig. 7a) suggest that normal and mutant GRP20 proteins are translated with similar stability. In addition, the predicted protein structures were not affected by the amino acid changes (Supplementary Fig. 7b), using structure prediction⁷¹ and simulation (https://swissmodel.expasy.org/). These results suggest that the folding of the mutant protein was probably not drastically affected by the amino acid substitutions.

Protein condensates, fluorescent photo bleaching and the corresponding constructs

The protein condensates were observed as described⁵¹ in sepals and petals of Arabidopsis transgenic plants (Pro_GRP20::GRP20–eYFP; grp20) and also in epidermal cells of tobacco leaves with one of the following constructs: Pro_35S::eYFP, Pro_35S::GRP20–eYFP, Pro_35S::GRP20ΔHDR (residue 1 to 118)–eYFP, Pro_35S::HDR [GRP20 (residue 119 to 153)]–eYFP, Pro_35S::GRP20 (RBDm)–eYFP, Pro_35S::GRP20Δ143–153 (residue 1 to 142)–eYFP and Pro_35S::GRP20 (HDRm)–eYFP. DAPI (0.05 mg ml⁻¹) was used to stain the nuclei of Arabidopsis and tobacco cells. Fluorescent bleaching was conducted as described previously⁷² and in the Zeiss manual. The full-length GRP20 (Pro_35S::GRP20 (residue 1 to 153)–eYFP), GRP20 without HDR (Pro_35S::GRP20 (residue 1 to 118)–eYFP), HDR alone (Pro_35S::GRP20 (residue 119 to 153)–eYFP), Pro_35S::GRP20Δ143-153 (residue 1 to 142)–eYFP and Pro_35S::GRP20 (HDRm)–eYFP) were transiently transformed into the bottom surface of N. benthamiana leaves. Protein condensates were bleached, and the intensity of fluorescence was calculated using confocal microscopy and an associated computational tool (Zeiss) following the manufacturer’s instructions.

Protein domain alignment, conservation analyses and orthogroup searching

The evolutional relationship of representative angiosperms was derived from published phylogeny⁷³. The relationship among ABCE family genes was obtained from previous studies⁷⁴. The protein sequences of Arabidopsis GRP20 and its homologues from other species were downloaded from Phytozome (https://phytozome-next.jgi.doe.gov/) and Uniprot (https://www.uniprot.org/), with a threshold of similarity ≥60%, to focus on the close homologues. The protein alignment of GRP20 homologues was conducted using Muscle in MEGA 7 (ref. ⁷⁵). The protein sequences encoded by micro exons of ABCE genes were obtained from Uniprot, and the alignment was conducted using Muscle in MEGA 7. The illustrations of gene structures of ABCE family genes were generated using Gene Structure Display Server (version 2.0)⁷⁶ and TBtools⁷⁷. The GFF3 file was downloaded from TAIR (https://www.arabidopsis.org/). The CDSs and genomic sequences were downloaded from Phytozome. The orthogroup searching and copy number identification for 13 angiosperms (Arabidopsis, papaya, grape, poplar, tomato, lettuce, carrot, rice, sorghum, quinoa, pineapple, water lily and Amborella) and one gymnosperm (Ginkgo) were performed as referenced⁷⁸. The whole Arabidopsis genes were used as queries to search for 1 gymnosperm and 13 high-quality angiosperm genomes using BLASTP with a strict E-value threshold of less than 1 × 10⁻⁵ and a minimal amino acid sequence identity of 30%.

Statistics and reproducibility

Three experiments were repeated independently with similar results for micrographs in Figs. 6c, 7d and 8a,c; Extended Data Figs. 6h, 8g,h,j, 9c and 10c; and Supplementary Figs. 4b, 5b,d and 7a. For flower images or cell images in Fig. 8b,d; Extended Data Figs. 6b,e–g, 9f,g and 10f; and Supplementary Fig. 5c, three observations were repeated independently with similar results in 20 individual flowers or 25 individual cells. The statistical test used for GO annotations in Supplementary Table 3 and for differential expressed genes in Supplementary Table 6 is the Mann–Whitney U test with 95% confidence intervals and FDR correction, and Fisher’s test with 95% confidence intervals, respectively.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

All data are available in the main text or Supplementary Information. Raw data of RNA-seq of WT and grp20 floral and leaf transcriptomes have been deposited in the SRA database of NCBI with accession number PRJNA851744. The gene and protein information of Arabidopsis and other species were obtained from TAIR (https://www.arabidopsis.org/), UniProt (https://www.uniprot.org/) and Phytozome v13 (https://phytozome-next.jgi.doe.gov/). The prediction protein structures were obtained from AlphaFold Protein Structure Database (https://alphafold.ebi.ac.uk/). Source data are provided with this paper.

References

van Santen, V. L. & Spritz, R. A. Splicing of plant pre-mRNAs in animal systems and vice versa. Gene 56, 253–265 (1987).
Article PubMed Google Scholar
Deng, X. & Cao, X. F. Roles of pre-mRNA splicing and polyadenylation in plant development. Curr. Opin. Plant Biol. 35, 45–53 (2017).
Article CAS PubMed Google Scholar
Montes, M., Sanford, B. L., Comiskey, D. F. & Chandler, D. S. RNA splicing and disease: animal models to therapies. Trends Genet. 35, 68–87 (2019).
Article CAS PubMed Google Scholar
Zhang, H., Zhao, Y. & Zhu, J. K. Thriving under stress: how plants balance growth and the stress response. Dev. Cell 55, 529–543 (2020).
Article CAS PubMed Google Scholar
He, Z., Webster, S. & He, S. Y. Growth-defense trade-offs in plants. Curr. Biol. 32, R634–R639 (2022).
Article CAS PubMed Google Scholar
Reed, R. Mechanisms of fidelity in pre-mRNA splicing. Curr. Opin. Cell Biol. 12, 340–345 (2000).
Article CAS PubMed Google Scholar
Meyer, K., Koester, T. & Staiger, D. Pre-mRNA splicing in plants: in vivo functions of RNA-binding proteins implicated in the splicing process. Biomolecules 5, 1717–1740 (2015).
Article CAS PubMed PubMed Central Google Scholar
Deng, X. A. et al. Arginine methylation mediated by the Arabidopsis homolog of PRMT5 is essential for proper pre-mRNA splicing. Proc. Natl Acad. Sci. USA 107, 19114–19119 (2010).
Article CAS PubMed PubMed Central Google Scholar
Sanchez, S. E. et al. A methyl transferase links the circadian clock to the regulation of alternative splicing. Nature 468, 112–116 (2010).
Article CAS PubMed Google Scholar
Zhang, Z. L. et al. Arabidopsis floral initiator SKB1 confers high salt tolerance by regulating transcription and pre-mRNA splicing through altering histone H4R3 and small unclear ribonucleoprotein LSM4 methylation. Plant Cell 23, 396–411 (2011).
Article PubMed PubMed Central Google Scholar
Jia, T. et al. The Arabidopsis MOS4-associated complex promotes microRNA biogenesis and precursor messenger RNA splicing. Plant Cell 29, 2626–2643 (2017).
Article CAS PubMed PubMed Central Google Scholar
Richardson, D. N. et al. Comparative analysis of serine/arginine-rich proteins across 27 eukaryotes: insights into sub-family classification and extent of alternative splicing. PLoS ONE 6, e24542 (2011).
Article CAS PubMed PubMed Central Google Scholar
Shepard, P. J. & Hertel, K. J. The SR protein family. Genome Biol. 10, 242 (2009).
Article PubMed PubMed Central Google Scholar
Wang, J. H., Smith, P. J., Krainer, A. R. & Zhang, M. Q. Distribution of SR protein exonic splicing enhancer motifs in human protein-coding genes. Nucleic Acids Res. 33, 5053–5062 (2005).
Article CAS PubMed PubMed Central Google Scholar
Lander, E. S. et al. Initial sequencing and analysis of the human genome. Nature 409, 860–921 (2001).
Article CAS PubMed Google Scholar
Atambayeva, S. A., Khailenko, V. A. & Ivashchenko, A. T. Intron and exon length variation in Arabidopsis, rice, nematode, and human. Mol. Biol. 42, 312–320 (2008).
Article CAS Google Scholar
Guo, L. & Liu, C. M. A single-nucleotide exon found in Arabidopsis. Sci. Rep. https://doi.org/10.1038/srep18087 (2015).
Hawkins, J. D. A survey on intron and exon lengths. Nucleic Acids Res. 16, 9893–9908 (1988).
Article CAS PubMed PubMed Central Google Scholar
Dominski, Z. & Kole, R. Selection of splice sites in pre-mRNAs with short internal exons. Mol. Cell Biol. 11, 6075–6083 (1991).
CAS PubMed PubMed Central Google Scholar
Hwang, D. Y. & Cohen, J. B. U1 small nuclear RNA-promoted exon selection requires a minimal distance between the position of U1 binding and the 3′ splice site across the exon. Mol. Cell Biol. 17, 7099–7107 (1997).
Article CAS PubMed PubMed Central Google Scholar
Hollander, D., Naftelberg, S., Lev-Maor, G., Kornblihtt, A. R. & Ast, G. How are short exons flanked by long introns defined and committed to splicing? Trends Genet. 32, 596–606 (2016).
Article CAS PubMed Google Scholar
Irimia, M. et al. A highly conserved program of neuronal microexons is misregulated in autistic brains. Cell 159, 1511–1523 (2014).
Article CAS PubMed PubMed Central Google Scholar
Li, Y. I., Sanchez-Pulido, L., Haerty, W. & Ponting, C. P. RBFOX and PTBP1 proteins regulate the alternative splicing of micro-exons in human brain transcripts. Genome Res. 25, 1–13 (2015).
Article PubMed PubMed Central Google Scholar
Ustianenko, D., Weyn-Vanhentenryck, S. M. & Zhang, C. L. Microexons: discovery, regulation, and function. Wiley Interdiscip. Rev. RNA https://doi.org/10.1002/wrna.1418 (2017).
Yu, H. et al. Pervasive misannotation of microexons that are evolutionarily conserved and crucial for gene function in plants. Nat. Commun. 13, 820 (2022).
Article CAS PubMed PubMed Central Google Scholar
Song, Q. et al. Identification and analysis of micro-exon genes in the rice genome. Int. J. Mol. Sci. https://doi.org/10.3390/ijms20112685 (2019).
Song, Q., Bari, A., Li, H. & Chen, L. L. Identification and analysis of micro-exons in AP2/ERF and MADS gene families. FEBS Open Bio 10, 2564–2577 (2020).
Article CAS PubMed PubMed Central Google Scholar
Hugouvieux, V. et al. Tetramerization of MADS family transcription factors SEPALLATA3 and AGAMOUS is required for floral meristem determinacy in Arabidopsis. Nucleic Acids Res. 46, 4966–4977 (2018).
Article CAS PubMed PubMed Central Google Scholar
Puranik, S. et al. Structural basis for the oligomerization of the MADS domain transcription factor SEPALLATA3 in Arabidopsis. Plant Cell 26, 3603–3615 (2014).
Article CAS PubMed PubMed Central Google Scholar
Conn, V. M. et al. A circRNA from SEPALLATA3 regulates splicing of its cognate mRNA through R-loop formation. Nat. Plants 3, 17053 (2017).
Article CAS PubMed Google Scholar
Wang, L., Ma, H. & Lin, J. Angiosperm-wide and family-level analyses of AP2/ERF genes reveal differential retention and sequence divergence after whole-genome duplication. Front. Plant Sci. 10, 196 (2019).
Article PubMed PubMed Central Google Scholar
Ma, W. et al. Wrinkled1, a ubiquitous regulator in oil accumulating tissues from Arabidopsis embryos to oil palm mesocarp. PLoS ONE 8, e68887 (2013).
Article CAS PubMed PubMed Central Google Scholar
Black, D. L. Does steric interference between splice sites block the splicing of a short c-src neuron-specific exon in nonneuronal cells. Genes Dev. 5, 389–402 (1991).
Article CAS PubMed Google Scholar
Kim, J. S. et al. Cold shock domain proteins and glycine-rich RNA-binding proteins from Arabidopsis thaliana can promote the cold adaptation process in Escherichia coli. Nucleic Acids Res. 35, 506–516 (2007).
Article CAS PubMed Google Scholar
Cao, S. Q., Jiang, L., Song, S. Y., Jing, R. & Xu, G. S. AtGRP7 is involved in the regulation of abscisic acid and stress responses in Arabidopsis. Cell. Mol. Biol. Lett. 11, 526–535 (2006).
Article CAS PubMed PubMed Central Google Scholar
Streitner, C. et al. An hnRNP-like RNA-binding protein affects alternative splicing by in vivo interaction with transcripts in Arabidopsis thaliana. Nucleic Acids Res. 40, 11240–11255 (2012).
Article CAS PubMed PubMed Central Google Scholar
Staiger, D., Zecca, L., Kirk, D. A. W., Apel, K. & Eckstein, L. The circadian clock regulated RNA-binding protein AtGRP7 autoregulates its expression by influencing alternative splicing of its own pre-mRNA. Plant J. 33, 361–371 (2003).
Article CAS PubMed Google Scholar
Steffen, A., Elgner, M. & Staiger, D. Regulation of flowering time by the RNA-binding proteins AtGRP7 and AtGRP8. Plant Cell Physiol. 60, 2040–2050 (2019).
Article CAS PubMed Google Scholar
Chen, D., Yan, W., Fu, L. Y. & Kaufmann, K. Architecture of gene regulatory networks controlling flower development in Arabidopsis thaliana. Nat. Commun. 9, 4534 (2018).
Article PubMed PubMed Central Google Scholar
Yant, L. et al. Orchestration of the floral transition and floral development in Arabidopsis by the bifunctional transcription factor APETALA2. Plant Cell 22, 2156–2170 (2010).
Article CAS PubMed PubMed Central Google Scholar
Schiefner, A., Walser, R., Gebauer, M. & Skerra, A. Proline/alanine-rich sequence (PAS) polypeptides as an alternative to PEG precipitants for protein crystallization. Acta Crystallogr. F 76, 320–325 (2020).
Article CAS Google Scholar
Protter, D. S. W. et al. Intrinsically disordered regions can contribute promiscuous interactions to RNP granule assembly. Cell Rep. 22, 1401–1412 (2018).
Article CAS PubMed PubMed Central Google Scholar
Lin, Y. & Fang, X. Phase separation in RNA biology. J. Genet. Genomics 48, 872–880 (2021).
Article CAS PubMed Google Scholar
Alberti, S., Gladfelter, A. & Mittag, T. Considerations and challenges in studying liquid–liquid phase separation and biomolecular condensates. Cell 176, 419–434 (2019).
Article CAS PubMed PubMed Central Google Scholar
Patel, S. B. & Bellini, M. The assembly of a spliceosomal small nuclear ribonucleoprotein particle. Nucleic Acids Res. 36, 6482–6493 (2008).
Article CAS PubMed PubMed Central Google Scholar
Yan, Q., Xia, X., Sun, Z. & Fang, Y. Depletion of Arabidopsis SC35 and SC35-like serine/arginine-rich proteins affects the transcription and splicing of a subset of genes. PLoS Genet. 13, e1006663 (2017).
Article PubMed PubMed Central Google Scholar
Day, I. S. et al. Interactions of SR45, an SR-like protein, with spliceosomal proteins and an intronic sequence: insights into regulated splicing. Plant J. 71, 936–947 (2012).
Article CAS PubMed Google Scholar
Xing, D., Wang, Y., Hamilton, M., Ben-Hur, A. & Reddy, A. S. Transcriptome-wide identification of RNA targets of Arabidopsis SERINE/ARGININE-RICH45 uncovers the unexpected roles of this RNA binding protein in RNA processing. Plant Cell 27, 3294–3308 (2015).
Article CAS PubMed PubMed Central Google Scholar
Theissen, G., Melzer, R. & Rumpler, F. MADS-domain transcription factors and the floral quartet model of flower development: linking plant development and evolution. Development 143, 3259–3271 (2016).
Article CAS PubMed Google Scholar
Cho, W. K. et al. Mediator and RNA polymerase II clusters associate in transcription-dependent condensates. Science 361, 412–415 (2018).
Article CAS PubMed PubMed Central Google Scholar
Fang, X. F. et al. Arabidopsis FLL2 promotes liquid–liquid phase separation of polyadenylation complexes. Nature 569, 265–269 (2019).
Article CAS PubMed PubMed Central Google Scholar
Zhang, Y. L., Li, Z. K., Chen, N. Z., Huang, Y. & Huang, S. J. Phase separation of Arabidopsis EMB1579 controls transcription, mRNA splicing, and development. PLoS Biol. 18, e3000782 (2020).
Article CAS PubMed PubMed Central Google Scholar
Livi, C. M., Klus, P., Delli Ponti, R. & Tartaglia, G. G.catRAPID signature: identification of ribonucleoproteins and RNA-binding regions. Bioinformatics 32, 773–775 (2016).
Article CAS PubMed Google Scholar
Walia, R. R. et al. RNABindRPlus: a predictor that combines machine learning and sequence homology-based methods to improve the reliability of predicted RNA-binding residues in proteins. PLoS ONE 9, e97725 (2014).
Article PubMed PubMed Central Google Scholar
Yan, J. & Kurgan, L. DRNApred, fast sequence-based method that accurately predicts and discriminates DNA- and RNA-binding residues. Nucleic Acids Res. 45, e84 (2017).
PubMed PubMed Central Google Scholar
Kumar, M., Gromiha, M. M. & Raghava, G. P. Prediction of RNA binding sites in a protein using SVM and PSSM profile. Proteins 71, 189–194 (2008).
Article CAS PubMed Google Scholar
Paiz, E. A. et al. Beta turn propensity and a model polymer scaling exponent identify intrinsically disordered phase-separating proteins. J. Biol. Chem. 297, 101343 (2021).
Article CAS PubMed PubMed Central Google Scholar
Yang, H., Lu, P., Wang, Y. & Ma, H. The transcriptome landscape of Arabidopsis male meiocytes from high-throughput sequencing: the complexity and evolution of the meiotic process. Plant J. 65, 503–516 (2011).
Article CAS PubMed Google Scholar
Lu, K. et al. qPrimerDB: a thermodynamics-based gene-specific qPCR primer database for 147 organisms. Nucleic Acids Res. 46, D1229–D1236 (2018).
Article CAS PubMed Google Scholar
Wang, J. et al. The PHD finger protein MMD1/DUET ensures the progression of male meiotic chromosome condensation and directly regulates the expression of the condensin gene CAP-D3. Plant Cell 28, 1894–1909 (2016).
Article CAS PubMed PubMed Central Google Scholar
Shen, S. et al. rMATS: robust and flexible detection of differential alternative splicing from replicate RNA-seq data. Proc. Natl Acad. Sci. USA 111, 5593–5601 (2014).
Article Google Scholar
Choudhary, B., Marx, O. & Norris, A. D. Spliceosomal component PRP-40 is a central regulator of microexon splicing. Cell Rep. 36, 109464 (2021).
Article CAS PubMed PubMed Central Google Scholar
Pang, T. L. et al. Comprehensive identification and alternative splicing of microexons in Drosophila. Front. Genet. 12, 642602 (2021).
Article CAS PubMed PubMed Central Google Scholar
Trincado, J. L. et al. SUPPA2: fast, accurate, and uncertainty-aware differential splicing analysis across multiple conditions. Genome Biol. 19, 40 (2018).
Article PubMed PubMed Central Google Scholar
Bailey, T. L., Johnson, J., Grant, C. E. & Noble, W. S. The MEME Suite. Nucleic Acids Res. 43, W39–W49 (2015).
Article CAS PubMed PubMed Central Google Scholar
Seo, M., Lei, L. & Egli, M. Label-free electrophoretic mobility shift assay (EMSA) for measuring dissociation constants of protein–RNA complexes. Curr. Protoc. Nucleic Acid Chem. 76, e70 (2019).
Article PubMed Google Scholar
Mermaz, B., Liu, F. Q. & Song, J. RNA immunoprecipitation protocol to identify protein–RNA interactions in Arabidopsis thaliana. Methods Mol. Biol. 1675, 331–343 (2018).
Article CAS PubMed Google Scholar
Hu, C. D., Chinenov, Y. & Kerppola, T. K. Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation. Mol. Cell 9, 789–798 (2002).
Article CAS PubMed Google Scholar
Wang, J. et al. Cell-type-dependent histone demethylase specificity promotes meiotic chromosome condensation in Arabidopsis. Nat. Plants 6, 823–837 (2020).
Article CAS PubMed Google Scholar
Fiil, B. K., Qiu, J. L., Petersen, K., Petersen, M. & Mundy, J. Coimmunoprecipitation (co-IP) of nuclear proteins and chromatin immunoprecipitation (ChIP) from Arabidopsis. CSH Protoc. 2008, prot5049 (2008).
Google Scholar
Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589 (2021).
Article CAS PubMed PubMed Central Google Scholar
Liu, Q., Liu, Y., Li, Q., Qian, W. & Zhang, X. Determining the phase separation characteristics of plant proteins. Curr. Protoc. 1, e237 (2021).
Article CAS PubMed Google Scholar
Zeng, L. P. et al. Resolution of deep angiosperm phylogeny using conserved nuclear genes and estimates of early divergence times. Nat. Commun. 5, 4956 (2014).
Article CAS PubMed Google Scholar
Zahn, L. M. et al. The evolution of the SEPALLATA subfamily of MADS-box genes: a preangiosperm origin with multiple duplications throughout angiosperm history. Genetics 169, 2209–2223 (2005).
Article CAS PubMed PubMed Central Google Scholar
Kumar, S., Stecher, G. & Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874 (2016).
Article CAS PubMed PubMed Central Google Scholar
Hu, B. et al. GSDS 2.0: an upgraded gene feature visualization server. Bioinformatics 31, 1296–1297 (2015).
Article PubMed Google Scholar
Chen, C. J. et al. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 13, 1194–1202 (2020).
Article CAS PubMed Google Scholar
Zhou, S. Y., Chen, Y. M., Guo, C. C. & Qi, J. PhyloMCL: accurate clustering of hierarchical orthogroups guided by phylogenetic relationship and inference of polyploidy events. Methods Ecol. Evol. 11, 943–954 (2020).
Article Google Scholar
Kwon, S. C. et al. The RNA-binding protein repertoire of embryonic stem cells. Nat. Struct. Mol. Biol. 20, 1122–1130 (2013).
Article CAS PubMed Google Scholar
Wellmer, F., Riechmann, J. L., Alves-Ferreira, M. & Meyerowitz, E. M. Genome-wide analysis of spatial gene expression in Arabidopsis flowers. Plant Cell 16, 1314–13126, (2004).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank the core facility in Huck Institutes of the Life Sciences at the Pennsylvania State University for providing the confocal microscope and other services. We thank Y. Huang, D. Wei and C. Xu of Pennsylvania State University for support with materials and equipment. We thank X. Chen of Peking University; W. Huang, G. Zhang and T. Zhang of Pennsylvania State University; and L. Sun of Nanjing Forest University for helpful discussions. This work was supported by funds from the Eberly College of Science and the Huck Institutes of the Life Sciences, Pennsylvania State University.

Author information

Authors and Affiliations

Department of Biology, Eberly College of Science, Huck Institutes of the Life Sciences, Pennsylvania State University, University Park, PA, USA
Jun Wang, Xinwei Ma, Yi Hu, Guanhua Feng & Hong Ma
Jiangxi Provincial Key Laboratory for Bamboo Germplasm Resources and Utilization, Forestry College, Jiangxi Agricultural University, Nanchang, China
Chunce Guo
Department of Chemistry and Department of Biochemistry and Molecular Biology, Eberly College of Science, Pennsylvania State University, University Park, PA, USA
Xin Zhang

Authors

Jun Wang
View author publications
You can also search for this author in PubMed Google Scholar
Xinwei Ma
View author publications
You can also search for this author in PubMed Google Scholar
Yi Hu
View author publications
You can also search for this author in PubMed Google Scholar
Guanhua Feng
View author publications
You can also search for this author in PubMed Google Scholar
Chunce Guo
View author publications
You can also search for this author in PubMed Google Scholar
Xin Zhang
View author publications
You can also search for this author in PubMed Google Scholar
Hong Ma
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

H.M. supervised and designed the study. J.W., X.M., Y.H., G.F. and C.G. performed the experiments. J.W. analysed the data. X.M., X.Z. and H.M. discussed and commented on the study. J.W. and H.M. wrote the paper.

Corresponding author

Correspondence to Hong Ma.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Plants thanks Daniel Slane and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data

Extended Data Fig. 1 The prediction of an RNA-binding domain and highly disordered domain in GRP20.

a, The four prediction programs used for the RNA-binding prediction. The basic algorithms are shown in the table. b, The RNA binding propensity of GRP20 from catRAPID. The propensity ≥ 0.5 indicates potential RNA-binding ability, identifying the region with residue 92 to 115 as an RNA binding domain (highlighted by pink background). The overall interaction score of GRP20 is 0.54 (≥0.5), indicating that GRP20 is a putative RNA binding protein. c, The prediction of classification of the potential RNA-binding domain in GRP20 by catRAPID. The program divides potential RNA-binding proteins into three categories: classical, non-classical and putative according to propensity values⁷⁹. The scores ≥ 0.5 reflects the propensity to be associated with one of the categories. The results indicate that the score of GRP20 is highest (0.72) for a non-classical RNA-binding protein and above threshold (0.59) for a putative RNA-binding protein, but not enough for a classic RNA-binding protein. d, RNA-binding propensity of GRP20 predicted by RNAbindPlus. The propensity ≥ 0.1 indicates potential RNA-binding residues in GRP20, in two regions: residue 20 to 30, and residue 96 to 116 (highlighted by pink). e, f, The prediction of core residues in GRP20 for RNA binding by DRNApred (e) and PPRlnt (f) programs. Each dot represents an amino acid. The amino acids with high probability for binding are indicated for the putative RNA-binding region (residue 92 to 116, highlighted by pink). The cutoff used in the two programs are 0.5 and −0.25, respectively. g, The GRP20 amino acid sequence, with the putative RNA-binding region (blue underlined) and key amino acids for RNA binding (Red letters: predicted by either predictor in e and f; Green letters: predicted by both predictors in e and f). h, The GRP20 gene structure with positions of two T-DNA insertion grp20 mutations (the triangles above gene structure). i, The relative expression of GRP20 in two grp20 alleles compared to WT by RT-qPCR. The expression level of GRP20 is normalized to WT being set as ‘1’. Two-sided Student’s t test. Data are presented as mean ± SE from three biological replicates. j, Vegetative growth between WT and two grp20 mutants. Some siliques are shorter, suggesting that the mutation of GRP20 affected fertility. Yellow arrows indicate short siliques. Bar = 10 cm.

Source data

Extended Data Fig. 2 Analyses of pre-mRNA splicing in grp20 flowers and leaves, as compared to WT.

a, Illustrations of categories of splicing defects observed in this study. The categories are exon skipping (ES); alternative 3’ splicing site (A3SS); alternative 5’ splicing site (A5SS), alternative mutually exclusive exon (aMXE), and alternatively spliced intron (ASI), including intron retention (IR), delayed intron degradation (DID), and alternative exon (AE) inside an intron. The blue and red rectangles represent normal exons, yellow rectangles represent abnormal exonic sequences, and the white rectangles represent introns. b, Numbers of genes/transcripts with ASI and aMXE splicing defects in the flower-specific group and the overlapping group between flower and leaf. c, Numbers of genes/transcripts with ASI and aMXE splicing defects in the leaf-specific group and the overlapping group between leaf and flower. d, A heatmap of defective types and significance of each gene in flowers and leaves. P-values are categorized to two groups: p < 0.01 (blue) and 0.01 ≤ p < 0.05 (dark blue) (a likelihood-ratio test with 95% confidence intervals). The splicing defects are categorized into five groups including ES (light red), A3SS (yellow), A5SS (light green), aMXE (gray), and ASI (light purple). Among the splicing defects specifically detected in floral transcripts, ASI and ES are more frequent than other types. e, A Venn diagram of the overlap between genes in different GO categories. 64 genes in flower development (including petal development, ovule development and floral organ formation), morphogenesis structure and meristem development are highly enriched in defective transcripts in grp20 flowers. f, A Venn diagram of the overlap between defective transcription factor families and enriched defective transcription factor families in flower specific (blue circle), in flower and leaf overlapping (red circle), and in leaf specific (purple circle) groups. g-i, Fractions of all annotated transcription factors containing abnormal transcripts to all transcription factors in the same family in grp20 flower specific (g), leaf specific (h), and flower and leaf overlapping groups (i). The enrichment is compared to referenced fractions of transcription factors in each family to all 1,717 transcription factors. The enriched defects in flower and leaf are defined if the defective fraction is more than referenced fraction. Two asterisks (**) indicate enrichment of defects in corresponding transcription factor family if the defective fraction is more than twice of reference fraction.

Extended Data Fig. 3 A summary of reads corresponding to wild-type and alternative transcripts in WT and grp20 flowers for micro exon skipping and other defects.

Illustrations of gene structures, transcripts and reads for floral homeotic MADS-box genes, AP2 and CYCH;1 including micro exons. The blue structure is gene structure, and grey structures are the transcripts in WT and grp20 flowers. Most exons are shown as blue boxes and introns as blue lines between exons; skipped micro exons in grp20 are highlighted as red boxes and other micro exons as brown boxes. The yellow bars represent reads (with thin lines for sequences that were absent) supporting the normal and abnormal transcripts. The × plus number near a transcript represents the read counts mapped to the affected region(s) supporting this transcript. The reads for MADS-box transcripts lacking the micro exons were observed in grp20 flowers, but not in the WT. For example, there are 47 reads supporting the wild-type AP1 transcript T1 in WT (× 47), but no WT reads supporting alternative transcripts; therefore, × 0 is omitted and the percentage of reads only observed in mutants is 0%. In grp20 flowers, there are 42 reads supporting wild-type T1 (× 42); however, there are another 8 reads (× 8) supporting an alternative transcript T2, with the second micro exon skipped. Therefore, the percentage of alternative transcript is 16%. T1 and T2 in black represent wild-type transcripts that could be observed in WT. T2 and T3 in red represent alternative transcripts that only could be observed in grp20 mutants. T2* in black in SEP3 represents a transcript in WT with ~5% detection; in contrast, this transcript had substantially increased percentage in grp20 flowers (~37%). ‘I’ indicates intron, ‘M’ indicates micro exon, ‘E’ represents exons, and ‘A3’ represents alternative 3’ site. The number indicates the order of the affected exon or intron. For example, M2 indicates the second micro exon in this gene. E6 indicates the sixth exon in this gene. I1 indicates the first intron in this gene. M2/E6 indicates the affected exon is both the second micro exon and sixth exon. The ES, ASI and A3SS defective regions are highlighted, respectively, by light blue, light pink and light green. The black lines under the gene structure indicate the regions amplified by primers used in qRT-PCR.

Extended Data Fig. 4 Transcriptomic analyses in WT and grp20 flowers and leaves, and the comparison of DEGs in grp20 and floral homeotic mutant flowers.

a, The illustration of splicing defect types for floral homeotic genes, LOB domain genes, Auxin responsive factor (ARF) family genes, and cell division genes; the splicing defect types are indicated with red (ES), green (A5SS), yellow (A3SS), and purple [ASI (IR and AE)]. b, The illustration of wide defects of environmental response in grp20. c, Pearson correlation coefficient values of all three replicates in RNA-seq in WT and grp20. The red colors indicate high levels of correlation, with > 0.9 values for biological replicates of the same tissue. d, Differentially expressed genes (DEGs) in WT and grp20-1 flowers. The expression of GRP20 is indicated by a short line. The numbers of down-regulated and up-regulated genes in grp20-1 flowers are shown at the top right. There are ~2% differential genes in grp20 flowers, unlike the relatively large number of differential genes (1,000-2,000) affected by floral homeotic mutants⁸⁰. e, The relative expression of flower developmental genes in WT and grp20-1 flowers by RT-qPCR. Genes include floral homeotic MADS-box genes (AP1 to PI), AP2, LOB domain genes (AS2 to LOB), and other flower developmental genes (SUPERMAN, OBO1, ARF1 to ETT). The expression levels were normalized to WT being ‘1’. The expression of GRP20 is greatly reduced in the mutant as expected. The expression levels of known floral regulatory genes were not significantly different between the wild-type and grp20 flowers, except for LOB DOMAIN 3 (LBD3). The experiments are conducted with three independent replicates and two-sided Student’s t test is used for statistics. Data are presented as mean ± SEM. f, Differentially expressed genes (DEGs) in WT and grp20-1 leaves. The expression of GRP20 is indicated by a short line. For d and f, the X-axis is log₂(fold-change of [grp20-1 to WT]) and Y-axis is log₁₀(q-value). The cut-off for DEGs is log₂(fold-change) ≥ 1 or log₂(fold-change) ≤ -1 (vertical green dash lines) and q-value < 0.05 (horizontal green dash line). The numbers of down-regulated and up-regulated genes in grp20-1 leaves are shown at the top right.

Source data

Extended Data Fig. 5 The micro exons and small exons in alternative transcripts in grp20 flowers and leaves.

a, b, Venn diagrams of the overlap among 211 genes with exon skipping in grp20 flowers (a) or 226 genes with exon skipping in grp20 leaves (b), and numbers of Arabidopsis genes containing small exons (51-100 nucleotides) and micro exons with lengths (inclusive) of 26-50 nucleotides, or ≤ 25 nucleotides, respectively. Totally 114 genes in grp20 flowers and 69 genes in grp20 leaves with exon skipping overlap with the above two groups of genes containing micro exons ≤ 50 nucleotides. A total of 48 genes in grp20 flowers and 140 genes in grp20 leaves with exon skipping overlap with the group containing small exons. The data suggested the idea that small exons and micro exons are important gene-structural elements in plant genomes. c, d, Venn diagrams of overlaps for skipped micro exon (c) and skipped small exon (d) in flowers and/or leaves. e, Heatmaps of copy number with all referenced orthogroups and defective orthogroups including micro exons and small exons in grp20 flowers and leaves among thirteen angiosperms (Arabidopsis to Amborella). Protein ubiquitination and degradation genes (UBP15 and PBC1), drought responsive proteins (DI19), epigenetic factor (BONSAI (BNS)) and meiotic gene (RAD50) are found in the small exon skipping in flowers. In addition, responsive factors to GA (vacuolar sorting protein), JA (NINJA), high light (DEG5) and cold (PFC1), regulators for leaf morphology (BLH4, ANU7, ACA4 and others), protein modification genes (MEKK1 and other kinases, and PUB9 and other U-box proteins), transcription factors (AGL31, AGL42, NF-YA7 and others), cell death inducer (ACD6), epigenetic regulators (methyltransferases) and polypyrimidine tract binding protein (PTB1) were also observed in affected small exons in leaves. f, Gene structures of AP1 and AP2 homologues among representative angiosperms. On the left are the phylogenetic relationships of selected angiosperm AP1 and AP2 homologs, respectively, and on the right part are the corresponding gene structures. The elliptical boxes indicate exons, and the thin lines represent introns. Red and green highlight micro exons (M1, M2 and M3), with M2 (red) being skipped in grp20 mutants. Gene structure comparison indicates the skipped micro exons are conserved in angiosperms and are linked by light red lines. Intron sizes are not to scale.

Extended Data Fig. 6 Floral phenotypes in WT, grp20, and the complementation plants (ProGRP20::GRP20-YFP; grp20), and flower phenotypes of double mutants between GRP20 and floral homeotic genes or LOB domain gene.

a, Sepal and carpel defects in grp20 mutants and complementation lines. WT flowers show normal organ number and morphology. Flower defects are shown in grp20-1 including in the left panel, the white asterisk indicates a floral bud at the position of a sepal in grp20-1; a white arrow in the middle panel indicates an unfused carpel in grp20-1 and yellow arrows in the right panel indicate an extra sepal and petal, respectively. Flower defects were shown in grp20-2 including an extra sepal (indicated by an orange arrow; total 5) and a curved carpel (indicated by a white arrow) are shown in the left and middle panels, respectively; an extra sepal and extra petal (total 5 sepals and 5 petals) in the right panel are indicated by orange arrows. Normal flowers are shown in Pro_GRP20::GRP20-YFP;grp20 complementation line. Bar = 1 mm. The yellow letter and number at top right of each panel indicate corresponding organ and number in the flower. Se: Sepal; P: Petal. The white number indicates sepal count in a flower. b, Scanning electron microscope (SEM) images of floral phenotypes in WT (left) and grp20-1 (right). An extra stamen is indicated by an orange arrow in the left panel in grp20-1. Fused anthers and petals are indicated by the orange asterisks in the middle panel and the right panel, respectively in grp20-1. The positions of missing stamens are indicated by dashed orange arrows in the right panel in grp20-1. Bar = 20 μm. c, Petal length, width, and top angle in WT, grp20 and complementation lines. Petal length (pl), width (pw) and top angle (α) are indicated by the orange double arrowed line, pink double arrowed line, and light green angle α, respectively. Bar = 100 μm. d, Reduced pl in grp20-1: (difference of pl in WT and grp20-1)/(average pl in WT) = (0.98-0.84) mm /0.98 mm = 14%. Flower counts for petal length: WT, 15; grp20-1, 18; and Pro_GRP20::GRP20-YFP grp20, 18. Slightly reduced petal width in WT, grp20 and complementation plants. Flower counts for petal width: WT: 16, grp20-1: 20 and Pro_GRP20::GRP20-YFP; grp20: 18. Reduced top angle α in grp20-1. (Reduced α in grp20-1)/(average α in WT)= (140-83)/ 140 = 40%. Flower counts: WT: 16; grp20-1: 15; Pro_GRP20::GRP20-YFP;grp20: 15. two-sided Student’s t test is used for statistics; The lower bound, maxima, minima, centre and upper bound of box plots (from left to right) is shown as: For pl: WT: 1.36, 1.41, 1.29, 1.375, 1.39; grp20-1: 1.105,1.24, 1.04, 1.2, 1.225; GRP20-YFP (grp20): 1.33, 1.43, 1.28, 1.36, 1.39. For pw: WT: 0.41, 0.46, 0.39, 0.42, 0.43; grp20-1: 0.39, 0.42, 0.38, 0.41, 0.42; GRP20-YFP (grp20): 0.42, 0.46, 0.39, 0.43, 0.435. For top angle α: WT: 136, 152, 132, 83.6, 92; grp20-1: 75, 101, 72, 83.6, 92; GRP20-YFP (grp20): 134.25, 154, 132, 146, 148.75. e, Stamen phenotypes in grp20 mutants. f, Petal morphologies in grp20 mutants. g, Carpel phenotypes in grp20 mutants. Bar = 300 μm. h, Western blot analysis of GRP20-YFP in two complementation lines (C1 and C2) with the Pro_GRP20::GRP20-YFP transgene in grp20. A GFP antibody was used against whole cell lysate from transgenic flowers. i, Mature flowers of double mutants between grp20 and homeotic mutants ap1-1, ap2-1 and LOB domain mutant lbd7-1. The yellow arrows indicate extra stamen in grp20-1 and grp20-1 lbd7-1. The asterisks indicate chimeric organs in ap1-1, grp20-1 ap1-1, ap2-1 and grp20-1 ap2-1. The double mutants grp20-1 ap1-1, grp20-1 ap2-1 and grp20-1 lbd7-1 show more severe floral organ defects including various organ numbers compared to single mutants. Bar = 1 mm.

Source data

Extended Data Fig. 7 The comparison of DEGs in grp20 and floral homeotic mutants.

a-c, Venn diagrams of potential target genes of A function AP1 or AP2 proteins (a), B function AP3 or PI proteins (b) and C (AG) and E function (SEP3 and SEP4) proteins (c). d, A Venn diagram of the overlap among potential targets of ABCE (AP1, SEP4, SEP3, AG, AP3 and PI) proteins. Total 9279 genes might be putative targets of ABCE MADS-box genes. e, A Venn diagram of the overlap between the potential ABCE (AP1, SEP4, SEP3, AG, AP3, and PI) target genes and down-regulated genes in grp20 flowers. 40% (87/217) of down-regulated genes in grp20 flowers among putative MADS-box protein targets. f, A Venn diagram of the overlap between potential AP2 target genes and up-regulated genes in grp20. 12% (59/493) of up-regulated genes in grp20 flowers among putative AP2 targets. AP1, AP3, PI, AG, SEP3, and SEP4 are known positive regulators of gene expression; however, AP2 is a known negative regulator in gene expression for flower development.

Extended Data Fig. 8 Evolutional analyses of transcripts including micro exon and small exon skipping, and in vitro binding between pre-mRNA or RNA motifs and GRP20.

a, Illustrations of GRP20 constructs for expressing full-length GRP20 and recombinant proteins with the RBD mutation with five amino acids (M102A, W103A, Y105A, K106A, and K107A; RBDm) or deletion of HDR or deletion of RBD. b, The consensus motifs and percentages found in defective transcripts, with ES, A3SS, A5SS or ID defects. ES_C2, A3SS and A5SS correspond to RNA probe 2, 3, and 4, respectively, used for RNA binding. A5SS and ID_C2 are the second most frequent consensuses in grp20; A3SS: Abnormal 3’ splicing site; A5SS: abnormal 5’ splicing site. c, The consensus motifs and percentages found in defective micro exons and small exons in grp20 flowers and leaves. GA-rich [poly(R)] is enriched in affected micro and small exons. d, The RNA motifs related to micro exons and affected protein domain in MADS-box proteins and AP2. M1, M2 and M3 indicate micro exons. Y indicates the presence and N indicates the absence of GA-rich motifs in micro exons; X indicates lack of the micro exon. An asterisk in the row for SEP3 indicates the micro exon is skipped in an alternatively spliced transcript in WT at ~5%; however, the number of reads supporting this ES transcript is notably increased in grp20 flowers. e, GA-rich motifs in affected micro-exons, as indicated by underline, with G and A residues in the motif highlighted in red. p-values were calculated by using MEME program with the test method named Expectation-Maximization algorithm, and are highly significant. f, The protein alignment of α-helix 2 in K domain encoded by affected micro-exons. Asterisks indicate the conserved key amino acid for protein tetramerization. The red asterisk indicates the most important amino acid for tetramerization formation by SEP3. g, In vitro binding of the AP3 pre-mRNA by recombinant GRP20 using RNA EMSA. The free RNA and shifted RNA with protein are indicated. ++ indicates double the amount of input proteins (+). h, In vitro binding test of the ACTIN7 pre-mRNA by GRP20 using RNA EMSA; the band is free RNA, indicating no detected binding. The AP3 and ACTIN7 pre-mRNA were synthesized by T7 in vitro transcription using the genomic DNAs of the corresponding gene as the template. The gels were stained by the SYBR Green fluorescent dye for RNA. i, The P1 to P4 probes correspond to 4 consensuses identified in the genes with splicing defects (P1: ES_C1; P2: ES_C2; P3: A3SS and P4: A5SS corresponding to Fig. 7b and Extended Data Fig. 8b). j, In vitro binding of the P1 to P4 probes by GRP20. The same amount of GRP20 proteins (17 ug) and the same amount of RNA probe (400 fmol) were added to each reaction system. The bottom bands are free RNAs, and the upper bands are shifted RNAs. GRP20 was able to bind to each of the four probes, with relatively strong binding to P1 and weak binding to P4.

Source data

Extended Data Fig. 9 GRP20 condensates in Arabidopsis and tobacco cells, and HDR is required for flower development and condensate formation.

a, The disorder confidence score along the GRP20 protein predicted by Phyre2. There are two highly disordered regions (60%-100%) in GRP20, one near the N-terminus (residue 15 to 25, a region with positive charge) and highlighted by light green; the other is the C-terminal region (residue 119 to 153, highly disordered region, HDR) and highlighted by light blue. b, Illustration of GRP20 protein structures for various transgenic constructs. c-e, Analyses of different transgenic plants with HDR constructs, as shown in Extended Data Fig. 9b. (c) Comparison of protein expression level in transgenic plants, using Western blot with antibodies against GFP and the same amount of input flower proteins indicated by antibodies against β-Tubulin. The GRP20ΔHDR transgenic plants expressed the GRP20 protein at a level higher than that in the wild-type. (d) Flower phenotypes in transgenic plants as labeled at the top. Yellow letters and numbers at the right top of each panel indicate the organ and corresponding number. P: Petal; S: Stamen. Bar = 1 mm. (e) Floral organ numbers in transgenic plants. Flower counts: Pro_GRP20::GRP20-YFP grp20, 30; Pro_GRP20::GRP20ΔHDR-YFP grp20, 30 and grp20-1, 26. Data are presented as mean ± SD. Two-sided Student’s t test. f, The GRP20 condensates in Arabidopsis petal nuclei in complementation lines. The nuclei were stained by DAPI. The condensates are indicated by yellow arrows. BF: Bright field. The bottom right panel is a magnified image of red boxed area in the top left panel. Bar= 5 μm. g, GRP20 condensates in a tobacco leaf cell following transient transformation. The nucleus is also stained by DAPI. Red arrows indicate some of nuclear condensates and yellow arrows indicate some of the condensates in the cytosol. Bar= 5 μm. h, The liquid fluidity of GRP20 condensates tested by photo-bleaching in tobacco cells. The YFP fluorescent signal was recorded from 0 second(s) to 180 s. The YFP condensates were bleached by 100% 514 nm laser from 7 to 11 s after the start of recording. Red arrows mark the positions of strong YFP fluorescence signals, yellow arrows indicate weak YFP signals (following bleaching), and white arrows indicate the positions corresponding to the pre-bleach YFP signals. i, Fluorescence intensity recovery of YFP signals from the experiments shown in Extended Data Fig. 9h. HDR: highly disordered region. The intensity data are shown by mean ± SD from 15, 10 and 20 condensates for GRP20-YFP, GRP20ΔHDR-YFP, and HDR-YFP, respectively. Bar= 10 μm. j, Condensate formation of various GRP20 proteins with/without deletion of HDR, HDR alone, or RBD mutations, respectively, in tobacco leaf epidermal cells. The condensates were detected in GRP20-YFP, HDR-YFP, and GRP20 (RBDm)-YFP, the signal from GRP20ΔHDR-YFP was relatively even, without obvious condensate. Results support the idea that HDR is necessary and sufficient for condensate formation, but RBD is not necessary to condensate formation. The yellow arrow indicates the nucleus, and the white arrow indicates the condensate, respectively. Bar= 5 μm.

Source data

Extended Data Fig. 10 The interaction between GRP20 and spliceosome in the condensates depending on HDR.

a, The spliceosome U5 subunits identified by IP-MS. b, The quantification of YFP signals in the nucleus of tobacco leaves in Fig. 8b. The fraction of YFP intensity to DAPI intensity for a single nucleus was estimated. The data were presented as mean ± SD from 26 or 27 nuclei for each transient experiment indicated in each column. PC: positive control. c, Co-IP of GRP20 and Prp18 from Arabidopsis. GRP20-YFP and Prp18-FLAG fusion proteins driven by the CaMV-35S promoter were co-expressed in Arabidopsis. Seedlings from such transgenic plants were used to extract nuclear proteins for immunoprecipitation using GFP antibody-conjugated agarose beads. The pre-IP and IP samples were analyzed by immunoblotting using antibodies against FLAG and GFP, separately. Arabidopsis co-expressing GFP and Prp18-FLAG driven by the 35 S promoter was used as a negative control. The pre-IP sample using an antibody against Histone 3 was the loading control. d, The band intensity of Prp18-GST in His pull-down experiments for GRP20, GRP20ΔHDR and HDR in Fig. 8c. His-sumo is a negative control. Nearly none of Prp18 was captured by GRP20ΔHDR and 40% of Prp18 was captured by HDR, compared to full-length GRP20. The experiments are conducted by three independent replicates with similar results. The data were presented as mean ± SEM. e, The fluorescent intensity of Prp18-RFP and GRP20-YFP estimated in the drawing line across the nucleus (left to right distance shown in the X-axis) in Fig. 8d by Image J. The data suggested that Prp18-RFP and GRP2-YFP are co-localized in the nuclei and have stronger co-localization in three condensates in the nucleus indicated by black arrows. f, The condensate formation in the nucleus showing interactions between GRP20 and Prp18 by BiFC assay. The MMD1 and JMJ16 were used as a control that do not form condensates under interaction. The yellow arrows indicate condensates in the tobacco nuclei when GRP20-YFPn interacts with Prp18-YFPc. The fluorescent intensity of YFP after interactions in the right panel was estimated by drawing red lines across the nucleus (left to right distance shown in the X-axis) in the left panel. YFP signals represented positive interaction. Two obvious peaks indicated by black arrows were observed in the interaction nucleus of GRP20 and Prp18 suggesting two condensates, however, none of peaks (condensates) were observed in positive interacting nucleus. Two-sided Student’s t test is used for statistics in 10b and 10d.

Source data

Supplementary information

Supplementary Information

Supplementary Figs. 1–7 and uncropped scans of blots and gels in the Supplementary Figs. 4b, 5b,d and 7a.

Reporting Summary

Supplementary Tables

Supplementary Tables 1–7. The title and descriptive captions for each table have been included in the file itself.

Supplementary Data

Statistical source data for Supplementary Figs. 2c,d, 3c,f, 4a, 5g and 6b,e–h.

Source data

Source Data Fig. 2

Statistical source data for Fig. 2e,f.

Source Data Fig. 3

Statistical source data for Fig. 3a,j.

Source Data Fig. 6

Unprocessed western blots and gels for Fig. 6c.

Source Data Fig. 7

Unprocessed western blots and gels for Fig. 7d.

Source Data Fig. 8

Unprocessed western blots and gels for Fig. 8a,c.

Source Data Extended Data Fig. 1

Statistical source data for Extended Data Fig. 1i.

Source Data Extended Data Fig. 4

Statistical source data for Extended Data Fig. 4e.

Source Data Extended Data Fig. 6

Statistical source data for Extended Data Fig. 6d.

Source Data Extended Data Fig. 6

Unprocessed western blots and gels for Extended Data Fig. 6h.

Source Data Extended Data Fig. 8

Unprocessed western blots and gels for Extended Data Fig. 8g,h,j.

Source Data Extended Data Fig. 9

Unprocessed western blots and gels for Extended Data Fig. 9c.

Source Data Extended Data Fig. 10

Statistical source data for Extended Data Fig. 10b,d.

Source Data Extended Data Fig. 10

Unprocessed western blots and gels for Extended Data Fig. 10c.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Wang, J., Ma, X., Hu, Y. et al. Regulation of micro- and small-exon retention and other splicing processes by GRP20 for flower development. Nat. Plants 10, 66–85 (2024). https://doi.org/10.1038/s41477-023-01605-8

Download citation

Received: 11 November 2022
Accepted: 29 November 2023
Published: 09 January 2024
Issue Date: January 2024
DOI: https://doi.org/10.1038/s41477-023-01605-8

Subjects

Abstract

Similar content being viewed by others

Main

Results

GRP20 encodes a predicted non-classical RNA-binding protein

GRP20 regulates splicing of genes for development and response

GRP20 regulates micro-exon and small-exon splicing

Identification of putative GRP20 homologues among plants

GRP20 is required for normal floral organ development

GRP20 binds to purine-rich motifs in micro and small exons

GRP20 is able to form condensates

GRP20 interacts with the U5 subunits of the spliceosome

Discussion

Methods

Plant materials and growth conditions

Bioinformatic analyses of GRP20 protein domain

Plant phenotypic analyses

Confocal image analyses

Transcriptomic analyses and qRT-PCR

Analyses of RNA splicing and detection of affected transcripts by RT-qPCR

RNA motif analyses, RNA binding using EMSA and RNA immunoprecipitation

Recombinant protein purification

In vivo and in vitro interaction assay

Plant protein extraction and western blot

Constructs for complementation and GRP20 mutant domains

Protein condensates, fluorescent photo bleaching and the corresponding constructs

Protein domain alignment, conservation analyses and orthogroup searching

Statistics and reproducibility

Reporting summary

Data availability

References

Acknowledgements

Author information

Authors and Affiliations

Contributions

Corresponding author

Ethics declarations

Competing interests

Peer review

Peer review information

Additional information

Extended data

Supplementary information

Source data

Rights and permissions

About this article

Cite this article

Share this article

Search

Quick links