Abstract
Inactivation of the tumour suppressor p53 is the most common defect in cancer cells. p53 is a sequence specific transcription factor that is activated in response to various forms of genotoxic stress to induce cell cycle arrest and apoptosis. Induction of p53 is subjected to complex and strict control through several pathways, as it will often determine cellular fate. The p73 protein shares strong structural and functional similarities with p53 such as the potential to activate p53 responsive genes and the ability to induce apoptosis. In addition to alternative splicing at the carboxyl terminus which yields several p73 isoforms, a p73 variant lacking the N-terminal transactivation domain (ΔNp73) was described in mice. In this study, we report the cloning and characterisation of the human ΔNp73 isoforms, their regulation by p53 and their possible role in carcinogenesis. As in mice, human ΔNp73 lacks the transactivation domain and starts with an alternative exon (exon 3′). Its expression is driven by a second promoter located in a genomic region upstream of this exon, supporting the idea of two independently regulated proteins, derived from the same gene. As anticipated, ΔNp73 is capable of regulating TAp73 and p53 function since it is able to block their transactivation activity and their ability to induce apoptosis. Interestingly, expression of the ΔNp73 is strongly up-regulated by the TA isoforms and by p53, thus creating a feedback loop that tightly regulates the function of TAp73 and more importantly of p53. The regulation of ΔNp73 is exerted through a p53 responsive element located on the ΔN promoter. Expression of ΔNp73 not only regulates the function of p53 and TAp73 but also shuts off its own expression, once again finely regulating the whole system. Our data also suggest that increased expression of ΔNp73, functionally inactivating p53, could be involved in tumorogenesis. An extensive analysis of the expression pattern of ΔNp73 in primary tumours would clarify this issue.
Similar content being viewed by others
Introduction
Physical or functional inactivation of the tumour suppressor p53 is the most common defect in cancer cells.1,2 p53 is a sequence specific transcription factor that is activated in response to various forms of genotoxic stress to induce cell cycle arrest and apoptosis. p53 executes its function inducing genes responsible for cell cycle regulation like p21 or genes promoting apoptosis, e.g. PUMA, noxa and bax.3,4,5,6,7,8 The steady state protein levels of p53 and thus its function are subjected to complex and strict control through several pathways in order to determine the fate of the cell.9 For example, p53 induces MDM2 which in turn promotes the ubiquitin dependent degradation of p53, generating an important feedback loop that controls p53 action.9
The p73 gene was discovered as the first homologue of the tumour suppressor p53.10 The two proteins work as transcription factors and share significant structural similarity, being formed by three highly homologous domains, the N-terminal transactivation (TA) domain, a DNA-binding domain (DBD), and an oligomerisation domain (OD). These structural homologies lead the way for the search of functional similarities; indeed, p73 shows many p53-like features.11,12,13,14,15,16
Despite remarkable structural similarities of the genes, the knockout mice for p53, p63 and p73 display no obvious overlapping features.11 In particular, p73−/− mice show abnormalities in fluid dynamics of the nervous and respiratory systems, defective neurogenesis and abnormal reproductive and social behaviour indicating a role for p73 in the development of the nervous and immune systems.17 Conversely, several lines of evidence suggest its involvement in cancer. Exogenous expression of p73, similarly to p53, induces irreversible cell cycle and growth arrest and promotes apoptosis.10,18,19,20,21,22,23,24,25 Although p73 is not transcriptionally regulated by DNA damage, p73 protein is stabilised by phosphorylation through the c-Abl tyrosine kinase pathway in response to DNA damage.26,27,28 These data support the existence of a rescue pathway mediated by MLH1/c-Abl/p73 which triggers apoptosis following DNA damage, independent from p53. However, unlike p53, and despite its homology to the tumour suppressor gene p53, p73 mutations are extremely rare in human cancers,13,29,30,31 and in contrast to p53 knockouts, p73 knockout mice do not develop spontaneous tumours.17 Still, several reports suggest that an altered expression of this gene rather than its mutation might be involved in cancer.13,16,17,32,33,34,35,36,37,38,39,40,41
In contrast to p53, p73 is expressed as several distinct forms differing either at the C- or at the N-terminus. Indeed, differential splicing of the 3′ end of the gene leads to the expression of several p73 C-terminal splice variants (α to ζ)10,18,42,43 that differ in vitro in their potential to activate p53-responsive genes, such as p21Waf1/Cip1 and BAX, thus showing different functional properties. In addition, in mice two variants with a different N-terminus exist, thought to derive from the usage of two different promoters one located upstream of exon 1 and one located upstream of exon 3′.17 Consequently, full length isoforms contain the transactivation domain (TA forms) and shorter or ΔN isoforms lack this domain introducing additional complexity to the system. The ΔNp73 variants do not activate transcription from p53-responsive promoters and inhibit the full length p73 variant (TAp73)17 acting as dominant negatives. Ectopic expression of these variants in mice was shown to inhibit p53-induced apoptosis and to protect p73−/− neurons from death induced by nerve growth factor (NGF) withdrawal.44 The dominant negative effect is thought to be mediated either by competition through its DBD and/or by hetero-oligomerisation and sequestration through its OD. The differential expression of transcriptionally active (TA) and inactive (ΔN) p73 variants may determine p73 and p53 function within a particular cell type or in a particular phase of cell cycle or differentiation stage. The balance between the two forms might be finely regulated at the transcriptional level via alternative promoter usage. Alteration of the relative amounts of the two isoforms might be extremely important for its function (e.g. its involvement in development and possibly in carcinogenesis). Since the two forms have distinct (if not opposite) functions, it is important to identify them in humans, to clarify their normal expression pattern and functions and to clarify their differential regulation.
Here we describe the cloning and characterisation of the human ΔNp73 variants, and of the second promoter region located in intron 3′. Our results show that p53 and TAp73 regulate ΔNp73 protein levels by binding to the ΔNp73 promoter and inducing its transcription, thus generating a negative feed-back loop that tightly regulates the activity of either TAp73 or p53. ΔNp73 in turn blocks p53 and TAp73 action on its own promoter, further refining the regulation of the whole system. In addition our data suggest that an altered expression of the ΔNp73 isoforms might be oncogenic by creating a functional inactivation of p53.
Results
Cloning of human ΔNp73 isoforms
The p73 gene shows a number of different splice variants clustered at the 3′ end of the gene that result in a number of different C-termini. At least in mice, p73 also shows two different N-termini, one containing (TA forms) and one lacking (ΔN forms) the transactivation domain.17,44 The latter derives from the usage of a different ATG, located in an additional exon (exon 3′), driven by a second promoter (Figure 1A).
In order to clone the human homologues of the mice ΔNp73 isoforms we performed a BLAST search in the genebank database using a sequence from mice exon 3′ (y19235). This search allowed us to identify a genomic clone (AL136528) containing the entire human p73 gene. We were therefore able to design forward primers within human exon 3′ and amplify the entire coding sequence of ΔNp73 α, β and γ [ΔNp73α (AY040827); ΔNp73β (AY040828) ΔNp73γ (AY040829)]. The human ΔNp73 isoforms are highly homologous to the mouse ΔNp73 isoforms (Figure 1B). Interestingly, the sequence of exon 3′ contains two different in frame ATGs and translation can start with either one (Figure 1B). The existence of two different translation start sites is confirmed by in vitro translation of a ΔNp73 construct (Figure 1C) and by Western blot analysis of over-expressed (Figure 1C) and endogenous p73 (Figure 2B). In addition we confirmed the use of both ATGs by in vitro translating ΔNp73 cDNAs in which either one of the two ATGs was mutated, showing that only one protein band was present (Figure 1D).
Fluorescence microscopy of cells transfected with TAp73α and ΔNp73α show that both forms are localised in the nucleus (Figure 2).
Expression pattern of human ΔNp73 isoforms
RT–PCR of the entire open reading frame of p73 using forward primers specific for either TA or ΔN, followed by a nested PCR spanning exons from 8 to 14, shows that mRNA for all C-terminous variants exists as both TA and ΔN variants (Figure 3A). Western blot analysis with an antibody directed against the C-terminus of p73α, that recognises only the α isoforms, shows that ΔN and TAp73 proteins can be detected only in a small subset of different cell lines tested and that with the exception of HaCaT cells, the TA isoforms were the most represented (Figure 3B).
Since it has been previously reported by us and others10,33 that in most tissues and cell lines p73 is expressed at very low levels, we developed a very sensitive quantitative real time RT–PCR to evaluate the expression levels of TA and ΔN isoforms in different tissues and cell lines. Our results summarised in Table 1 show that differently from what was previously reported for mouse p73, in human tissues and cell lines TA isoforms are the most represented. Our results also suggest that foetal tissues express 10-fold more p73 (both TA and ΔN) than the corresponding adult tissues, underlining its important role in development. Interestingly, breast and ovary show the highest expression levels in adult tissues. In all cases TA isoforms are more expressed than ΔN in the same sample.
The expression levels of the ΔN and TA isoforms detected by PCR do not always correspond to those measured by Western (this is particularly evident for Hela and HaCaT cells), suggesting that ΔN proteins might possibly have a longer half life than the corresponding TA forms.
ΔNp73 isoforms function as dominant negatives
Mouse p73 and p63 ΔN isoforms have been shown to act as dominant negatives,11,17,44 thus regulating the activity of the full length family members. In order to show that the human ΔN isoforms we have cloned are also functioning as dominant negatives on p73 and on its homologue p53, we cloned the different ΔN isoforms into a mammalian expression vector (pCDNA-3) under the control of the CMV promoter and performed cotransfection experiments.
As shown in Figure 4, ΔNp73 is capable of blocking the ability of either p73 or p53 to transactivate the p21 promoter in a dose-dependent manner (Figure 4A,B). Experiments were also performed with plasmids expressing ΔN isoforms starting with either of the two ATGs, and similar results were obtained, showing that both forms were able to block p53 and TAp73 induced transcription at comparable levels (data not shown).
We also investigated the ability of ΔNp73 to interfere with a highly important cellular function of p53, namely the ability to induce apoptosis. In fact, ΔNp73 is able to significantly reduce the apoptosis induced by over-expression of TAp73 or p53 when co-transfected into Saos-2 cells (Figure 4C).
The data reported very clearly indicate that ΔNp73 is able to act as a natural dominant negative regulator of p73 and p53.
In order to rule out whether ΔN isoforms block p53 and TAp73 by competing with the binding to DNA or by forming inactive complexes with p53 and TAp73 we produced mutants of the DNA binding domain of both TA and ΔNp73 isoforms. We mutated the same arginine residue in the DNA binding domain into a histidine (R292H for TA; R244H for ΔN). This mutation is known to determine loss of DNA binding activity of TAp73 and p53, transforming them into dominant negatives that inhibit the corresponding wild-type forms.21 Our results show that while both R292H-TAp73 and R244H-ΔNp73 are still capable of inhibiting TAp73 transcription they both lose the ability to interfere with p53 activity (Figure 4D). This result strongly suggests that p53 inhibition is achieved through the competition for the binding to specific responsive elements while p73 is blocked also through a hetero-oligomerisation between the TA and the ΔN forms.
Cloning and characterisation of ΔNp73 promoter
To confirm that the transcription of ΔNp73 isoforms is driven by a different promoter located upstream of exon 3′, we first determined the beginning of the messenger RNA by 5′ race and RNA protection assay (data not shown) and then cloned a genomic fragment upstream of the transcription start site by PCR using primers designed on the genomic sequence previously described (AL136528).
As shown in Figure 5A the messenger RNA contains 235 nucleotides of 5′ untranslated RNA which is not interrupted by introns. A TATA box is in position −25.
We cloned an approximately 2 kb fragment (from nucleotide 43580 to nucleotide 45728 of sequence, AL136528) of the 5′ flanking sequence into the pGL3-basic vector upstream of the luciferase gene (construct A), and tested its ability to drive transcription of the luciferase gene. This fragment drives the expression of the luciferase gene when transfected into cell lines expressing high levels of ΔN but not in those that are negative or low expressing. Figure 5B shows the experiments performed in five representative cell lines expressing different levels of ΔNp73.
p53 and TAp73 regulate ΔNp73 expression
Sequence analysis of ΔNp73 promoter region revealed the presence of a single p53 responsive element, which consists of three half-binding sites, located at position −47/−78 from the cap-site (Figure 6A). This suggested that expression of the ΔNp73 isoforms could be regulated by p53 and by TAp73s.
In order to study whether p53 and TAp73s act directly on ΔNp73 promoter we performed luciferase assays co-transfecting the ΔNp73 promoter together with p53 and TAp73s. Figure 6B shows that ΔNp73 promoter is strongly induced by both p53 and TAp73 α, β and γ.
To confirm that p53 and TAp73 directly induce ΔNp73 acting on the p53 responsive element identified at position −47/−78, we generated progressive truncations of the ΔNp73 promoter and a deletion mutant lacking the p53 responsive element (Figure 6A). Luciferase constructs containing these truncated promoters were tested for the ability to respond to p53. Constructs containing more than 150 bases upstream of the TATA-box showed strong luciferase activity by p53 cotransfection (constructs A–D) while shorter constructs lacking the p53 responsive element were no longer inducible (constructs E and F) (Figure 6C). Similarly deletion of two of the p53 half-binding sites (constructs A.del and B.del) abrogated the induction by p53 completely demonstrating the existence of a single active p53 binding site (Figure 6C).
In order to confirm that p53 and TAp73s were able to regulate ΔNp73 we studied the expression levels or ΔNp73 after transfection of SAOS-2 cells with p53 or TAp73α and β. Transcript analysis by real time RT–PCR (Table 2) shows that p53 is capable of inducing both TA and ΔNp73 constructs, however while TA forms are induced 26-fold ΔNp73 is induced up to 3620-fold. Similarly TAp73 α and β are capable of inducing ΔNp73, β having the strongest activity, up to 5763-fold. Figure 6D shows the protein levels evaluation by Western blot analysis confirming the induction of ΔNp73 levels.
ΔNp73 blocks its own induction by p53 and TAp73
Since ΔNp73 is capable of counteracting the activity of p53 and p73 we investigated the possibility that ΔNp73 blocked its own induction. Co-transfection of p53 or TAp73α together with increasing concentrations of ΔNp73 and ΔN promoter construct shows that ΔNp73 is capable of blocking the action of p53 and TAp73 on its own promoter (Figure 6E). This creates an additional feedback loop that finely tunes the system.
Discussion
The function of p73 has not been fully elucidated at molecular levels. Even though the data known so far are sufficient to indicate the importance of p73, its molecular regulations are just beginning to emerge. Not only are there physical and functional interactions within the members of the family (p53, p63, p73) and their isoforms in normal as well as in cancer-derived variants, but the existence of cross-reactive natural dominant negatives finely tune the cellular response.
Our results show that human ΔNp73 isoforms are expressed in different tissues and cell lines and that their expression is driven by a second promoter located in a genomic region upstream of exon 3′. At the functional level, not only do the two proteins have distinct actions, but ΔNp73 can act as a natural dominant negative regulator for both p53 and for TAp73 itself. In fact, ΔNp73 can block TAp73- and p53-dependent transcription and apoptosis. In contrast to what has been reported for mouse embryos, TA forms are always expressed 10–100-fold more than ΔN isoforms. In addition, most of the tumour cell lines tested showed an altered TA/ΔN ratio when compared to normal adult or foetal tissues, suggesting that the relative amounts of the two forms rather than the absolute amount is important for the normal cell function. This is understandable since ΔN isoforms exert a dominant negative effect on the TA forms. Therefore the final activity of the TA forms is tightly regulated by the amount of ΔN present in the cell. In addition, ΔN isoforms can interact with p53 thus regulating the function of this gene.
p53 is expressed in response to DNA damage and its induction results in cell cycle arrest and apoptosis, preventing multiplication of damaged cells. As for other killing genes, the levels and functions of p53 have to be carefully regulated in order to avoid wanton cell death. Intracellular p53 levels are therefore controlled by a balance of production and degradation. As a matter of fact, elevated p53 levels lead to the protein's own regulation by inducing the transcription of MDM2, that binds p53 and causes its ubiquitination and degradation in proteosomes.
Here we describe a novel way of controlling p53 function, without increasing its elimination. Our results show that p53 is capable of inducing ΔNp73, a protein that can block p53 action by competing for p53 DNA binding sites. p53 induces ΔNp73 by directly binding to its promoter. In addition ΔNp73 counteracts p53 action on its own promoter creating an additional feedback loop that finely tunes the entire system (Figure 7). In addition, we show that a similar loop regulates TAp73 action, since ΔNp73 expression is also induced by TAp73, and ΔNp73 also regulates the function of the TA forms. The major implication of these results is that ΔNp73 plays an important role in regulating p53 function and that its over expression could play a role in tumorogenesis by generating a functional block of p53.
The complete absence of p73 could then be less damaging to most cells than the altered equilibrium of its isoforms, explaining the absence of increased number of tumours described in the p73-KO animals.
A very interesting observation arising from our data is the relatively high expression levels of p73 in cancer cell lines.45,46 Indeed, it is worth noting that several cancers express a cancer-specific TA isoform of p73 with a specific deletion of exon 2 (Δ2-p73) that, because of the disruption of the TA domain, is functionally similar to ΔNp73.32,47 It is possible that increased ΔN levels, and subsequent functional inactivation of p53, are involved in carcinogenesis. This possibility could be addressed by careful screening of a large number of primary tumour samples.
In conclusion we report here the cloning and characterisation of human ΔNp73 isoforms, the cloning and partial characterisation of the ΔN promoter, and the identification of a feedback loop that controls the function of p53 preventing unnecessary elimination of cells. Activation of the p53/TAp73-dependent death program would require the removal (ΔN downregulation) or the overcoming (p53 or TAp73 increased expression) of the ΔN block.
Materials and Methods
Cell cultures and samples
Cells were grown in Dulbecco's Modified essential Medium (DMEM) or RPMI-1640 supplemented with 10% v/v Foetal Bovine Serum, 1.2 g bicarbonate per litre, 1% (v/v) non essential amino acids and 15 mM N-2-hydroxyethylpiperazine-N′-2-ethanesulphonic acid, at 37°C in a humidified atmosphere of 5% (v/v) CO2 in air. All chemicals and reagents were from Sigma (Buchs, Switzerland), unless specified. Cell lines were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ; Braunschweig, Germany) and from the American Type Culture Collection (Rockville, USA). The HaCaT cell line was a kind gift from N. Fusenig (Heidelberg, Germany). The panel of normal RNA was obtained from Stratagene (Amsterdam, The Netherlands).
RNA extraction and reverse transcription
Total RNA was extracted using the RNeasy kit (Qiagen, Basel, Switzerland). During the extraction procedure, contaminating DNA was removed by DNase I: 600 ng RNA was treated with 10 U of DNase I (Roche, Basel, Switzerland) in a total volume of 10 μl containing 50 mM NaAc pH 5.0, 5 mM MgCl2 and 25 U of RNase Inhibitor (Roche) for 15 min at 37°C, 5 min at 90°C and immediate placement on ice. Two hundred ng of total RNA was reverse transcribed in a 20 μl reaction volume, using 16 nM pd(N)6 random primers, 19.2 U of avian myeloblastosis virus reverse transcriptase, 50 U RNase inhibitor and 1×AMV-RT-buffer (all reagents from Roche). The incubation was at room temperature for 10 min, followed by 42°C for 60 min and 95°C for 5 min. To check for contaminating genomic DNA, RNA samples were processed identically as for cDNA synthesis except that the reverse transcriptase was replaced by the same volume of water.
Real-time quantitative RT–PCR
Real-time PCR was used for absolute quantitation of p73 N-terminal variants, 7S RNA was used for internal standard. Each PCR was carried out in a total volume of 25 μl containing cDNA reverse-transcribed from 25 ng and 0.375 ng total RNA for p73 and 7S respectively. Dual labelled (FAM/TAMRA) gene specific probes and TaqMan Universal PCR Master Mix (Applied BioSystems, Rotkreuz, Switzerland) were used for the PCR. ΔNp73 was amplified using 5′-GGAGATGGGAAAAGCGAAAAT-3′ as the forward primer, 5′-CTCTCCCGCTCGGTCCAC-3′ as the reverse primer (both 300 μM), and a ΔNp73 probe 5′-CAAACGGCCCGCATGTTCCC-3′ (150 μM). For TAp73, the primers were forward 5′-GCACCACGTTTGAGCACCTC-3′, reverse 5′-TAATGAGGTGGTGGGCGGA-3′ (both 300 μM), and the probe was 5′-TTCGACCTTCCCCAGTCAAGCCG-3′ (150 μM). For 7S RNA the primers and probe were: forward 5′-ACCACCAGGTTGCCTAAGGA-3′, reverse 5′-CACGGGAGTTTTGACCTGCT-3′, probe 5′-TGAACCGGCCCAGGTCGGAAAC-3′ (300 μM each). All measurements were performed twice, and the arithmetic mean was used for further calculations.
For the determination of absolute transcript number analysis, cDNA was amplified from JVM-2 cells (TAp73 F 5′-ACGCAGCGAAACCGGGGCCCG-3′, R 5′-GCCGCGCGGCTGCTCATCTGG-3′, ΔNp73 F 5′-CCCGGACTTGGATGAATACT-3′, R 5′-GCCGCGCGGCTGCTCATCTGG-3′) and from a 7S-plasmid with F 5′-GCTACTCGGGAGGCTGAGAC-3′, R 5′-AGGCGCGATCCCACTACTGA-3′). The amplicons were cloned into the pcDNA3.1/V5-His vector as described and the constructs were verified by sequencing. After digestion with NsiI (Roche), a T7-dependent RNA synthesis was performed with the RiboMAXTM Large Scale RNA Production System (Promega, Wallisellen, Switzerland) according to the manufacturer's protocol. The synthesised RNA was extracted with a 5′-biotinylated oligo (5′-TTTCCACACCCTAACTGACA-3′) and the mRNA Isolation Kit (Roche) and quantified spectrophotometrically. Molecular concentrations were calculated and random-primed cDNA synthesis was performed with the purified RNA adjusted to 200 ng with yeast RNA. A series of dilutions was prepared and measured by real-time quantitative RT–PCR as described above.
Determination of C-terminal p73 mRNA splice variants
One hundred ng of cDNA obtained as described above from three different cell lines (JVM-2, HaCaT, and MCF-7) were amplified by PCR with forward primers specific for TAp73 and ΔNp73 and a reverse primer common to both variants: TAp73 F 5′-AAGATGGCCCAGTCCACCGCCACCTCCCCT-3′ (exon 2); ΔNp73 F 5′-ATGCTGTACGTCGGTGACCC-3′ (exon 3′); common reverse primer R 5′-TCAGTGGATCTCGGCCTCC-3′ (exon 14). The Expand High Fidelity PCR System enzyme was used as described above, but with an annealing temperature of 61°C. 0.1 μl of the first PCR product was used as a template for a nested PCR using a forward primer in exon 8 and a reverse primer in exon 14,35,45 15 cycles were used for TAp73 and 18 cycles for ΔNp73. The detection by blotting and hybridisation was performed as previously described.35,45
Western blot analysis
Protein extraction was performed as previously described.45 Thirty μg of total cellular protein was size-fractionated on an 8% SDS-polyacrylamide gel and blotted onto nitrocellulose (Protran; Schleicher and Schuell, Dassel, Germany). Equal loading and transfer efficiency were assessed by ponceau staining. p73 antibodies (AB7824, Chemikon, or a polyclonal p73 antibody kindly provided by D. Caput, Labège, France) were used for the detection as previously described.46 As standards for the Western blots, ΔNp73α/β, and TAp73α/β (the latter two subcloned from pcDNA3-HA plasmids18 were synthesised in vitro by TNT T7 Quick Coupled Transcription/Translation System (Promega) according to the manufacturer's protocol. To assess for protein quality, 30 μg of protein was fractionated and blotted as above, and detected with a rabbit polyclonal antibody against actin (A2066; Sigma).
Cloning of the ΔNp73 expression plasmids
PCR was carried out with 100 ng of cDNA from JVM-2 in a 50 μl reaction with Expand High Fidelity PCR System enzyme mix (Roche, Basel, Switzerland) according to manufacturer's protocol. Amplification consisted of 1 cycle at 94°C for 2 min, followed by 35 cycles of 94°C for 15 s, 59°C for 30 s, and 72°C for 1.5 min with a cycle elongation of 5 s for cycles 11–35, and a final elongation at 72°C for 7 min. The primers were as follows: 5′-ATGCTGTACGTCGGTGACCC-3′ and 5′-TCAGTGGATCTCGGCCTCC-3′ which allowed the amplification of different C-terminal splice variants. The PCR product was cloned into the pcDNA3.1/V5-His Vector (TA Cloning Kit®, Invitrogen, Groningen, The Netherlands) according to the manufacturer's protocol and ΔNp73α, ΔNp73β, and the ΔNp73γ variants were sequenced completely in both directions. Point mutations on the DBD (TAp73-R292H and ΔNp73-R244H) were done using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) with mutagenic primers (GTCCTTTGAGGGCCACATCTGCGCCTGTC sense and antisense) according to manufacturer's protocol. The same method was used for mutations of the start codons. For ΔNp73-ATG1m primers were GAATTGCCCTTCTGCTGTACGTCGGTGA sense and antisense, for ΔNp73-ATG2m primers were CTGAGCAGCACCCTGGACCAGAT sense and antisense.
Subcloning in pEGFP vector (Clontech) was performed by PCR. PCR products of the open reading frames of TAp73 and ΔNp73 were ligated by T/A cloning as described48 using SmaI restriction enzyme (Roche) and the Rapid DNA Ligation Kit (Roche).
Cloning of the ΔNp73 promoter region
Amplification of the 5′ upstream region of ΔNp73 was performed using primers: with F1, 5′-GCTGGGCCTTGGGAACGTT-3′ and R1, 5′-GGCAGCGTGGACCGAGCGG-3′ (construct A) designed on the genomic sequence of clone AL136528, with High Fidelity Taq (Life Technologies). Amplification consisted of 1 cycle at 94°C for 3 min, followed by 40 cycles of 94°C for 45 s, 60°C for 45 s, and 72°C for 2 min, and final elongation at 72°C for 7 min on a GeneAmp PCR 9600 (Perkin Elmer, Rothrist, Switzerland). The fragment was first cloned into PCR2.1 Invitrogen, then digested with Xho-I HindIII and cloned into pGL3basic vector (Promega).
Deletion constructs were generated by PCR. Different forward primers (Construct B: GTTGGAAGGAAAGGGGAAAG; Construct C: ACACCATCTCTCCCCCTTG; Construct D: CCCTGGTGGGTTTAATTATGG; Construct E: CCCGGACTTGGATGAATACT; Construct F: AAGCGAAAATGCCAACAAAC) and a common reverse primer (GACGAGGCATGGATCTGG) were used. Amplification was carried out with Taq DNA polymerase (Roche) using an annealing temperature of 55°C and 35 cycles. Ligation into the pGL3basic vector was performed by T/A cloning as described48 using SmaI restriction enzyme (Roche) and the Rapid DNA Ligation Kit (Roche).
Deletion of the p53 binding site on the A and B construct (A.del and B.del respectively) were performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, Amsterdam, The Netherlands) with mutagenic primers (CAACACATCACCCGGACTTGGATGAAT sense and antisense) according to manufacturer's protocol.
Fluorescent microscopy
Saos2 cells were transfected with TAp73α-GFP and ΔNp73α-GFP expression vectors with Lipofectamine 2000 (Life Technologies, Basel, Switzerland) according to the manufacturer's protocol. 36 h after transfection, cells were fixed in 4% paraformaldehyde. Slides were analyzed with a fluorescence microscope (excitation wavelength 490 nm) and images were acquired with a CCD camera (Biorad).
Dual luciferase-assay
Saos-2 cells (105) were plated and transfected with Lipofectamine 2000 (Life Technologies, Basel, Switzerland) according to the manufacturer's protocol. Indicated amounts of a reporter plasmid containing firely luciferase under control of the p21WAF1/Cip1 promoter33 or ΔN promoter described below, together with p53, TAp7333 and ΔNp73 expression plasmids were used for transfection. A total of 2 μg of plasmids were transfected using pcDNA3 (Invitrogen) to adjust for equal amounts. In all cases 10 ng of a renilla luciferase expression plasmid (pRL-CMV, Promega) was co-transfected to normalise for transfection efficiency. All transfections were done in triplicates and the Dual-Luciferase reporter assay system (Promega) was carried out after 24 h from transfection according to the manufacturer's protocol.
Analysis of apoptosis
To estimate DNA fragmentation, Saos-2 cells were plated to approximately 50% confluency and transfected, using Lipofectamin 2000 reagent (Life Technologies) according to the manufacturer's protocol, with either TAp73α or p5314,18 in combination with pcDNA3 or ΔNp73α, together with a GFP-spectrin expression vector49 at a 1 to 5 ratio. Cells were collected at 800×g for 10 min and fixed with 1 : 1 PBS and methanol-acetone (4 : 1 v/v) solution at −20°C. Hypodiploid events and cell cycle of GFP positive cells was evaluated by flow cytometry using a propidium iodide (PI) staining (40 mg/ml) in the presence of 13 kU/ml ribonuclease A (20 min incubation at 37°C) on a FACS-Calibur flow cytometer (Becton-Dickinson, CA, USA). Cells were excited at 488 nm using a 15 mW Argon laser, and the fluorescence was monitored at 578 nm at a rate of 150–300 events / s. Ten thousand events were evaluated using the Cell Quest Program (ibid). Electronic gating FSC-a/vs/FSC-h was used, when appropriate, to eliminate cell aggregates.
Abbreviations
- ΔN:
-
amino-terminus deleted
- TA:
-
transactivation
- DBD:
-
DNA-binding domain
- OD:
-
oligomerisation domain
- DMEM:
-
Dulbecco's Modified essential Medium
- PI:
-
propidium iodide
- GFP:
-
green fluorescent protein
References
Hollstein M, Sidransky D, Vogelstein B, Harris CC . 1991 p53 mutations in human cancers Science 253: 49–53
Hollstein M, Shomer B, Greenblatt M, Soussi T, Hovig E, Montesano R, Harris CC . 1996 Somatic point mutations in the p53 gene of human tumors and cell lines: updated compilation Nucleic Acids Res. 24: 141–146
Ko LJ, Prives C . 1996 p53: puzzle and paradigm Genes Dev. 10: 2438–2451
Levine AJ . 1997 p53, the cellular gatekeeper for growth and division Cell 89: 1175–1184
Choisy-Rossi C, Yonish-Rouach E . 1998 Apoptosis and the cell cycle: the p53 connection Cell Death Differ. 5: 129–131
el-Deiry WS . 1998 Regulation of p53 downstream genes Semin. Cancer Biol. 8: 345–357
Prives C, Hall PA . 1999 The p53 pathway J. Pathol. 187: 112–126
Oren M . 1999 Regulation of the p53 tumor suppressor protein J. Biol. Chem. 274: 8371–8374
Lohrum MA, Vousden KH . 1999 Regulation and activation of p53 and its family members Cell Death Differ. 6: 1162–1168
Kaghad M, Bonnet H, Yang A, Creancier L, Biscan JC, Valent A, Minty A, Chalon P, Lelias JM, Dumont X, Ferrara P, McKeon F, Caput D . 1997 Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers Cell 90: 809–819
Yang A, McKeon F . 2000 P63 and P73: P53 mimics, menaces and more Nat. Rev. Mol. Cell Biol. 1: 199–207
Levrero M, De Laurenzi V, Costanzo A, Gong J, Wang JY, Melino G . 2000 The p53/p63/p73 family of transcription factors: overlapping and distinct functions J. Cell Sci. 113: 1661–1670
Levrero M, De Laurenzi V, Costanzo A, Gong J, Melino G, Wang JY . 1999 Structure, function and regulation of p63 and p73 Cell Death Differ. 6: 1146–1153
De Laurenzi V, Catani MV, Terrinoni A, Corazzari M, Melino G, Costanzo A, Levrero M, Knight RA . 1999 Additional complexity in p73: induction by mitogens in lymphoid cells and identification of two new splicing variants epsilon and zeta Cell Death Differ. 6: 389–390
Ikawa S, Nakagawara A, Ikawa Y . 1999 p53 family genes: structural comparison, expression and mutation Cell Death Differ. 6: 1154–1161
Kaelin Jr WG . 1999 The p53 gene family Oncogene 18: 7701–7705
Yang A, Walker N, Bronson R, Kaghad M, Oosterwegel M, Bonnin J, Vagner C, Bonnet H, Dikkes P, Sharpe A, McKeon F, Caput D . 2000 p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours Nature 404: 99–103
De Laurenzi V, Raschella G, Barcaroli D, Annicchiarico-Petruzzelli M, Ranalli M, Catani MV, Tanno B, Costanzo A, Levrero M, Melino G . 2000 Induction of neuronal differentiation by p73 in a neuroblastoma cell line J. Biol. Chem. 275: 15226–15231
Fang L, Lee SW, Aaronson SA . 1999 Comparative analysis of p73 and p53 regulation and effector functions J. Cell Biol. 147: 823–830
Knight RA . 1999 p53 and its younger siblings Cell Death Differ. 6: 1143
Jost CA, Marin MC, Kaelin Jr WG . 1997 p73 is a simian [correction of human] p53-related protein that can induce apoptosis Nature 389: 191–194
Zhu J, Jiang J, Zhou W, Chen X . 1998 The potential tumor suppressor p73 differentially regulates cellular p53 target genes Cancer Res. 58: 5061–5065
Miller FD, Pozniak CD, Walsh GS . 2000 Neuronal life and death: an essential role for the p53 family Cell Death Differ. 7: 880–888
Strano S, Munarriz E, Rossi M, Cristofanelli B, Shaul Y, Castagnoli L, Levine AJ, Sacchi A, Cesareni G, Oren M, Blandino G . 2000 Physical and functional interaction between p53 mutants and different isoforms of p73 J. Biol. Chem. 275: 29503–29512
Ueda Y, Hijikata M, Takagi S, Chiba T, Shimotohno K . 1999 New p73 variants with altered C-terminal structures have varied transcriptional activities Oncogene 18: 4993–4998
Gong JG, Costanzo A, Yang HQ, Melino G, Kaelin Jr WG, Levrero M, Wang JY . 1999 The tyrosine kinase c-Abl regulates p73 in apoptotic response to cisplatin-induced DNA damage Nature 399: 806–809
Agami R, Blandino G, Oren M, Shaul Y . 1999 Interaction of c-Abl and p73alpha and their collaboration to induce apoptosis Nature 399: 809–813
Yuan ZM, Shioya H, Ishiko T, Sun X, Gu J, Huang YY, Lu H, Kharbanda S, Weichselbaum R, Kufe D . 1999 p73 is regulated by tyrosine kinase c-Abl in the apoptotic response to DNA damage Nature 399: 814–817
Corn PG, Kuerbitz SJ, van Noesel MM, Esteller M, Compitello N, Baylin SB, Herman JG . 1999 Transcriptional silencing of the p73 gene in acute lymphoblastic leukemia and Burkitt's lymphoma is associated with 5′ CpG island methylation Cancer Res. 59: 3352–3356
Kawano S, Miller CW, Gombart AF, Bartram CR, Matsuo Y, Asou H, Sakashita A, Said J, Tatsumi E, Koeffler HP . 1999 Loss of p73 gene expression in leukemias/lymphomas due to hypermethylation Blood 94: 1113–1120
Stirewalt DL, Clurman B, Appelbaum FR, Willman CL, Radich JP . 1999 p73 mutations and expression in adult de novo acute myelogenous leukemia Leukemia 13: 985–990
Casciano I, Ponzoni M, Lo Cunsolo C, Tonini GP, Romani M . 1999 Different p73 splicing variants are expressed in distinct tumour areas of a multifocal neuroblastoma Cell Death Differ. 6: 391–393
De Laurenzi V, Costanzo A, Barcaroli D, Terrinoni A, Falco M, Annicchiarico-Petruzzelli M, Levrero M, Melino G . 1998 Two new p73 splice variants, gamma and delta, with different transcriptional activity J. Exp. Med. 188: 1763–1768
Chi SW, Ayed A, Arrowsmith CH . 1999 Solution structure of a conserved C-terminal domain of p73 with structural homology to the SAM domain EMBO J. 18: 4438–4445
Tschan MP, Grob TJ, Peters UR, De Laurenzi V, Huegli B, Kreuzer KA, Schmidt CA, Melino G, Fey MF, Tobler A, Cajot JF . 2000 Enhanced p73 expression during differentiation and complex p73 isoforms in myeloid leukemia Biochem. Biophys. Res. Commun. 277: 62–65
Nozaki M, Tada M, Kashiwazaki H, Hamou MF, Diserens AC, Shinohe Y, Sawamura Y, Iwasaki Y, de Tribolet N, Hegi ME . 2001 p73 is not mutated in meningiomas as determined with a functional yeast assay but p73 expression increases with tumor grade Brain Pathol. 11: 296–305
Ito Y, Takeda T, Wakasa K, Tsujimoto M, Sakon M, Matsuura N . 2001 Expression of p73 and p63 proteins in pancreatic adenocarcinoma: p73 overexpression is inversely correlated with biological aggressiveness Int. J. Mol. Med. 8: 67–71
Liu ZG, Baskaran R, Lea-Chou ET, Wood LD, Chen Y, Karin M, Wang JY . 1996 Three distinct signalling responses by murine fibroblasts to genotoxic stress Nature 384: 273–276
Senoo M, Tsuchiya I, Matsumura Y, Mori T, Saito Y, Kato H, Okamoto T, Habu S . 2001 Transcriptional dysregulation of the p73L/p63/p51/p40/KET gene in human squamous cell carcinomas: expression of Delta Np73L, a novel dominant-negative isoform, and loss of expression of the potential tumour suppressor p51 Br. J. Cancer 84: 1235–1241
El-Naggar AK, Lai S, Clayman GL, Mims B, Lippman SM, Coombes M, Luna MA, Lozano G . 2001 p73 gene alterations and expression in primary oral and laryngeal squamous carcinomas Carcinogenesis 22: 729–735
Matos P, Isidro G, Vieira E, Lacerda AF, Martins AG, Boavida MG . 2001 P73 expression in neuroblastoma: a role in the biology of advanced tumors? Pediatr. Hematol. Oncol. 18: 37–46
De Laurenzi V, Melino G . 2000 Evolution of functions within the p53/p63/p73 family Ann NY Acad. Sci. 926: 90–100
Scaruffi P, Casciano I, Masiero L, Basso G, Romani M, Tonini GP . 2000 Lack of p73 expression in mature B-ALL and identification of three new splicing variants restricted to pre B and C-ALL indicate a role of p73 in B cell ALL differentiation Leukemia 14: 518–519
Pozniak CD, Radinovic S, Yang A, McKeon F, Kaplan DR, Miller FD . 2000 An anti-apoptotic role for the p53 family member, p73, during developmental neuron death Science 289: 304–306
Zwahlen D, Tschan MP, Grob TJ, Peters UR, Fink D, Haenggi W, Altermatt HJ, Cajot JF, Tobler A, Fey MF, Aebi S . 2000 Differential expression of p73 splice variants and protein in benign and malignant ovarian tumours Int. J. Cancer 88: 66–70
Peters UR, Tschan MP, Kreuzer KA, Baskaynak G, Lass U, Tobler A, Fey MF, Schmidt CA . 1999 Distinct expression patterns of the p53-homologue p73 in malignant and normal hematopoiesis assessed by a novel real-time reverse transcription-polymerase chain reaction assay and protein analysis Cancer Res. 59: 4233–4236
Fillippovich I, Sorokina N, Gatei M, Haupt Y, Hobson K, Moallem E, Spring K, Mould M, McGuckin MA, Lavin MF, Khanna MK . 2001 Transactivation-deficient p73alpha (p73Deltaexon2) inhibits apoptosis and competes with p53 Oncogene 20: 514–522
Marchuk D, Drumm M, Saulino A, Collins FS . 1991 Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products Nucleic Acids Res. 19: 1154
Kalejta RF, Shenk T, Beavis AJ . 1997 Use of a membrane-localized green fluorescent protein allows simultaneous identification of transfected cells and cell cycle analysis by flow cytometry Cytometry 29: 286–291
Acknowledgements
The HaCaT cell line was a kind gift from N. Fusenig (Heidelberg, Germany). We would like to thank Dr. R. Kalejta and Dr. A.J. Beavis for the GFP-spectrin expression vector. This work was supported by grants from the Swiss National Foundation (3200-053596.98), from the Swiss Cancer League (KFS 156-9-1995) and the Ursula-Hecht-Stiftung. Telethon grant E872, AIRC, MURST and EU grant QLGI-1999-00739 to G Melino. Telethon grant E1224 to V De Laurenzi.
Author information
Authors and Affiliations
Corresponding author
Additional information
Edited by RA Knight
Rights and permissions
About this article
Cite this article
Grob, T., Novak, U., Maisse, C. et al. Human ΔNp73 regulates a dominant negative feedback loop for TAp73 and p53. Cell Death Differ 8, 1213–1223 (2001). https://doi.org/10.1038/sj.cdd.4400962
Received:
Revised:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/sj.cdd.4400962
Keywords
This article is cited by
-
Requirement for TP73 and genetic alterations originating from its intragenic super-enhancer in adult T-cell leukemia
Leukemia (2022)
-
Hexokinase 3 enhances myeloid cell survival via non-glycolytic functions
Cell Death & Disease (2022)
-
p73 isoforms meet evolution of metastasis
Cancer and Metastasis Reviews (2022)
-
The p53 family member p73 in the regulation of cell stress response
Biology Direct (2021)
-
Tissue-specific expression of p73 and p63 isoforms in human tissues
Cell Death & Disease (2021)