The segregation of Escherichia coli minichromosomes constructed in vivo by recombineering
Highlights
► Defined oriC plasmids are constructed in vivo by recombination. ► oriC plasmids localize at the site of the cell division plane. ► This technology can be used to map chromosome organization and segregation functions.
Introduction
Escherichia coli minichromosomes are small autonomously replicating DNA molecules whose replication is driven by the chromosomal origin of replication oriC. They are often referred to as oriC plasmids. Isolation of F′ plasmids that replicate under oriC control has been reported by Hiraga (1976). Minichromosomes that replicate exclusively from oriC were isolated by in vitro ligation of chromosomal restriction fragments by Yasuda and Hirota (1977) and by in vivo recombination between specialized transducing phages by von Meyenburg et al. (1979). Such oriC plasmids were found to be unstably inherited despite evidence that they were present at high average copy numbers. It was shown that they replicate under normal oriC control, but have no means of equitable segregation to daughter cells (Jensen et al., 1990, Leonard and Helmstetter, 1986). Thus, the copy number in some cells increases at the expense of others, and the overall copy number in the population depends on the strength of the antibiotic selection used to maintain them. In addition, multiple plasmid copies are grouped into a limited number of foci, further increasing segregational instability (Niki and Hiraga, 1999). Here we show that oriC plasmids containing precise, pre-determined regions of the chromosome can be generated by in vivo recombination. By following the fate of these plasmids by fluorescence microscopy in living cells, we study their properties and find that their spatial distribution differs radically from that previously described (Niki and Hiraga, 1999).
Section snippets
Bacterial strains and plasmids
All bacteria are derivatives of E. coli K12. LT521 is MG1655 λcI857 Δ(cro-bioA) pglΔ8 nadA::Tn10. CC2373 is MG1655 ΔlacI-lacA containing the pMT1 parS site inserted at 84.3′ min. with a linked chloramphenicol-resistance marker. The parS insertion was made as described (Nielsen et al., 2006b), using the primer pair: 5′ GCAGGATGTTTGATTAAAAACATAACAGGAGAAAAATGCAGGAAGCGGAATTCCGGACC and 5′ AATCGGTTACGGTTGAGTAATAAATGGATGCCCTGCGTAACTCGAGATGCAGAAGACGCA to generate the PCR fragment. CC2535 was derived from
Direct generation of oriC plasmids by recombineering
Recombineering is an efficient method of in vivo genetic engineering that exploits the properties of the phage λ Red recombination system (Yu et al., 2000). Among many applications is the ability to rescue precisely defined segments of the E. coli chromosome onto a plasmid vector, thus circumventing the need for the multiple steps required to clone chromosomal genes onto plasmid vectors by conventional genetic engineering (Court et al., 2002). This is achieved by recombination between a
Discussion
We demonstrate that E. coli minichromosomes (oriC plasmids) can be generated in a single step by in vivo recombineering. The method should allow the generation of plasmids carrying the oriC locus and any defined chromosomal region that surrounds it, assuming that the resulting plasmid can be maintained. Generation of such plasmids with very large chromosomal regions should be possible, and may help to locate any sequences that might be involved in the organization or segregation of the
Acknowledgments
This work is dedicated to the memory of Kurt Nordström, a good friend, colleague and mentor.
The project has been funded in part with federal funds from the National Cancer Institute, National Institutes of Health, under contract HHSN26120080001E. The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the US Government. This
References (19)
Escherichia coli minichromosomes: random segregation and absence of copy number control
J. Mol. Biol.
(1990)Escherichia coli contains a DNA replication compartment in the cell center
Biochimie
(1999)Recombineering: in vivo genetic engineering in E. Coli, S. enterica, and beyond
Methods Enzymol.
(2007)KOPS: DNA motifs that control E. coli chromosome segregation by orienting the FtsK translocase
EMBO J.
(2005)Genetic engineering using homologous recombination
Annu. Rev. Genet.
(2002)The genes for the eight subunits of the membrane bound ATP synthase of Escherichia coli
Mol. Gen. Genet.
(1981)Ends-in vs. ends-out recombination in yeast
Genetics
(1993)Novel F prime factors able to replicate in Escherichia coli Hfr strains
Proc. Natl. Acad. Sci. USA
(1976)- et al.
Cell cycle-specific replication of Escherichia coli minichromosomes
Proc. Natl. Acad. Sci. USA
(1986)
Cited by (3)
chi sequences switch the RecBCD helicase–nuclease complex from degradative to replicative modes during the completion of DNA replication
2023, Journal of Biological ChemistryRecBCD, SbcCD and ExoI process a substrate created by convergent replisomes to complete DNA replication
2019, Molecular Microbiology