Analysis of RNA–protein interactions by a microplate-based fluorescence anisotropy assay
Section snippets
Synthesis of the fluorescent DNA probe
The Drosophila dodecasatellite C-strand was synthesized with fluorescein (6-FAM) at its 5′ end using phosphoramidite chemistry and was PAGE-purified by the Biotechnology Center (University of Illinois, Urbana, IL, USA). The probe contains seven repeats of an 11- to 12-nucleotide fragment [24] and its DNA sequence is 5′- TCTGTCCCGTACTCTGTCCCGTACTCCGTCTCGTACTCTGTCCCATATTGGTCCCGTACTGGTCCCGCACATGGTCCCGAAC-3′. The labeling ratios of the fluorescent DNA and RNA probes were estimated by comparing
Binding of vigilin to a fluorescein-labeled segment of the vitellogenin mRNA 3′-UTR
In preliminary studies, we identified conditions that improved the stability of vigilin during the assay. To test the microplate-based FA assay and fluorescein-labeled RNA probe under these conditions, we compared binding of purified recombinant human vigilin to a chemically synthesized fluorescein-labeled oligonucleotide containing the dodecasatellite single-stranded DNA sequence (flDodecaSS-DNA) and to the enzymatically synthesized fluorescein-labeled vitellogenin mRNA 3′-UTR (flVit3′UTR-RNA)
Discussion
Although chemical synthesis works well for the production of fluorescein-labeled DNA probes and may be appropriate for the production of short single-stranded RNA probes, chemical synthesis of fluorescein-labeled RNA oligonucleotide probes is quite costly and is impractical for RNAs much longer than 50 nucleotides. The biochemical method that we used allows for the inexpensive synthesis of longer RNA probes. The combination of PCR to amplify only the sequence of interest and in vitro
Acknowledgments
This research was supported by NIH Grants DK 50080 and DK-071909 (to D.S.) and by Grants CA78710 and CA94082 (to J.R.) and by NICHD Predoctoral Traineeships in Reproductive Biology to S.W. and K.G.F. J.R. acknowledges the expert technical assistance of B. Clark and H. Gerard.
References (53)
- et al.
Pre-mRNA splicing: awash in a sea of proteins
Mol. Cell
(2003) - et al.
Structure and function of poly (A) binding proteins
Biochim. Biophys. Acta
(2004) - et al.
Nuclear export of mRNA: from the site of transcription to the cytoplasm
Exp. Cell Res.
(2004) - et al.
Dicers at RISC; the mechanism of RNAi
Cell
(2004) - et al.
Regulation of pathways of mRNA destabilization and stabilization
Prog. Nucleic Acids Res.
(2002) - et al.
Ribonomics: identifying mRNA subsets in mRNA complexes using antibodies to RNA binding proteins and genomic arrays
Methods
(2002) - et al.
RNA gel shift assays for analysis of hormone control of mRNA stability
Methods Enzymol.
(2003) Fluorescence polarization and anisotropy in high throughput screening: perspectives and primer
J. Biomol. Screen.
(2000)- et al.
Folding of A + U-rich RNA elements modulates AUF1 binding: potential roles in regulation of mRNA turnover
J. Biol. Chem.
(2001) - et al.
Characteristics of the interaction of a synthetic human tristetraprolin tandem zinc finger peptide with AU-rich element-containing RNA substrates
J. Biol. Chem.
(2003)
Drosophila DDP1, a multi-KH-domain protein, contributes to centromeric silencing and chromosome segregation
Curr. Biol.
Vigilins bind to promiscuously edited A-to-I edited RNAs and are involved in the formation of heterochromatin
Curr. Biol.
The yeast G protein α subunit Gpa1 transmits a signal through an RNA binding effector protein Scp160
Mol. Cell
Vigilin, a ubiquitous protein with 14 K homology domains, is the estrogen-inducible vitellogenin mRNA 3-untranslated region-binding protein
J. Biol. Chem.
Targeted knockdown of the RNA-binding protein CRD-BP promotes call proliferation via an insulin-like growth factor II-dependent pathway in Human K562 leukemia cells
J. Biol. Chem.
CRD-BP/IMP1 expression characterizes cod blood CD34+ stem cells and affects c-myc and IGF-II expression in MCF-7 cancer cells
J. Biol. Chem.
RNA as a drug target: methods for biophysical characterization and screening
Trends Biotechnol.
Discovery of selective, small molecule inhibitors of RNA complexes-I. The Tat protein/TAR RNA complexes required for HIV-1 transcription
Bioorg. Med. Chem.
Small molecule modulators of HIV Rev/Rev response element interaction identified by random screening
Antiviral Res.
A simple statistical parameter for use in evaluation and validation of high throughput screening assays
J. Biomol. Screen.
Fluorescence approaches to study of protein–nucleic acid complexation
Methods Enzymol.
Small molecule blockade of transcriptional coactivation of the hypoxia-inducible factor pathway
Cancer Cell
A high-throughput fluorescence-anisotropy screen that identifies small molecule inhibitors of the DNA binding of B-ZIP transcription factors
Anal. Biochem.
RNA interference: biology, mechanism, and applications
Microbiol. Mol. Biol. Rev.
The RNAi revolution
Nature
Messenger-RNA-binding proteins and the messages they carry
Nat. Rev. Mol. Cell Biol.
Cited by (16)
A new small molecule inhibitor of estrogen receptor α binding to estrogen response elements blocks estrogen-dependent growth of cancer cells
2008, Journal of Biological ChemistryCitation Excerpt :The flcARE and flcPRE were synthesized and characterized as described for flcERE. To remove traces of free fluorescein present in some oligonucleotides (29), they were passed over a Centri-Sep column (usually used to remove free fluorescent dyes in DNA sequencing) following the supplier's directions (Princeton Separation, Princeton, NJ). Oligonucleotides were prepared at 10 μm, and 50–100 μl was loaded onto each column.
In vitro fluorescence anisotropy analysis of the interaction of full-length SRC1a with estrogen receptors α and β supports an active displacement model for coregulator utilization
2007, Journal of Biological ChemistryCitation Excerpt :Kinetic measurements were carried out at room temperature by taking anisotropy measurements at the indicated time points after diluting the flERE·E2-ER·SRC1a complex. FAMA Analysis of the Interaction of Full-length SRC1a with flERE·E2-ER Complexes—Previously, we used the FAMA to analyze binding of steroid hormone receptors and RNA-binding proteins to their response elements in a small sample volume, microplate format (46, 52). To extend the utility of the FAMA, we tested its ability to measure binding of full-length SRC1a to a pre-formed flERE·E2-ER complex.
Natural Compound Boldine Lessens Myotonic Dystrophy Type 1 Phenotypes in DM1 Drosophila Models, Patient-Derived Cell Lines, and HSA<sup>LR</sup> Mice
2023, International Journal of Molecular SciencesFrom parts lists to functional significance—RNA–protein interactions in gene regulation
2020, Wiley Interdisciplinary Reviews: RNA