Stably transfected ABCA1 antisense cell line has decreased ABCA1 mRNA and cAMP-induced cholesterol efflux to apolipoprotein AI and HDL

doi:10.1016/S1388-1981(01)00183-4

Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids

Volume 1534, Issues 2–3, 30 December 2001, Pages 121-128

https://doi.org/10.1016/S1388-1981(01)00183-4 Get rights and content

Abstract

Using a sensitive real time fluorescent PCR assay, ABCA1 mRNA levels were induced by ∼50–70-fold following 8Br-cAMP treatment of the RAW264 murine macrophage cell line, concomitant with the induction of cholesterol efflux to apoAI and HDL. A stably transfected ABCA1 antisense cDNA cell line was created, which led to ∼50–70% reductions in ABCA1 mRNA levels in basal and 8Br-cAMP-treated cells, and diminished to the same extent the 8Br-cAMP-mediated efflux of cholesterol to apolipoprotein AI and HDL. These data demonstrate that ABCA1 is necessary for the cAMP-induced lipid efflux to both apoAI and HDL.

Introduction

Defects in the ABCA1 gene (previously called ABC1) cause Tangier disease, and related hypoalphalipoproteinemias [1], [2], [3], [4]. Fibroblasts from Tangier disease subjects have decreased lipid efflux to both apolipoprotein AI (apoAI) and HDL, thus demonstrating that ABCA1 plays a role in efflux to both lipid-free apolipoproteins and to lipoproteins [5], [6]. Similarly, macrophages cultured from ABCA1-deficient mice loose their ability to efflux cholesterol to apoAI [7]. The addition of ABCA1 antisense oligonucleotides to human fibroblasts has been shown to give rise to a transient reduction in ABCA1 mRNA and a 24–50% reduction in cholesterol efflux to apoAI [1], [8]. Transient transfections of the 293 cell line with ABCA1 expression vectors containing the authentic 5′ start codon have been shown to increase the binding of, and lipid efflux to, apoAI, without leading to a large increase in the binding of, or lipid efflux to, HDL [9], [10]. Thus, the role of ABCA1 in efflux to HDL is controversial.

The pathway of lipid efflux to lipid-free apolipoproteins has been studied in RAW264 macrophages, a cell line in which this pathway can be induced with cAMP analogues [11]. We have previously implicated receptor-mediated endocytosis and resecretion in this lipid efflux pathway in these cells [12]. Chimini’s lab has proposed that ABCA1 mediates phosphatidyl serine exofacial flopping, and that this activity is required for docking of apoAI at the cell surface. We and others have shown that cAMP treatment of RAW264 or J774 macrophages leads to the induction of ABCA1 mRNA [7], [13], [14]. In the present study, we report the development of a real time quantitative RT-PCR assay for ABCA1 mRNA, which is superior to gel-based RT-PCR or Northern blot assays. 8Br-cAMP treatment of RAW264 cells led to an ∼50–70-fold increase in ABCA1 mRNA. Stable transfection of an ABCA1 antisense expression vector into RAW264 cells led to large decreases in ABCA1 mRNA in both untreated and cAMP-treated cells. The cAMP-mediated increase of cholesterol efflux to apoAI and HDL was decreased in the ABCA1 antisense cell line.

Section snippets

Selection of stably transfected ABCA1 antisense cell lines

A partial murine ABCA1 cDNA clone was obtained by RT-PCR of total RNA of RAW264.7 cells treated for 16 h with 0.3 mM 8-Br-cAMP. The sense primer, GGACTAGTCCATGCCGTCTGCAGGAACC, consisted of nucleotides 263–281 (all murine ABCA1 nucleotide positions are according to GenBank accession number X75926) and a synthetic SpeI site on the 5′ end, and the antisense primer, TCGAGATATCGTCTGGATTGCCTGGTT, consisted of nucleotides 1583–1558 with a naturally occurring EcoRV site. With these primers a 1.31-kb

Selection of an antisense ABCA1 cDNA stably transfected cell line

A murine ABCA1 partial cDNA was cloned in the antisense orientation into the bicistronic pIRESneo 2 vector (Clontech). Stably transfected RAW264 colonies were picked and expanded in selective medium containing 1.0 mg/ml G418. Four clonally derived cell lines were screened for the ability to efflux [³H]cholesterol to exogenous apoAI in the presence of 8Br-cAMP. The fold induction of cholesterol efflux to apoAI induced by 8-Br-cAMP was decreased by 18% to 42% in the ABCA1 antisense cell lines

Discussion

We have developed a sensitive and quantitative TaqMan assay for murine ABCA1 mRNA, and showed that cAMP induced its expression in RAW264 cells by ∼50–70-fold. We also demonstrated that this method is more accurate than quantification based upon Northern blots or gel-based RT-PCR assay. In the current study we made stably transfected RAW264 macrophage cell lines expressing an ABCA1 antisense cDNA fragment, which displayed reduced ABCA1 mRNA, and reduced cholesterol efflux to apoAI and HDL after

Acknowledgements

This research was supported by Grant PO1 HL54591 from the National Institutes of Health.

References (16)

J.F. Oram
Biochim. Biophys. Acta
(2000)
M. Walter et al.
Biochem. Biophys. Res. Commun.
(1994)
A.E. Bortnick et al.
J. Biol. Chem.
(2000)
W. Chen et al.
J. Biol. Chem.
(2000)
N. Wang et al.
J. Biol. Chem.
(2000)
J.D. Smith et al.
J. Biol. Chem.
(1996)
Y. Takahashi et al.
Biochim. Biophys. Acta
(2000)
J.F. Oram et al.
J. Biol. Chem.
(2000)

There are more references available in the full text version of this article.

Cited by (23)

A critical appraisal of the measurement of serum ‘cholesterol efflux capacity’ and its use as surrogate marker of risk of cardiovascular disease
2018, Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids
Citation Excerpt :
However, there can be a significant discrepancy between more specific measurement of ABCA1-specific (e.g. probucol-inhibitable) and cAMP-stimulated efflux from J774 macrophages [127]. Transfection of ABCA1 antisense RNA into RAW macrophages significantly, but not completely, reduced cAMP-stimulated cholesterol efflux to apoA-I or HDL [128]. As there was some residual expression of ABCA1 in the antisense line, it is difficult to decide from this study whether ABCA1 was the sole contributor to cAMP-stimulated efflux.
The ‘cholesterol efflux capacity (CEC)’ assay is a simple in vitro measure of the capacities of individual sera to promote the first step of the reverse cholesterol transport pathway, the delivery of cellular cholesterol to plasma HDL.
This review describes the cell biology of this model and critically assesses its application as a marker of cardiovascular risk. We describe the pathways for cell cholesterol export, current cell models used in the CEC assay with their limitations and consider the contribution that measurement of serum CEC provides to our understanding of HDL function in vivo.
Cell lipid metabolism modulators 2-bromopalmitate, D609, monensin, U18666A and probucol shift discoidal HDL formation to the smaller-sized particles: implications for the mechanism of HDL assembly
2016, Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids
Citation Excerpt :
Reconstitution studies have found that an excess of phospholipid over apo A-I promotes formation of larger-sized reconstituted HDL (rHDL), while an excess of apo A-I over phospholipid promotes formation of smaller-sized rHDL [7,8]. The level of ABCA1 expression determines the amount of cell lipid available for discoidal HDL formation [9]. We have previously shown that a high expression level of ABCA1 (i.e., a large amount of available cell lipid) and a low concentration of extracellular, lipid-free apo A-I promote formation of larger-sized discoidal HDL, while a low level of ABCA1 expression (i.e., a small amount of available cell lipid) and a high concentration of extracellular, lipid-free apo A-I promote formation of smaller-sized discoidal HDL [10].
ATP-binding cassette transporter A1 (ABCA1) mediates formation of disc-shaped high-density lipoprotein (HDL) from cell lipid and lipid-free apolipoprotein A-I (apo A-I). Discoidal HDL particles are heterogeneous in physicochemical characteristics for reasons that are understood incompletely. Discoidal lipoprotein particles similar in characteristics and heterogeneity to cell-formed discoidal HDL can be reconstituted from purified lipids and apo A-I by cell-free, physicochemical methods. The heterogeneity of reconstituted HDL (rHDL) is sensitive to the lipid composition of the starting lipid/apo A-I mixture. To determine whether the heterogeneity of cell-formed HDL is similarly sensitive to changes in cell lipids, we investigated four compounds that have well-established effects on cell lipid metabolism and ABCA1-mediated cell cholesterol efflux. 2-Bromopalmitate, D609, monensin and U18666A decreased formation of the larger-sized, but dramatically increased formation of the smaller-sized HDL. 2-Bromopalmitate did not appear to affect ABCA1 activity, subcellular localization or oligomerization, but induced dissolution of the cholesterol-phospholipid complexes in the plasma membrane. Arachidonic and linoleic acids shifted HDL formation to the smaller-sized species. Tangier disease mutations and inhibitors of ABCA1 activity wheat germ agglutinin and AG 490 reduced formation of both larger-sized and smaller-sized HDL. The effect of probucol was similar to the effect of 2-bromopalmitate. Taking rHDL formation as a paradigm, we propose that ABCA1 mutations and activity inhibitors reduce the amount of cell lipid available for HDL formation, and the compounds in the 2-bromopalmitate group and the polyunsaturated fatty acids change cell lipid composition from one that favors formation of the larger-sized HDL particles to one that favors formation of the smaller-sized species.
Postprandial lipemia enhances the capacity of large HDL2 particles to mediate free cholesterol efflux via SR-BI and ABCG1 pathways in type IIB hyperlipidemia
2010, Journal of Lipid Research
Citation Excerpt :
Efflux experiments performed in the presence of apoB-depleted plasma support the possibility that a reduction of cholesterol efflux to LDL particles during the postprandial phase might counterbalance the increased ABCG1-dependent cellular efflux to HDL2 particles. We presently observed a significant increase in the capacity of whole postprandial plasma to remove cellular free cholesterol efflux compared with fasting plasma using the mouse macrophage cell line Raw264.7, in which the expression of ABCA1 can be stimulated with 8 Br-cAMP (26). ABCA1 is known to mediate the export of cellular cholesterol and phospholipids to lipid-poor or lipid-free apolipoproteins (mainly apoAI) to form nascent preβ-HDL particles.
Lipid and cholesterol metabolism in the postprandial phase is associated with both quantitative and qualitative remodeling of HDL particle subspecies that may influence their anti-atherogenic functions in the reverse cholesterol transport pathway. We evaluated the capacity of whole plasma or isolated HDL particles to mediate cellular free cholesterol (FC) efflux, cholesteryl ester transfer protein (CETP)-mediated cholesteryl ester (CE) transfer, and selective hepatic CE uptake during the postprandial phase in subjects displaying type IIB hyperlipidemia (n = 16). Postprandial, large HDL2 displayed an enhanced capacity to mediate FC efflux via both scavenger receptor class B type I (SR-BI)-dependent (+12%; P < 0.02) and ATP binding cassette transporter G1 (ABCG1)-dependent (+31%; P < 0.008) pathways in in vitro cell systems. In addition, the capacity of whole postprandial plasma (4 h and 8 h postprandially) to mediate cellular FC efflux via the ABCA1-dependent pathway was significantly increased (+19%; P < 0.0003). Concomitantly, postprandial lipemia was associated with elevated endogenous CE transfer rates from HDL2 to apoB lipoproteins and with attenuated capacity (−17%; P < 0.02) of total HDL to deliver CE to hepatic cells. Postprandial lipemia enhanced SR-BI and ABCG1-dependent efflux to large HDL2 particles. However, postprandial lipemia is equally associated with deleterious features by enhancing formation of CE-enriched, triglyceride-rich lipoprotein particles through the action of CETP and by reducing the direct return of HDL-CE to the liver.
Apolipoprotein A-I lysine modification: Effects on helical content, lipid binding and cholesterol acceptor activity
2006, Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids
We examined the role of the positively charged lysine residues in apoAI by chemical modification. Lysine modification by reductive methylation did not alter apoAI's net charge, secondary or tertiary structure as observed by circular dichroism and trytophan fluorescence, respectively, or have much impact on lipid binding or ABCA1-dependent cholesterol acceptor activity. Acetylation of lysine residues lowered the isoelectric point of apoAI, altered its secondary and tertiary structure, and led to a 40% decrease in cholesterol acceptor activity, while maintaining 93% of its lipid binding activity. Exhaustive lysine acetoacetylation lowered apoAI's isoelectric point, profoundly disrupted its secondary and tertiary structure, and led to 90% and 82% reductions in cholesterol acceptor and lipid binding activities, respectively. The dose-dependent acetoacetylation of an increasing proportion of apoAI lysine residues demonstrated that cholesterol acceptor activity was more sensitive to this modification than lipid binding activity, suggesting that apoAI lysine positive charges play an important role in ABCA1 mediated lipid efflux beyond the role needed to maintain α-helical content and lipid binding activity.
Tyrosine modification is not required for myeloperoxidase-induced loss of apolipoprotein A-I functional activities
2005, Journal of Biological Chemistry
Apolipoprotein A-I (apoAI), the major protein of high density lipoprotein, plays an important role in reverse cholesterol transport via its activity as an ABCA1-dependent acceptor of cellular cholesterol. We reported recently that myeloperoxidase (MPO) modification of apoAI inhibits its ABCA1-dependent cholesterol acceptor activity (Zheng, L., Nukuna, B., Brennan, M. L., Sun, M., Goormastic, M., Settle, M., Schmitt, D., Fu, X., Thomson, L., Fox, P. L., Ischiropoulos, H., Smith, J. D., Kinter, M., and Hazen, S. L. (2004) J. Clin. Invest. 114, 529–541). We also reported that MPO-mediated chlorination preferentially modifies two of the seven tyrosines in apoAI, and loss of parent peptides containing these residues dose-dependently correlates with loss in ABCA1-mediated cholesterol acceptor activity (Zheng, L., Settle, M., Brubaker, G., Schmitt, D., Hazen, S. L., Smith, J. D., and Kinter, M. (2005) J. Biol. Chem. 280, 38–47). To determine whether oxidative modification of apoA-I tyrosine residues was responsible for the MPO-mediated inactivation of cholesterol acceptor activity, we made recombinant apoAI with site-specific substitutions of all seven tyrosine residues to phenylalanine. ApoAI and the tyrosine-free apoAI were equally susceptible to dose-dependent MPO-mediated loss of ABCA1-dependent cholesterol acceptor activity, as well as lipid binding activity. MPO modification altered the migration of apoAI on SDS gels and decreased its α-helix content. MPO-induced modification also targeted apoAI tryptophan and lysine residues. Specifically, we detected apoAI tryptophan oxidation to mono- and dihydroxytryptophan and apoAI lysine modification to chlorolysine and 2-aminoadipic acid. Thus, tyrosine modification of apoAI is not required for its MPO-mediated inhibition of cholesterol acceptor activity.
Lipid efflux in human and mouse macrophagic cells: Evidence for differential regulation of phospholipid and cholesterol efflux
2005, Journal of Lipid Research
ABCA1 is a critical regulator of lipid efflux from cells, which is highly regulated at the transcriptional and posttranslational levels. However, cells from different species and different tissues, and primary versus immortalized cells, show different modes of regulation. We have carried out a comparative analysis of basic signaling pathways of lipid efflux in mouse J774 cells, mouse peritoneal macrophages (MPMs), human THP-1 cells, and human monocyte-derived macrophages. Cyclic AMP (cAMP) was a potent stimulator of lipid efflux in mouse macrophages, but not in human macrophages. Moreover, this cAMP-inducible component of efflux from MPMs was inhibitable by H89 [a protein kinase A (PKA) inhibitor], but H89 did not affect basal efflux. On the other hand, cAMP failed to show any stimulatory effect in human macrophages, but basal efflux was inhibitable by H89. In MPMs and THP-1 cells, protein kinase C (PKC) inhibitors blocked cholesterol efflux but had no effect on phospholipid efflux, demonstrating the separation of the regulation of phospholipid efflux and cholesterol efflux in macrophages.
We conclude that: 1) cAMP regulates lipid efflux predominantly in a PKA-dependent fashion; 2) cholesterol efflux is modulated by a PKC-dependent mechanism; and 3) mouse and human macrophages exhibit different modes of regulation of lipid efflux.

View all citing articles on Scopus

View full text

Stably transfected ABCA1 antisense cell line has decreased ABCA1 mRNA and cAMP-induced cholesterol efflux to apolipoprotein AI and HDL

Abstract

Introduction

Section snippets

Selection of stably transfected ABCA1 antisense cell lines

Selection of an antisense ABCA1 cDNA stably transfected cell line

Discussion

Acknowledgements

Biochim. Biophys. Acta

Biochem. Biophys. Res. Commun.

J. Biol. Chem.

J. Biol. Chem.

J. Biol. Chem.

J. Biol. Chem.

Biochim. Biophys. Acta

J. Biol. Chem.