Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Gene structure and promoter function of a teleost ribosomal protein: a tilapia (Oreochromis mossambicus) L18 gene
Introduction
Ribosomes are composed of 3–4 rRNA molecules and about 60–80 protein subunits. Ribosomal protein (r-protein) genes have been considered housekeeping genes, with a strongly coordinated constitutive expression that is closely linked to that of the different ribosomal RNAs to form the entire ribosome. R-protein expression is adjusted according to the needs of the cell for protein biosynthesis [1].
The coordinated expression of the r-protein genes is controlled at various levels. In prokaryotes, most of them are organized in a comparatively small number of operons [2], which encode a repressor of both transcription and translation that binds to a specific site on the polycistronic RNA [3], [4]. In eukaryotes, r-protein gene-specific regulatory elements have been identified in the different promoter sequences, consistent with a coordinated expression. Most eukaryotic r-protein genes have special short promoters devoid of a TATA box. The transcription start site (mostly a C) is part of an oligopyrimidine tract flanked by GC-rich sequences [5], [6], [7], [8]. The mRNA thus starts with a 5′-terminal oligopyrimidine tract (5′-TOP) that is required for translational control of r-proteins [9]. Such a 5′-TOP tract was recently described in the mRNA coding for the medaka (Oryzias latipes) r-protein gene S3a [10]. Control of expression at the level of RNA splicing and degradation has also been described (for a review, see [11]).
The r-protein L18 in concert with L5 and L25 interacts with the 5S rRNA, which is a component of the large ribosomal subunit [12]. Only a few genomic sequences have been reported in higher eukaryotes (human [13], Xenopus [14], Caenorhabditis elegans [15]) and only one promoter study in Xenopus laevis [16]. Here we report the molecular cloning of a tilapia (Oreochromis mossambicus) L18 ribosomal protein gene (tiL18). We analyzed its expression and performed promoter studies, using a reporter gene strategy, by transient assays in cultured cells or in microinjected zebrafish (Danio rerio) and tilapia (Oreochromis niloticus) embryos. We observed high levels of expression under ideal metabolic conditions suggesting that the L18 regulatory sequences are likely to drive efficient and constitutive expression of a transgene in tilapia.
Section snippets
Oligonucleotides
Oligonucleotide primers (Eurogentec, Seraing, Belgium) used for PCR procedures were: L18pf1: TCCCTTTTCGCTCTGAGTCC; L18pr1: TTGGTCCTGCTCATGAACAG; T12MG, T12MA, T12MT and T12MC (M represents G, A, or C); nL18pr1: TTCTTGTAGCCGCAGCTGGCTC; fL18pr1: TTGGTCCTGCTCATGAACAG; pL18f1: AGCCCGATTAGAATGCTTGGTG; pL18r1: GGTTGGACTCAGAGCGAAAAGGG.
All RT-PCR or PCR products were cloned into the pCRII vector and sequenced.
Library screening
Using a salmon L18 cDNA (GenBank No. CAC36993) as a probe, 2×106 plaques
Genomic library screening
A salmon ribosomal protein L18 cDNA clone was used as a probe to screen 2.0×106 λ-phage plaques from a tilapia (O. mossambicus) genomic library. One out of 94 positive clones containing approx. 13 kb of insert, λ5jtiL18, was chosen for restriction mapping and Southern blot analysis (data not shown). A 4.5 kb XhoI fragment hybridizing to the L18 probe was subcloned (pB4.5-tiL18) and sequenced. Primers from the 5′- and 3′-ends of the pB4.5-tiL18 insert were used to identify flanking regions by
Discussion
Although heterologous regulatory sequences are often used to express transgenes in fish with success, a number of researchers have recommended the use of fish-derived sequences for appropriately regulated and high levels of expression. In addition, the unacceptability to the food market of transgenic fish containing heterologous sequences leads to a demand for new fish promoters [26]. We present a new, strong fish promoter that can be used to drive ubiquitous expression of a gene of interest.
Acknowledgments
This work was supported by the ‘Région Wallone (ULg 1815); the ‘Services Fédéraux des Affaires Scientifiques, Techniques et Culturelles’ (PAI P4/30 and ‘Actions de Recherche Concertées’: 95/00-193); the Fonds National de la Recherche Scientifique (FNRS) (−3.4537.93 and −9.4569.95), the EU (No. BIO4-CT97-0554). M.M. is a ‘Chercheur qualifié’ at the Fonds National de la Recherche Scientifique (FNRS). A.M. held fellowships from ‘CGRI’ and ‘ULg patrimoine’. L.F.M held a scholarship from CAPES,
References (36)
- et al.
Functional analysis of the promoter of the gene encoding the acidic ribosomal protein L45 in yeast
Biochim. Biophys. Acta
(1991) - et al.
The gene family encoding the mouse ribosomal protein L32 contains a uniquely expressed intron-containing gene and an unmutated processed gene
Cell
(1984) - et al.
Isolation and characterization of medaka ribosomal protein S3a (fte-1) cDNA and gene
Gene
(2000) - et al.
Sequence, overproduction and purification of Vibrio proteolyticus ribosomal protein L18 for in vitro and in vivo studies
Gene
(1996) - et al.
Nucleotide and deduced amino acid sequence of human ribosomal protein L18
Biochim. Biophys. Acta
(1993) - et al.
Cloning and expression analysis of an inducible HSP70 gene from tilapia fish
FEBS Lett.
(2000) - et al.
Pit-1 mediates cell-specific and cAMP-induced transcription of the tilapia GH gene
Mol. Cell. Endocrinol.
(1999) - et al.
The primary structure of rat ribosomal protein L18a
FEBS Lett.
(1989) - et al.
Isolation and characterization of four mouse ribosomal-protein-L18 genes that appear to be processed pseudogenes
Gene
(1984) Control of ribosomal protein gene expression
Biochim. Biophys. Acta
(1988)
The GA-binding protein can serve as both an activator and repressor of ribosomal protein gene transcription
J. Biol. Chem.
The basal promoter elements of murine cytochrome c oxidase subunit IV gene consist of tandemly duplicated ets motifs that bind to GABP-related transcription factors
J. Biol. Chem.
Regulation of the synthesis of ribosomes and ribosomal components
Annu. Rev. Biochem.
Regulation of ribosome biosynthesis in Escherichia coli and Saccharomyces cerevisiae: diversity and common principles
J. Bacteriol.
Phylogenetic analysis of L4-mediated autogenous control of the S10 ribosomal protein operon
J. Bacteriol.
Characterization of the expressed gene and several processed pseudogenes for the mouse ribosomal protein L30 gene family
Mol. Cell. Biol.
Characterization of the multigene family encoding the mouse S16 ribosomal protein: strategy for distinguishing an expressed gene from its processed pseudogene counterparts by an analysis of total genomic DNA
Mol. Cell. Biol.
Functional dissection of a mouse ribosomal protein promoter: significance of the polypyrimidine initiator and an element in the TATA-box region
Proc. Natl. Acad. Sci. USA
Cited by (6)
Identification of 5′-upstream region of pufferfish ribosomal protein L29 gene as a strong constitutive promoter to drive GFP expression in zebrafish
2004, Biochemical and Biophysical Research CommunicationsApplication of comparative genomics in fish endocrinology
2002, International Review of CytologyGene structure of the carp fish ribosomal protein L41: Seasonally regulated expression
2002, Biochemical and Biophysical Research CommunicationsCitation Excerpt :Conversely, in other r-protein genes, this orthodox cis-acting sequence is replaced by the γ element that can bind TBP, as is the case with the mouse L32 r-protein promoter [36,37]. The cL41 transcription start site is separated from the ATG by one small intron and the 5′ region comprises two T-rich regions (−468 and −246) similar to those described for yeast [38] and tilapia r-protein promoters [39]. In higher eukaryotes, the promoter region of the r-proteins comprises four elements recognizable by the ubiquitous transcription factors α (RFX-1), β (GABP), γ (γ-factor), and δ (NF-E1) [37].