Fig. 1. Conservation and expression of the Leishmania AM genes. (A) The AM gene locus of L. major. Physical map showing the arrangement of the six genes, AMA–F, on chromosome 30; each gene is designated by a box. F1, 9 Kb Xho1 fragment; F2–F7, 6.1 Kb Xho1 fragments. Arrows indicate the direction of transcription; restriction sites are as follows: X, Xho1; E, EcoR1; Sp, Sph1; N, Not1; C, Cla1. Black box, 2 Kb Sph1 fragment, probe SS4 from the ORF; hatched box, regions of hybridisation with LmcDNA2; gray hatched box, 0.8 Kb Sph1 fragment, probe SS1 from the 3′UTR; cross-hatched box, unique 3′UTR of AMF; SS8, 1.2 Kb Sac1 fragment subcloned from F1; EX, 1.0 Kb EcoR1/Xho1 fragment subcloned from F7. (B) Conservation of the AM genes in Old and New World Leishmania. Genomic DNAs from L. donovani LV9 (MHOM/ET/67/L28; tracks 1 and 7), L. infantum LEM1163 (a clone of strain MHOM/FR/78/LEM75 [10]; tracks 2 and 8), L.b.braziliensis LTB300 (MHOM/BR/84/LTB300; tracks 3 and 9), L. major FV1 (MHOM/IL/81/Friedlin; tracks 4 and 10), L.m.mexicana M379 (MNYC/BZ/62/M379; tracks 5 and 11) and L.m.amazonensis M2269 (MHOM/BR/73/M2269; tracks 6 and 12) were digested with Xho1 (tracks 1–6) or EcoR1 (tracks 7–12), size separated, blotted and hybridised with probe SS4 (see Fig. 1) at 65°C in Church buffer (0.5 M NaPi, 7% SDS). Blots were washed to a final stringency of 0.1×SSC, 0.1% SDS at 65°C and autoradiographed for 24 h at −70°C. (C) Expression of the AM genes detected by RNA blotting. Total RNAs extracted (by the acid guanidinium thiocyanate-phenol-chloroform method) from log (1) or stationary (2) promastigotes and amastigotes (3) were denatured, size-separated and blotted [5], prior to hybridisation with the 3′UTR probe, SS1, or the coding region probe, SS4. The positions of the ribosomal RNAs were detected by staining with methylene blue (m) and after hybridisation with an 18 S ribosomal DNA probe from L. m.amazonensis (rh). Logarithmic promastigote RNA was also blotted and hybridised with the EX probe. RNA blots were exposed to phosphoimager screens (6 h for probes SS1 and SS4; 12 h for probe EX) and quantitated using the ImageQuant program (Molecular Dynamics). (D) Hydrophilicity analysis. Hydrophilicity plot of the 639 amino acid AM1 protein sequence, numbered at the bottom.

Fig. 2. Expression and localisation of GFP::AM1 protein fusion. Transgenic promastigotes expressing either GFP alone (A) or GFP::AM1 (B) (generated as described in [9]) were incubated with J774 macrophages at a ratio of 3:1 and the infected cells maintained at 34°C for 5 days before fixation in 3.7% formaldehyde. Fluorescent amastigotes were viewed using a Nikon Microphot-FX epifluorescent microscope; images were captured with a Photometrics CH350 CCD camera and analysed using IPLab Spectrum software (Scanalytics Inc.). (C) Promastigote, fixed as above, expressing GFP::AM1. Microscopy size bar, 10 μm. (D) Recombinant protein fusions used in this study. The AM1 open reading frame was amplified from the plasmid pLm6.1 with Pfu polymerase (Stratagene) using the primers amGFP5′ [CGCATGCTGCAAGGTCAGTACGATCAG] and amGFP3′ [CGCCTACATATGCCAGCCAAACGC]. Amplified fragments were purified, digested and ligated into either BamH1/EcoRV cut pX NEO HASPB::GFP [9] or BamH1/Xba1 cut pX NEO GFP::HASPB to create the constructs pX AM1::GFP and pX GFP::AM1 respectively, for expression as either (i) N- or (ii) C-terminal GFP fusion proteins (GFP::AM1 or AM1::GFP).