Journal of Molecular Biology
Volume 34, Issue 3, 28 June 1968, Pages 379-386, IN1-IN2, 387-398, IN4, 399-412
Journal home page for Journal of Molecular Biology

The sequence of 5 s ribosomal ribonucleic acid

https://doi.org/10.1016/0022-2836(68)90168-XGet rights and content

Abstract

The nucleotide sequence of the low molecular weight ribosomal RNA (5 s RNA) of Escherichia coli has been studied using 32P-labelled RNA and paper fractionation techniques. This is shown to be: pUGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAUOH. There are two major species of 5 s RNA which differ by a base in only one position. A new two-dimensional procedure suitable for fractionating oligonucleotides up to 25 residues long is described.

References (22)

  • A. Bernardi et al.

    Biochim. biophys. Acta

    (1966)
  • H. Boedtker et al.

    Biochem. Biophys. Res. Comm

    (1967)
  • G.G. Brownlee et al.

    J. Mol. Biol

    (1967)
  • J.C. Lee et al.

    Biochim. biophys. Acta

    (1965)
  • M.A. Naughton et al.

    Analyt. Biochem

    (1962)
  • R. Rosset et al.

    Biochim. biophys. Acta

    (1963)
  • F. Sanger et al.

    J. Mol. Biol

    (1965)
  • G. Augusti-Tocco et al.

    Nature

    (1965)
  • A. Bayev et al.
  • R.L.C. Brimacombe et al.

    Biochemistry

    (1965)
  • G.G. Brownlee et al.

    Nature

    (1967)
  • Cited by (270)

    • Long walk to genomics: History and current approaches to genome sequencing and assembly

      2020, Computational and Structural Biotechnology Journal
      Citation Excerpt :

      In 1968, the 12 bases long complementary extremities of phage λ cos-site were the first DNA molecules sequenced [5]. The same year, a team including Sanger determined the 120 base pair (bp) long 5 s rRNA using 32P-labeled RNA and a paper fractionation-based approach [6]. In 1972, Fiers sequenced the first gene, the 510 bp of the coat protein gene from the RNA virus phage MS2 [7].

    • The Legacy of Fred Sanger—100 Years on from 1918

      2018, Journal of Molecular Biology
      Citation Excerpt :

      Sanger's group followed this study by describing the complete sequence of the 120 nucleotide-long 5S ribosomal RNA, also published in J. Mol. Biol. [10]. The RNA sequencing method was similar, in principle, to the methods Sanger had previously used for proteins.

    • Chapter 3 Manipulating DNA. From cloning to knockouts

      1996, Foundations of Modern Biochemistry
    • On comparing two structured RNA multiple alignments

      2010, Journal of Bioinformatics and Computational Biology
    View all citing articles on Scopus

    In this paper one-letter symbols for the nucleosides have been used as recommended in J. Biol. Chem. (1966), 241, 527. Similarly an abbreviation such as 7MeG has been used for 7-methyl-guanosine. We have also followed these recommendations by using hyphens to replace p in short known sequences but for reasons of space have omitted the hyphens altogether in known sequences of more than six nucleosides. Unless otherwise stated the oligonucleotide fragments mentioned in this paper have a 3′-terminal phosphate group and a free 5′-terminal hydroxyl group.

    View full text