Protein phosphatase 2A carboxymethylation and regulatory B subunits differentially regulate mast cell degranulation
Introduction
Asthma is a major cause of morbidity and mortality and its prevalence continues to rise. Asthma is a chronic inflammatory disorder of the airways, involving a variable degree of airflow obstruction, bronchial hyper-responsiveness, and airway inflammation. Activation of mast cells represents one of the earliest events in allergic asthma, leading to release of chemical mediators that recruit other cell types and orchestrate the inflammatory response. Clinically, activated mast cells have been identified in the bronchial mucosa of asthmatic patients [1], [2] and there is a strong correlation between airway hyper-responsiveness and markers of mast cell activation [3]. Recent clinical evidence now also supports a role for mast cells in the chronic features of asthma, including direct actions on airway smooth muscle and submucosal glands, which appear to be independent of recruitment of other inflammatory cell types [4], [5]. Importantly, the majority of mast cells found in these cases were in the activated state suggesting that the release of granule contents from mast cells contributes directly to submucosal gland hyperplasia and mucous secretion. Inhibition of mast cell secretion is therefore an attractive approach for the improved treatment of asthma.
Mast cells store a wide variety of chemical mediators in preformed cytoplasmic granules including histamine, serotonin and a variety of proteases, such as chymase and tryptase, which are secreted upon stimulation [6]. Mast cell degranulation can occur in response to a variety of chemical, biological and physical stimuli and is characterised by a massive mobilisation of secretory granules, their fusion with the plasma membrane and with each other, and release of granule contents. This large release is recognised as one of the primary events in type I hypersensitivity inflammatory responses and allergies and has also been associated with tissue remodelling and angiogenesis [7], [8]. Antigen-mediated activation of mast cells is initiated by the cross-linking of IgE bound to the high affinity FcεRI receptor. Subsequent receptor clustering triggers a series of signalling events that coordinate the degranulation process. Whilst the early phosphorylation events following FcεRI receptor activation are well understood [9], there is little understanding of the dephosphorylation events that regulate secretory granule mobilisation and fusion.
Serine/threonine phosphorylation is an integral process in degranulation events [10], [11], [12] and previous studies have attempted to identify the protein phosphatases involved (reviewed in [13]). The majority of studies have relied upon broad based pharmacological inhibitors and generally correlate the inhibition of serine/threonine protein phosphatases with the inhibition of secretion. Thus treatment of mast cells with high concentrations of okadaic acid (OA) inhibits degranulation and this has been attributed to inhibition of type 1 (PP1) or type 2A (PP2A) protein phosphatases. We have shown in the RBL-2H3 rat mast cell line that PP1 activity is not affected by OA treatment up to 1 μM [14] suggesting that PP2A is the key phosphatase involved. Indeed we have also shown that PP2A undergoes transient translocation to the actin cytoskeleton and plasma membrane in response to IgE-dependent and IgE-independent stimulation over a time-course that matches or precedes the peak rate of secretion [15]. These correlative studies provide strong evidence for a role for PP2A in mast cell degranulation. Despite consistent observation that high OA concentrations inhibits degranulation in a range of mast cell types, the relatively high concentration of PP1 and PP2A in cells, together with the sensitivity of other PP2A-like phosphatases (PP4 and PP6) to OA [16], makes it difficult to identify precisely which phosphatases are involved. In order to determine the precise role that PP2A plays in mast cell degranulation, specific manipulation of PP2A is required.
PP2A is a trimeric complex comprising the catalytic (PP2A-C) subunit together with a core scaffold (PP2A-A) subunit and a variable, regulatory (PP2A-B) subunit. There are at least 3 different families of PP2A-B subunit with little structural homology (PP2A-B, PP2A-B′, and PP2A-B″), each with several isoforms. The association of a particular PP2A-B subunit with the core–dimer introduces substrate selectivity and compartmentalisation of PP2A activity (reviewed in [17]). Importantly, trimeric PP2A complex formation is regulated by carboxymethylation of the PP2A-C subunit on Leu309. Although methylation has a modest effect on activity towards in vitro substrates, carboxymethylation is essential for specific regulatory subunit binding but not necessary for binding to other proteins [18].
In this study we have utilised molecular techniques to elucidate a specific role for PP2A as a regulator of IgE-mediated mast cell degranulation. We have shown that the methylation state of PP2A catalytic subunit is dynamically regulated in response to stimulation. Further we have identified specific PP2A-B subunits, which differentially regulate mast cell degranulation, suggesting that a complex series of events are required not only to initiate degranulation but also limit the extent to which mast cells release their preformed mediators.
Section snippets
Plasmid construction
PP2A-Bα short hairpin RNA (shRNA) construct in the pNTO vector, and PP2A-Cα and PP2A-B′δ short hairpin RNA constructs in pSUPER were generated as described previously [19], [20]. The PP2A-Bα shRNA targets GTGGCAAGCGAAAGAA AGTCTTTCTTTGCTTGCCAC; the PP2A-B′δ targets AAGACCATTTTGCATCGCATC; and the PP2A-Cα targets AAGGCTAAA GAAATCCTGACA. The PP2A-B′δ shRNA construct was excised from the pSUPER vector using BamHI and HindIII and subcloned into the pNTO vector. As a control in each shRNA experiment,
Down regulation of PP2A-Cα enhances mast cell degranulation
Previous studies have shown that pharmacological inhibition of PP2A with the protein phosphatase inhibitor OA results in reduced degranulation of a number of mast cell types [23], [24], [25]. Indeed, we have also shown that pre-treatment with 1 μM OA for 45 min inhibits degranulation of RBL-2H3 cells (Fig. 1A) [15]. In contrast, we show here that treatment with a 10-fold lower concentration of OA significantly enhanced degranulation (Fig. 1A). To investigate the biphasic nature of this effect, we
Discussion
Mast cell degranulation is an important process in inflammatory asthma and this process is an attractive target for asthmatic intervention, however the molecular mechanisms mediating mast cell degranulation are not completely understood. This study now provides the first direct evidence that PP2A is an important regulator of mast cell degranulation, and that disruption of PP2A core–dimer interactions with specific B subunits differentially affects degranulation.
The importance of reversible
Conclusions
We have shown that specific molecular manipulation of PP2A directly affects mast cell secretion. We further demonstrate that the role of PP2A in mast cell degranulation is regulated by dynamic carboxymethylation of PP2A-C, and importantly, have shown that specific PP2A-B subunits differentially regulate mast cell degranulation. We hypothesise that in basal conditions the AB′δC PP2A holoenzyme is responsible for preventing spontaneous mast cell degranulation by preventing the phosphorylation of
Acknowledgments
This work was supported by funding from the National Health and Medical Research Council of Australia, the Asthma Foundation NSW, the Hunter Medical Research Institute and the University of Newcastle. GK and LFC are supported by Australian Postgraduate Awards; LFC is supported by a Cancer Institute NSW Research Scholar Award and a University of Newcastle VC Award. NMV is supported by a National Health and Medical Research Council Peter Doherty Fellowship.
References (56)
- et al.
J. Allergy Clin. Immunol.
(1991) - et al.
Blood
(2000) - et al.
J. Biol. Chem.
(1993) - et al.
Pharmacol. Ther.
(2006) - et al.
J. Biol. Chem.
(2000) - et al.
J. Biol. Chem.
(2005) - et al.
J. Biol. Chem.
(1993) - et al.
Cell Biol. Int.
(1998) - et al.
J. Biol. Chem.
(2004) - et al.
J. Biol. Chem.
(1993)
J. Biol. Chem.
J. Biol. Chem.
Cell
J. Biol. Chem.
J. Biol. Chem.
Mol. Immunol.
J. Biol. Chem.
J. Biol. Chem.
J. Biol. Chem.
J. Biol. Chem.
Am. Rev. Respir. Dis.
Am. Rev. Respir. Dis.
Clin. Exp. Allergy
Eur. Respir. J.
Ann. Allergy
Clin. Exp. Allergy
Nat. Med.
Nat. Rev. Immunol.
Cited by (12)
Biased holoenzyme assembly of protein phosphatase 2A (PP2A): From cancer to small molecules
2022, Journal of Biological ChemistryCitation Excerpt :Phosphatases were once considered undruggable given their structural diversity. However, using this diversity as an advantage by targeting PP2A using molecular glues and/or disruptors could allow for the specificity to re-establish PP2A homeostasis for the treatment of a broad range of cancers (20, 44, 47, 64, 194–199). Cancer is not a singular disease but instead a series of related diseases that have distinctive disease driving mechanisms.
The PP2A subunit PR130 is a key regulator of cell development and oncogenic transformation
2020, Biochimica et Biophysica Acta - Reviews on CancerCitation Excerpt :This posttranslational modification, which is catalyzed by the S-adenosylmethionine-dependent leucine carboxyl methyltransferase 1, contributes to the complex biogenesis of active PP2A dimers and trimers [7]. Methylation of the PP2A-C subunit alters the binding of a subset of B-type subunits to promote the formation of the active PP2A heterotrimer [27–29]. Through its impact on PP2A-C methylation, PR130 may be an upstream regulator of other B-type subunits.
Protein Phosphatase 2A as a Therapeutic Target in Pulmonary Diseases
2023, Medicina (Lithuania)Targeting protein phosphatases for the treatment of inflammation-related diseases: From signaling to therapy
2022, Signal Transduction and Targeted TherapyH<inf>2</inf>O<inf>2</inf> induces PP2A demethylation to downregulate mTORC1 signaling in HEK293 cells
2018, Cell Biology International