Toll-like receptor 4 is protective against neonatal murine ischemia-reperfusion intestinal injury

doi:10.1016/j.jpedsurg.2010.02.093

Journal of Pediatric Surgery

Volume 45, Issue 6, June 2010, Pages 1246-1255

https://doi.org/10.1016/j.jpedsurg.2010.02.093 Get rights and content

Abstract

Purpose

Premature infants receiving probiotics have a decreased incidence of necrotizing enterocolitis. This may be mediated by intestinal bacterial signaling via toll-like receptors (TLRs) 2 and 4 maintaining intestinal homeostasis. We hypothesized that TLRs 2 and 4 are protective against ischemia-reperfusion (I/R) intestinal injury.

Methods

Two-week-old C57BL/6 wild-type (WT), B6.TLR2^−/−, B6.TLR4^−/−, B6.TLR2^−/−4^−/−, and microbially reduced (antibiotic-treated) mice (MR) underwent 60 minutes of superior mesenteric artery occlusion (I) followed by 90 minutes of reperfusion (R). Small intestine was harvested for analysis of microscopic injury, apoptosis, and inflammatory gene expression using quantitative polymerase chain reaction.

Results

After I/R, the median histologic injury scores of the B6.TLR4^−/−, B6.TLR2^−/−4^−/−, and MR pups were higher than the WT or B6.TLR2^−/− pups that corresponded with greater apoptosis based on terminal deoxynucleotidyl transferase-mediated dUTP-FITC nick-end labeling and activated caspase-3 immunostaining. B6.TLR4^−/−, B6.TLR2^−/−4^−/−, and MR also had elevated tissue innate immunity-associated chemokine and cytokine expression.

Conclusions

Neonatal mice deficient in TLR4, either alone or also deficient in TLR2, as well as those lacking a normal commensal intestinal microbiome are more susceptible to an I/R model of intestinal injury. These results may provide a mechanism for commensal bacterial-mediated protection, which may help to direct further studies to elucidate the mechanism of probiotic protection.

Section snippets

Mice

Adult C57BL/6 WT, B6.TLR2^−/−, B6.TLR4^−/−, and B6.TLR2^−/−4^−/− mice were used for breeding to obtain 2-week-old pups for the study. The B6.TLR2^−/− and B6.TLR4^−/− were provided as gift from Drs Shizuo Akira at Osaka University Japan and Doug Golenbock at the University of Massachusetts. The mice with combined TLR2 and 4 deficiencies were bred at our facility and screened by polymerase chain reaction (PCR) using the primer sequences: for TLR2, GGTTCAAGCCCCTTTCTTCTTTA (forward),

Microbial reduction using antibiotics

To assess the degree of microbial reduction in the mice receiving antibiotic therapy, MR and SPF 2-week-old mice were analyzed for the presence of bacteria using amplification of 16s rRNA. After DNA extraction and PCR with conserved bacterial 16s rRNA primers, a DGGE analysis revealed a relatively diverse microbial population in the SPF feces (Fig. 1, lanes D and E) compared to MR mice (Fig. 1, lanes A-C). A band denoting a single bacterial species was observed in the MR mice (Fig. 1, arrow).

Discussion

Necrotizing enterocolitis continues to be a leading cause of morbidity and mortality in VLBW infants. Despite advances with other illnesses of VLBW infants, the rate of NEC remains unchanged for the last 2 decades [12]. Lack of insight into the mechanism of NEC has made development of treatments aimed at preventing the disease difficult. Although the pathogenesis in NEC is likely multifactorial, key factors that have been implicated in NEC include intestinal hypoperfusion [13], abnormal

Acknowledgments

We would like to thank Jamie McNaught and the Cell and Molecular Pathology Core of the Digestive Disease Developmental Center at UAB for assistance with the histology, Peggie McKie-Bell for animal husbandry assistance, and Randy Bullock for his assistance with the RT-PCR and PCR-DGGE experiments.

References (28)

Rakoff-NahoumS. et al.
Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis
Cell
(2004)
O'SullivanL. et al.
Modified linker-PCR primers facilitate complete sequencing of DGGE DNA fragments
J Microbiol Methods
(2008)
ChomczynskiP. et al.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction
Analytical Biochemistry
(1987)
FanaroffA. et al.
The NICHD neonatal research network: changes in practice and outcomes during the first 15 years
Semin Perinatol
(2003)
NankervisC. et al.
The neonatal intestinal vasculature: contributing factors to necrotizing enterocolitis
Semin Perinatol
(2008)
FrostB. et al.
The importance of pro-inflammatory signaling in neonatal necrotizing enterocolitis
Semin Perinatol
(2008)
HirataN. et al.
Selective synergy in anti-inflammatory cytokine production upon cooperated signaling via TLR4 and TLR2 in murine conventional dendritic cells
Mol Immunol
(2008)
CarioE. et al.
Toll-like receptor 2 enhances ZO-1-associated intestinal epithelial barrier integrity via protein kinase C
Gastroenterology
(2004)
LemonsJ. et al.
Very low birth weight outcomes of the National Institute of Child health and human development neonatal research network, January 1995 through December 1996. NICHD Neonatal Research Network
Pediatrics
(2001)
AlfalehK. et al.
Probiotics for prevention of necrotizing enterocolitis in preterm infants
Cochrane Database Syst Rev
(2008)

BartonG. et al.

A cell biological view of Toll-like receptor function: regulation through compartmentalization

Nat Rev Immunol

(2009)

AprahamianC. et al.

Toll-like receptor 2 is protective of ischemia-reperfusion-mediated small-bowel injury in a murine model

Pediatr Crit Care Med

(2008)

HansW. et al.

The role of the resident intestinal flora in acute and chronic dextran sulfate sodium-induced colitis in mice

Eur J Gastroenterol Hepatol

(2000)

SimpsonJ. et al.

Characterization of fecal bacterial populations in canines: effects of age, breed and dietary fiber

Microb Ecol

(2002)

Cited by (32)

The protective effects of fecal microbiota transplantation in an experimental model of necrotizing enterocolitis
2019, Journal of Pediatric Surgery
Necrotizing enterocolitis (NEC) is a serious disease that affects premature neonates, causing high mortality. In the search for new options of treatment it was investigated whether fecal microbiota transplantation (FMT) decreased the inflammatory response during NEC development in experimental model.
Wistar rats were used and divided as follows: naïve, control (NEC induction), FMT-before (transplantation of microbiota before insult) and FMT-after (microbiota transplantation after insult). The microbiota transplantation was performed by administering a feces solution obtained from an adult donor rat. The induction of enterocolitis involves feeding by artificial formula, hypothermia, hypoxia and endotoxin administration. MPO activity, TNF-α, IL-1β and IL-6 levels, oxidative and nitrosative damage and the grade of intestinal mucosa lesion were analyzed.
The control group had a significant increase of inflammatory and oxidative parameters when compared to naive animals. Both FMT-before and after decreased all inflammatory and oxidative damage parameters when compared to control group. This was also true to the intestinal mucosa damage.
FMT administered just before or after NEC induction improved gut and systemic inflammation, and gut oxidative damage and intestinal injury.
Deficiency in cold-inducible RNA-binding protein attenuates acute respiratory distress syndrome induced by intestinal ischemia-reperfusion
2017, Surgery (United States)
Citation Excerpt :
It has been shown previously that CIRP transmits its downstream signal by binding to its cognate receptor TLR4/MD2 complex.10 To evaluate the status after disruption of CIRP downstream signaling molecule TLR4 during intestinal I/R, we found a number of studies to demonstrate both beneficial and detrimental outcomes in intestinal I/R using TLR4 gene deficient mice.22-24 Because TLR4 signal transduction is essential for initiating innate-immune response against pathogens by recognizing a wide range of ligands, including bacterial LPS, modulation of TLR4 signaling might generate mixed outcomes in terms of not only regulating hyper inflammation, but also compromising effective innate immune response against infection.
Intestinal ischemia-reperfusion can occur in shock and mesenteric occlusive diseases, causing significant morbidity and mortality. Aside from local injury, intestinal ischemia-reperfusion can result in remote organ damage, particularly in the lungs. Cold-inducible RNA-binding protein (CIRP) was identified as a novel inflammatory mediator. We hypothesized that a deficiency in CIRP would protect the lungs during intestinal ischemia-reperfusion injury.
Intestinal ischemia was induced in adult male C57BL/6 wild-type and CIRP knock-out (CIRP^−/−) mice via clamping of the superior mesenteric artery for 60 minutes. Reperfusion was allowed for 4 hours or 20 hours, and blood, gut, and lung tissues were harvested for various analyses.
After intestinal ischemia-reperfusion, the elevated levels of serum lactate dehydrogenase and inflammatory cytokine interleukin-6 were reduced by 68% and 98%, respectively, at 20 hours after ischemia-reperfusion in CIRP^−/− mice compared with the wild-type mice. In the gut, mRNA levels of inflammatory cytokine interleukin-6 were reduced by 67% at 4 hours after ischemia-reperfusion in CIRP^−/− mice. In the lungs, inflammatory cytokine interleukin-6 protein and myeloperoxidase activity were reduced by 78% and 26% at 20 hours and 4 hours after ischemia-reperfusion, respectively, in CIRP^−/− mice. Finally, the elevated lung caspase-3 was significantly decreased by 55%, terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling-positive cells decreased by 91%, and lung injury score decreased by 37% in CIRP^−/− mice at 20 hours after ischemia-reperfusion.
Increased levels of proinflammatory cytokines, myeloperoxidase, and apoptosis are the hallmarks of acute respiratory distress syndrome. We noticed after intestinal ischemia-reperfusion the proinflammatory milieu in lungs was elevated significantly, while the CIRP^−/− mice had significantly decreased levels of proinflammatory cytokine, myeloperoxidase, and apoptotic cells leading to decreased lung injury. These findings strongly established a causal link between CIRP and acute respiratory distress syndrome during intestinal ischemia-reperfusion injuries. Targeting CIRP may therefore be beneficial for treatment of intestinal ischemia-reperfusion-associated acute respiratory distress syndrome acute respiratory distress syndrome.
Postconditioning: “Toll-erating” mesenteric ischemia-reperfusion injury?
2017, Surgery (United States)
Citation Excerpt :
In the present study, changes in the jejunum and ileum were examined, because these segments were shown to be the most affected with superior mesenteric artery occlusion.11,17,18 IR has been suggested to trigger apoptosis as the main mode of intestinal mucosal cell death with superior mesenteric artery occlusion.19,20 Cleaved caspase-3 is a hallmark of the initiating “death cascade” and its immunohistochemical detection is used widely for assessing apoptotic rate.19-21
Postconditioning may prove to be a suitable method to decrease ischemia-reperfusion injury of intestine after mesenteric arterial occlusion. Toll-like-receptor-4 is involved in the pathophysiology of organ damage after ischemia-reperfusion; therefore, the aim of our study was to investigate the effect of postconditioning on the mucosal expression of toll-like-receptor-4.
Male Wistar rats (n = 10/group) underwent 60 minutes of superior mesenteric artery occlusion followed by 6 hours of reperfusion in 3 groups: sham-operated, ischemia-reperfusion, and a postconditioned group. Postconditioning was performed by 6 alternating cycles of 10 seconds of reperfusion/reocclusion. Blood and tissue samples were collected at the end of reperfusion. Intestinal histopathologic changes and immunohistochemical expression of mucosal caspase-3, antioxidant status, and protein levels of high-mobility group box-1 and toll-like-receptor-4 were assessed. Immunofluorescent labeling and confocal microscopic analysis of toll-like-receptor-4 were performed. Mucosal and serum levels of interleukin-6 and tumor necrosis factor-α protein were measured.
Histologic alterations in the postconditioned group were associated with decreased caspase-3 positivity, less toll-like-receptor-4 mRNA, and less protein expression of high-mobility group box-1 and toll-like-receptor-4 in the intestinal villi compared with the ischemia-reperfusion group. Furthermore, a significantly improved antioxidant state of the intestinal mucosa and less mucosal and serum protein levels of interleukin-6 and tumor necrosis factor-α were detected in the postconditioned group.
Small intestinal ischemia-reperfusion injury in male Wistar rats caused by the occlusion of the superior mesenteric artery was ameliorated by the use of postconditioning, showing a more favorable inflammatory response, which may be attributed to the decreased mucosal expression of toll-like-receptor-4.
The microbiota protects against ischemia/reperfusion-induced intestinal injury through nucleotide-binding oligomerization domain-containing protein 2 (NOD2) signaling
2014, American Journal of Pathology
Citation Excerpt :
Because epithelial injury occurs in the context of a complex and rich microbiota, which significantly affects various intestinal functions, such as innate and adaptive immune system toning, epithelial homeostasis, and nutrient metabolism,38 one could posit that microbes would influence injury response. Already, microbial sensors have been linked to I/R injury response,39,40 although microbial contribution to this phenotype has not been clearly established. Herein, we directly address this possibility and show that the microbiota is an essential component to optimal epithelial recovery from injury.
Nucleotide-binding oligomerization domain-containing protein 2 (NOD2), an intracellular pattern recognition receptor, induces autophagy on detection of muramyl dipeptide (MDP), a component of microbial cell walls. The role of bacteria and NOD2 signaling toward ischemia/reperfusion (I/R)–induced intestinal injury response is unknown. Herein, we report that I/R-induced intestinal injury in germ-free (GF) C57BL/6 wild-type (WT) mice is worse than in conventionally derived mice. More important, microbiota-mediated protection against I/R-induced intestinal injury is abrogated in conventionally derived Nod2^−/− mice and GF Nod2^−/− mice. Also, WT mice raised in specific pathogen-free (SPF) conditions fared better against I/R-induced injury than SPF Nod2^−/− mice. Moreover, SPF WT mice i.p. administered 10 mg/kg MDP were protected against injury compared with mice administered the inactive enantiomer, l-MDP, an effect lost in Nod2^−/− mice. However, MDP administration failed to protect GF mice from I/R-induced intestinal injury compared with control, a phenomenon correlating with undetectable Nod2 mRNA level in the epithelium of GF mice. More important, the autophagy-inducer rapamycin protected Nod2^−/− mice against I/R-induced injury and increased the levels of LC3⁺ puncta in injured tissue of Nod2^−/− mice. These findings demonstrate that NOD2 protects against I/R and promotes wound healing, likely through the induction of the autophagy response.
Inflammatory Signaling in Necrotizing Enterocolitis
2013, Clinics in Perinatology
Citation Excerpt :
TLR4 is the receptor for endotoxin. Although a study found that TLR4 was protective in ischemia/reperfusion injury in neonatal mice,37 there are many pieces of evidence that suggest that TLR4 has an injurious role in NEC: (1) intestinal TLR4 gene expression is increased in animals exposed to formula feeding and cold asphyxia stress during experimental NEC, whereas it is normally downregulated in dam-fed animals during the first 72 hours of life38; and (2) TLR4-deficient mice are protected against NEC.38,39 TLR4 activation in IECs has been found to delay mucosal repair by inducing HMGB1 signaling, which increases stress fibers and focal adhesions40 and reduces enterocyte proliferation by inhibiting beta-catenin signaling.41
Probiotic bacteria induce maturation of intestinal claudin 3 expression and barrier function
2012, American Journal of Pathology
An immature intestinal epithelial barrier may predispose infants and children to many intestinal inflammatory diseases, such as infectious enteritis, inflammatory bowel disease, and necrotizing enterocolitis. Understanding the factors that regulate gut barrier maturation may yield insight into strategies to prevent these intestinal diseases. The claudin family of tight junction proteins plays an important role in regulating epithelial paracellular permeability. Previous reports demonstrate that rodent intestinal barrier function matures during the first 3 weeks of life. We show that murine paracellular permeability markedly decreases during postnatal maturation, with the most significant change occurring between 2 and 3 weeks. Here we report for the first time that commensal bacterial colonization induces intestinal barrier function maturation by promoting claudin 3 expression. Neonatal mice raised on antibiotics or lacking the toll-like receptor adaptor protein MyD88 exhibit impaired barrier function and decreased claudin 3 expression. Furthermore, enteral administration of either live or heat-killed preparations of the probiotic Lactobacillus rhamnosus GG accelerates intestinal barrier maturation and induces claudin 3 expression. However, live Lactobacillus rhamnosus GG increases mortality. Taken together, these results support a vital role for intestinal flora in the maturation of intestinal barrier function. Probiotics may prevent intestinal inflammatory diseases by regulating intestinal tight junction protein expression and barrier function. The use of heat-killed probiotics may provide therapeutic benefit while minimizing adverse effects.

View all citing articles on Scopus

¹: This work was supported in part by the NIH grants R01 DK059911, P01 DK071176, K08 HD46506, and the University of Alabama at Birmingham Digestive Diseases Research Development Center grant P30 DK064400. PT received partial support from the UAB Dixon Fellowship. Aspects of this project were conducted in biomedical research space that was constructed with funds supported in part by the NIH grant C06RR020136.

View full text

AAP PaperToll-like receptor 4 is protective against neonatal murine ischemia-reperfusion intestinal injury

Abstract

Purpose

Methods

Results

Conclusions

Section snippets

Mice

Microbial reduction using antibiotics

Discussion

Acknowledgments

Cell

J Microbiol Methods

Analytical Biochemistry

Semin Perinatol

Semin Perinatol

Semin Perinatol

Mol Immunol

Gastroenterology

Very low birth weight outcomes of the National Institute of Child health and human development neonatal research network, January 1995 through December 1996. NICHD Neonatal Research Network

Pediatrics

Probiotics for prevention of necrotizing enterocolitis in preterm infants

Cochrane Database Syst Rev

A cell biological view of Toll-like receptor function: regulation through compartmentalization

Nat Rev Immunol

Toll-like receptor 2 is protective of ischemia-reperfusion-mediated small-bowel injury in a murine model

Pediatr Crit Care Med

The role of the resident intestinal flora in acute and chronic dextran sulfate sodium-induced colitis in mice

Eur J Gastroenterol Hepatol

Characterization of fecal bacterial populations in canines: effects of age, breed and dietary fiber

Microb Ecol

AAP Paper
Toll-like receptor 4 is protective against neonatal murine ischemia-reperfusion intestinal injury