Structure and expression pattern of a human MTG8/ETO family gene, MTGR1
Introduction
The MTG8 gene on chromosome 8 has been isolated from the chromosomal translocation breakpoint in acute myeloid leukemia (AML) with t(8;21) translocation, as a fusion gene with the AML1 gene (Erickson et al., 1992, Miyoshi et al., 1991, Miyoshi et al., 1993, Nisson et al., 1992). Since AML1–MTG8 fusion transcripts are consistently expressed in leukemic cells carrying the t(8;21) translocation, AML1–MTG8 fusion protein, consisting of the N-terminal part of AML1 and the C-terminal large part of MTG8, is assumed to be an essential participant in the pathogenesis of AML (Downing et al., 1993, Kozu et al., 1993). AML1 protein is a member of a family of transcriptional factors with a highly conserved ‘runt’ domain that was named after the Drosophila Runt gene (Gergen and Butler, 1988, Meyers et al., 1993). Several target genes of AML1 have been isolated (Wolff, 1997).
While studying the function of AML1–MTG8 fusion protein by expressing it in the mouse myeloid precursor cell line L-G, we found that this fusion protein was associated with an 85 kDa protein that reacted with MTG8 antibody, and this association was required for AML1–MTG8 to stimulate proliferation. Since MTG8 mRNA was not detected in L-G cells, we searched databases for ESTs encoding an MTG8-like protein. MTGR1 cDNA (6406 bp) was isolated as a candidate cDNA. This cDNA can encode a protein of 604 amino acids, the sequence of which was 61% homologous to that of MTG8b protein (604 amino acids). When MTGR1 protein was expressed in L-G cells together with AML1–MTG8, these two proteins formed a complex (Kitabayashi et al., 1998).
The MTG16 gene, which also encodes an MTG8-like protein of either 653 amino acids (MTG16a) or 567 amino acids (MTG16b), was isolated as a fusion gene with the AML1 gene from the breakpoint of t(16;21) chromosomal translocation associated with therapy-related myeloid malignancies or variant types of acute myeloid leukemia (Gamou et al., 1998). MTG16a and MTG16b proteins show a high sequence similarity to both MTG8 and MTGR1. The Drosophila Nervy gene, which is downstream of the homeotic gene Ultrabithorax, encodes a protein similar to MTGR1, MTG8 and MTG16 protein (Feinstein et al., 1995). These three human proteins and Drosophila Nervy protein contain four evolutionally conserved regions, which we termed NHR1 (from the N-terminal side, ervy omology egion 1) to NHR4. NHR1 (97 amino acids), also known as ‘TAF homology region’, shows a sequence similarity to a central 80-amino-acid region of hTAF130 (TBP associating factor 130), hTAF105, and Drosophila TAF110 (Erickson et al., 1994, Kitabayashi et al., 1998). NHR2 (27 amino acids) is in the region required for hetero-dimerization between MTGR1 and AML1–MTG8 (Kitabayashi et al., 1998) and homo-dimerization of AML1–MTG8 (Lutterbach et al., 1998a). NHR4 (about 40 amino acids), which is the most conserved region among the three proteins, consists of two zinc finger motifs. These zinc finger motifs were homologous to those of programmed cell death-induced RP-8 protein of rat, mouse, and Caenorhabditis elegans (Owens et al., 1991) and Drosophila DEAF-1 protein, known as Deformed response element binding protein (Gross and McGinnis, 1996). In addition to these conserved regions, three Pro, Ser, and Thr-rich regions are found in the N-terminal, C-terminal and middle regions.
Recently, several groups showed that MTG8 protein bound to the N-CoR (nuclear receptor corepressor) through C-terminal zinc finger motifs and MTG8 acted as a transcriptional repressor through the interaction with N-CoR/Sin3A/HDAC (histone deacetylase) complex (Gelmetti et al., 1998, Lutterbach et al., 1998b, Wang et al., 1998). These findings suggest that members of the MTG8 family might repress transcription.
In the present report, we studied the genomic structure, and expression patterns of the MTGR1 gene. We also compared the genomic structure of MTGR1 to those of MTG16 and MTG8 genes (Gamou et al., 1998, Wolford and Prochazka, 1998).
Section snippets
Genomic library and P1-library screening
To isolate MTGR1 genomic DNA, a human placenta genomic library in λ FixII (Stratagene) was screened using PCR products corresponding to nucleotides 707–1970 of MTGR1a cDNA as a probe. A total human P1 library (DMPC-HFF#1 series B; Du Pont) (Ohira et al., 1996) was screened by PCR using three sets of primers made from MTGR1 cDNA or genomic sequences. The primer sequences were as follows: Pr1 and Pr2 (Pr1=GACAAGAGAGAAACTCCCGT, Pr2=CAACAGCAGAGAATCATGTTC); Pr3 and Pr4 (Pr3=TCTTCACTTCCACAGGCGATCCAG,
Isolation of the 5′-region of MTGR1 cDNA
We previously reported 6406 bp MTGR1 cDNA, of which the 5′ 71 bp were isolated by 5′-RACE, and the rest was isolated by screening a cDNA library of human KG-1 cells. Since this cDNA was shorter than MTGR1 mRNA, which was about 7.5 and 9.3 kb (Fig. 3, Fig. 4), we suspected the presence of extended cDNA and repeated 5′-RACE using Marathon Ready cDNA from K562 cells and various human tissues as templates. Since these cDNAs yielded various PCR products, we selected relatively long PCR products, which
Discussion
Of the three MTG8 -family genes that have been isolated to date, the MTG8 and MTG16 genes were isolated from chromosomal translocation breakpoints of myeloid leukemia (Erickson et al., 1992, Gamou et al., 1998, Miyoshi et al., 1993, Nisson et al., 1992). The MTGR1 gene was identified as a candidate gene encoding an MTG8-like protein associated with ectopically expressed AML1–MTG8 protein in the mouse myeloid precursor cell line, L-G (Kitabayashi et al., 1998). The genomic structures of the MTG8
Acknowledgements
This work was supported in part by a Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Science and Culture; by a grant from the Special Coordination Funds for the Promotion of Science and Technology from the Science and Technology Agency; by a Grant-in-Aid for the Comprehensive 10 year Strategy for Cancer Control and a Grant for Research on Aging and Health from the Ministry of Health and Welfare; and by the Program for Promotion of Fundamental Studies in
References (26)
- et al.
A detailed physical and transcriptional map of the region of chromosome 20 that is deleted in myeloproliferative disorders and refinement of the common deleted region
Genomics
(1998) - et al.
Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction
Anal. Biochem.
(1987) - et al.
An AML1/ETO fusion transcript is consistently detected by RNA-based polymerase chain reaction in acute myelogenous leukemia containing the (8;21)(q22;q22) translocation
Blood
(1993) - et al.
Identification of breakpoints in t(8;21) acute myelogenous leukemia and isolation of a fusion transcript, AML1/ETO, with similarity to Drosophila segmentation gene, runt
Blood
(1992) - et al.
EHT, a new member of the MTG8/ETO gene family, maps on 20q11 region and is deleted in acute myeloid leukemias
Blood
(1998) - et al.
The partner gene of AML1 in t(16;21) myeloid malignancies is a novel member of the MTG8(ETO) family
Blood
(1998) - et al.
Junctions of the AML1/MTG8(ETO) fusion are constant in t(8;21) acute myeloid leukemia detected by reverse transcription polymerase chain reaction
Blood
(1993) - et al.
Transcriptionally active chimeric gene derived from the fusion of the AML1 gene and a novel gene on chromosome 8 in t(8;21) leukemic cells
Cancer Genet. Cytogenet.
(1992) - et al.
A 1.6-Mb P1-based physical map of the Down syndrome region on chromosome 21
Genomics
(1996) - et al.
Structure and expression of the human MTG8/ETO gene
Gene
(1998)