1 Introduction

The superfamily of glycoside hydrolases (also named glycosyl hydrolases or glycosidases) is composed of 81 enzyme families that hydrolyze a wide range of substrates (Lombard et al. 2014). Among them, chitinases (EC 3.2.1.14) catalyze the hydrolytic cleavage of β-1,4 glycosidic bonds present in chitin, an insoluble derivative of glucose with sizes ranging from 20 to 90 kDa, and the second most abundant natural polysaccharide on earth after cellulose (Bhattacharya et al. 2007). Aside from being the major component of the exoskeleton of arthropods and nematodes, chitin is also the major component of the cell wall of bacteria, algae and higher fungi such as Basidiomycetes, Ascomycetes and Deuteromycetes. Up to 60 % of the cell wall of these organisms can be made of chitin (Bhattacharya et al. 2007).

Although chitin is not present in virus, plants and mammals, chitinolytic activity was found in these organisms. Since many chitinases are induced in response to pathogen infection, it is believed that they are mainly involved in the defense against fungi containing chitin in their cell wall. The lysozyme activity, which in some cases is observed together with chitinase activity, has been interpreted as a defense mechanism of the plant against possible bacterial attacks.

Plants have different classes of chitinases which can be distinguished by their primary structure, the catalytic mechanism and the sensitivity to inhibitors (Kasprzewska 2003; Taira 2010; Kesari et al. 2015; Islam and Datta 2015). Individually, all classes of chitinases exhibit different substrate specificities and reaction mechanisms. For example, in the case of class III chitinases from tobacco, proteins show a considerable degree of activity of lysozyme as well as chitinolytic activity, while class VI has only chitinase activity (Brunner et al. 1998).

Plant chitinases are present in all organs and tissues, both in the vacuole and apoplast (Kasprzewska 2003). The involvement of chitinase as a mechanism of active or passive defense against pathogens has been reported and verified experimentally. In general, rapid induction and accumulation of chitinases correlates with resistance to attack by pathogens (Samac and Shah 1991; Meier et al. 1993; Gerhardt et al. 1997). However, chitinases may also be involved in plant developmental processes such as cell elongation (Zhong et al. 2002) embryogenesis (Fukamizo 2000), cold tolerance, acting as antifreeze proteins (Yeh et al. 2000; de los Reyes et al. 2001; Yu and Griffith 2001) and storage (Peumans et al. 2002). In the case of symbioses with nitrogen fixing bacteria, it is thought that chitinases are involved in the auto regulation mechanism controlling the number and formation of nodules (Vasse et al. 1993; Staehelin et al. 1995; Goormachtig et al. 1998; Kim and An 2002; Fortunato et al. 2007). Moreover, they were identified as part of the nodule protection machinery against pathogens (Staehelin et al. 2000; Salzer et al. 2000; Kim et al. 2005; Santos et al. 2010; Ribeiro et al. 2011).

In a previous study CgChi3, the gene encoding a class III chitinase, has been isolated from Casuarina glauca root nodules induced by nitrogen-fixing bacteria Frankia (Fortunato et al. 2007). The transcriptional activity of this gene is specifically associated with the symbiotic process, particularly with bacterial nodule infection (Fortunato 2006; Fortunato et al. 2007). The fact that CgChi3 is expressed specifically in nodules makes it a promising symbiotic marker candidate for the elucidation of the role of defense-related genes in symbiosis as well as for the understanding of the mechanisms of evolution of symbiosis as a reminiscent of pathogenesis. In the present manuscript, we describe the cloning, overexpression, purification of the recombinant protein class III chitinase from C. glauca and its functional characterization in order to contribute to the clarification of its role during symbiosis between C. glauca and Frankia Thr strain.

2 Materials and methods

2.1 Biological material

Casuarina (C.) glauca plants were grown hydroponically from seeds provided by B & T World Seeds, Paguignan, 34210 Aigues-Vives, France (http://b-and-t-world-seeds.com) as described by Zhong et al. (2010). For C. glauca inoculation, Frankia Thr strain was used as described in Fortunato et al. (2007).

2.2 Bacterial strains, plasmid and fungal cultures

Cloning of the coding region (ORF-Open Reading Frame) of CgChi3 gene was done into the pJET1.2/blunt vector (Fermentas, Lithuania) and the subcloning into the pET-28b vector (Novagen, Germany). Escherichia coli DH5α and BL21 (DE3) (Novagen, Germany) cells with expression plasmids were grown aerobically in Luria Bertani (LB) broth or on LB agar plates at 37 °C, supplemented with kanamycin (30 μg/mL) for selection of transformants. Phytopathogenic fungal species used in this study included Botrytis cinerea (gray mold of Jatropha curcas), Colletotrichum gloeosporioides (Anthracnose of Manihot esculenta), Fusarium oxysporum (Solanum lycopersicum) and Trichoderma viride (Solanum lycopersicum). Ectomycorrhizal species included Suillus bovinus, Amanita muscari, Hebeloma crustiliforme and endomycorrhizal species included Glomus intraradices. Phytopathogenic and ectomycorrhizal fungi were grown on Potato Dextrose Agar medium (PDA). Endomycorrhizal fungus was grown on Minimal Salts Medium (MSM). Bacterial strains included, symbiotic- (Frankia Thr, ACN14a and CCI3 and Sinorhizobium medicae 55 Mp) and non-symbiotic (E. coli K12 and BL21 (DE3), Paracoccus denitrificans and Bacillus subtilis 168 wild type) bacteria. Frankia Thr culture was grown in Bacterial Alkaline Phosphatase (BAP-PCM) medium at 26 °C in the dark as described by Schwencke (1991) and Sinorhizobium was grown in yeast extract mannitol agar medium.

2.3 Construction of CgCHI3 expression system

Based on the cDNA full-size sequence, gene-specific primers covering the coding sequence of C. glauca chitinase III gene (CgChi3, GenBank accession number EF134410) were designed and used to amplify the corresponding cDNA-ORF by PCR in an iQ5 thermalcycler (BIO-RAD, USA).

For subcloning, specific primers were designed for the same region containing the NdeI and SalI restriction sites (underlined sequences): forward primer (CgChi3 fwd) 5’–CCATCATATGGCATTTTGTACAACTCTTCC–3’ and reverse primer (CgChi3 rev) 5’–CCATGTCGACGACATGGCCCTTAATGG–3’. PCR mix (50 μL) contained 50 ng of primer, 0.45 μg of template DNA, 2.5 μL 10× BD Advantage 2 SA PCR buffer, 2.5 μL 50× BD Advantage 2 polymerase (Clontech, San Jose, CA) mix, and 10 mM dNTPs. The amplification program included an initial denaturation step (94 °C for 30 sec) followed by 35 cycles of 30 sec at 94 °C, 30 sec at 55 °C and 30 sec at 72 °C, followed by an extension step at 72 °C for 5 min. The amplified fragments were purified using the High Pure PCR Product Purification Kit (Roche Applied Science, Germany) and ligated into the cloning vector pJET1.2/blunt, using the CloneJETTM PCR Cloning Kit (Fermentas, Lithuania), according to the manufacturer’s instructions. The ligation product was used to transform competent E. coli DH5α cells, plated on LB agar medium containing kanamycin (30 μg/mL) and incubated at 37 °C overnight.

Selected clone (pJET1.2-Cgchi3-ORF) was used to inoculate 5 mL of LB cultures containing kanamycin (30 μg/mL), grown at 37 °C for 18 h at 220 rpm orbital shaking for isolation of plasmid DNA using the Illustra PlasmidPrep Midi Flow kit (GE Healthcare Life Science, Germany). The plasmids, pJET1.2-Cgchi3-ORF and pET-28b, were subsequently quantified and hydrolyzed with the restriction endonucleases NdeI and SalI (Fermentas, Lithuania) according to instructions of the manufacturer. The fragment corresponding to CgChi3-ORF gene was purified from agarose gel using the High Pure PCR Product Purification kit (Roche Diagnostics GmbH, Germany) and quantified spectrophotometrically.

For the construction of the overexpression vector the purified fragment was ligated to the linearized expression vector in a 3:1 (insert:vector) ratio using the enzyme T4 DNA ligase (Fermentas, Lithuania), following the instructions of the manufacturer. The ligation product was used to transform competent E. coli DH5α cells as described above. Selection of positive clones was performed by colony-PCR using the amplification conditions described before. Plasmid DNA was isolated and sequenced using specific primers for the pET-28b plasmid, in order to confirm the cloned sequence.

2.4 Recombinant protein overexpression in Escherichia coli BL21 (DE3) cells and purification

One of the positive clones (pET28b-CgCHI3-ORF) was used to transform E. coli BL21 (DE3) competent cells by heat shock following the protocol of the manufacturer.

For overexpression of recombinant protein, a 5 mL LB medium culture containing kanamycin was inoculated with one E. coli BL21 (DE3) transformant and grown for 8 h at 37 °C, at 210 rpm. The pre-inoculum was diluted 100× in 50 mL of LB-kanamycin medium and incubated for 16 h under the same conditions. The overnight culture was diluted 100× in 1 L of LB medium containing antibiotic and incubated at 37 °C with stirring at 210 rpm until OD600 nm between 0.5 and 0.6. At this time, protein expression was induced with 0.1 mM of isopropyl β-D-1-thiogalactopyranoside (IPTG). After 3 h the culture was centrifuged at 5,700 g for 30 min at 4 °C to collect overexpression cells. The pellet was suspended in 10 mM Tris–HCl pH 7.6. The overexpression of recombinant protein was assessed by SDS-PAGE (12.5 %) as described by Laemmli (1970) in a vertical system (BIO-RAD, USA) at a constant current of 120 V for 1 h 30 min.

After three freeze-thaw cycles of the above obtained suspension, DNase I from bovine pancreas (Sigma, Spain) was added to the cell suspension before cell disruption in a French Pressure Cell Press (Thermo Electron Corporation, USA) at a pressure of 1,700 psi. After the addition of 10 mM of benzamidine hydrochloride (Sigma, Spain) and 1 mM of phenylmethanesulfonyl fluoride (Sigma, Spain), the mixture was centrifuged at 5,700 g for 20 min at 4 °C. The resulting cellular suspension was then ultracentrifuged (Beckman Optima LE-80 K com rotor 70 Ti, USA) at 225,072 g for 1 h at 4 °C, in order to separate the soluble fraction from the membrane fraction. Pellets were resuspended in lysis buffer (50 mM Tris–HCl, pH 7.8, 1 mM EDTA) and frozen at −80 °C.

As CgCHI3 recombinant protein was found to be in the pellet from the low speed centrifugation, solubilization from inclusion bodies was done using the procedure described by (Kirubakaran and Sakthivel 2007) with a slight modification. The addition of β-mercaptoethanol (2.5 mM) was replaced by a redox buffer composed of GSH (3 mM / 0.3 mM GSSG) (Sigma, Spain). Membrane fraction was centrifuged at 13,500 g for 10 min at 4 °C and the pellet containing the inclusion bodies was washed in three volumes of wash buffer (10 mM Tris–HCl, pH 7.5, 300 mM NaCl, 1 mM EDTA, 1 % Triton X-100 and 1 M urea), kept at room temperature for 5 min, and centrifuged as above. The detergent was removed by ressuspending and washing the pellet using sterile distilled water 5 times and centrifuged as above. For protein renaturation, the pellet was suspended in a 10× volume of 50 mM Tris–HCl, pH 7.8, 5 mM MgCl2, 0.3 mM GSSG, 3 mM GSH, 0.1 % (w/v) Tween 20 (denaturation–renaturation buffer; DR buffer) containing 8 M urea and incubated at room temperature for 1 h. The mixture was centrifuged at 10,000 g for 20 min at 4 °C. The supernatant was dialyzed gradually overnight against DR buffer containing progressively lower concentrations of urea down to 0 mM.

The presence of the protein on the soluble fraction was analyzed on a 12.5 % denaturing polyacrylamide gel, followed by Western Blotting by the positive reaction with an antibody against Class III chitinase of Lupinus albus (Regalado et al. 2000) and a monoclonal antibody against histidine (Sigma, Spain) that recognizes the affinity tag of the recombinant protein. After electrophoresis, proteins were electrotransferred to a PVDF membrane (GE Healthcare Life Sciences, Germany) following the protocol described by Regalado and Ricardo 1996).

2.5 Purification from inclusion bodies

Purification of the recombinant protein was performed on ÄKTA Prime Plus Liquid Chromatography system (GE Healthcare Life Science, Germany) at 4 °C. The solubilized and refolded protein solution was centrifuged at 5,850 g for 20 min at 4 °C. The supernatant was filtered and applied into a 1 mL HisTrap FF ™ column (GE Healthcare Life Science) equilibrated with buffer A composed by 50 mM Tris–HCl pH 7.8, 5 mM MgCl2, 2.5 mM β-mercaptoethanol, 0.1 % (w/v) Tween 20, 20 mM imidazol. After washing the column with buffer A, adsorbed proteins were eluted with buffer B (50 mM Tris–HCl pH 7.8, 5 mM MgCl2, 2.5 mM β-mercaptoetanol, 0.1 % (w/v) Tween 20, 500 mM imidazol) and collected in 1 mL fractions at a flow rate of 1 mL/min.

Protein purity was assessed by SDS-PAGE (12.5 %). The concentration of dialyzed protein was determined by the bicinchoninic acid (BCA) assay method (Sigma, Spain).

2.6 Functional analysis of recombinant protein

2.6.1 Enzymatic activities assays

The CgCHI3 chitinolytic activity was tested using the polymeric substrate, carboxymethyl chitin Remazol Brilliant Violet (CM-chitin-RBV, Loewe Biochemica, Germany), a soluble derivative of chitin, as described by Wirth and Wolf (1992). The enzyme, 0.1 mL of enzyme at a concentration of 1 μg/mL, was pre-incubated at 37 °C with 0.2 mL of 0.2 M sodium acetate buffer pH 5.4. The reaction was started by the addition of 0.1 mL of CM-chitin-RBV (2 mg/mL) and after specific reaction times, stopped by the addition of 0.1 mL of 2 N HCl. The non-degraded material was precipitated on ice for 10 min and then centrifuged at 10,000 g for 5 min. The absorbance of the supernatant was measured in a Evolution 300 UV–vis Spectrophotomer (Thermo Scientific, USA) at 550 nm against water. Three independent measurements were performed and average values used. The specific activity was defined as U/mg, with activity unit (U) as the ΔAbs550 nm/min, calculated as the initial velocity in accordance with an exponential first order increase. The exochitinase activity was assessed using the chitinase assay kit from Sigma that tests the chitobiosidase and β-N-acetylglucosaminidase enzymatic activities using 4-nitrophenyl N,N’-diacetyl-β-D-chitobioside and 4-nitrophenyl N-acetyl-β-D-glucosaminide, respectively, as substrates.

Lysozyme activity of the purified enzyme was measured by the rate of lysis of Micrococcus lysodeikticus cell walls (Sigma, Germany) as described by Shugar (1952). The reaction contained 2.9 mL of cell suspension (9 mg of dried M. lysodeikticus cells walls in 30 mL of 0.1 M potassium phosphate buffer, pH 7.0) and 0.1 mL of enzyme solution at different concentrations and monitored continuously as decrease in light scattering at 450 nm for 30 min at 25 °C in a Evolution 300 UV–vis Spectrophotomer (Thermo Scientific, USA). One unit of enzymatic activity was considered equal to a decrease in turbidity of 0.001 per minute at 450 nm.

β-1,3-glucanase activity was determined using the polymeric substrate, carboxymethyl-curdlan chitin Remazol Brilliant Blue (CM-Curdlan-RBB, Loewe Biochemica, Germany) a soluble derivative of chitin, as described by Wirth and Wolf (1992). The enzymatic assay was identical to the chitinolytic test, but using a stock solution of substrate at 4 mg/mL. The increase of optical density was measured at 600 nm against a blank assay prepared without enzyme solution. Three independent measurements were performed and average values used. The activity as for the chitinase one, with activity unit (U) as the ΔAbs600 nm/min.

β-1,4-endoglucanase (cellulase) activity was analyzed using sodium salts of carboxymethyl cellulose (CMC) in 0.2 % (w/v) 50 mM potassium phosphate-citric acid (PCA) pH 5.2 as enzyme substrate, according to Chen et al. (2004): 0.2 mL of substrate was mixed with 0.2 mL of enzyme solution (0.54 mg/mL) and 0.4 mL of PCA buffer and incubated at 30 °C for different reaction times. To measure the production of reducing sugar units, 0.8 mL of distilled water and 1 mL of BCA reagent were added to 0.2 mL of the previous reaction mixture at 100 °C for 15 min (Waffenschmidt and Jaenicke 1987). Samples were then cooled at room temperature for 10 min and absorbance was measured at 570 nm.

2.6.2 Antifungal activity

The disk diffusion method was used to study the antifungal activity (Elhamid et al. 2010). The assay was carried out in 9 cm diameter Petri plates containing PDA medium. The mycelium of several phytopathogenic filamentous fungi, Botrytis cinerea, Ccirolletotrichum gloeosporioides, Furasium oxysporum and Trichoderma viride were inoculated at the center of the plates; when the colony diameter reached 3–4 cm, different amounts of chitinase protein (0.01 mg and 0.0025 mg) were applied directly into the Petri plate or in a filter paper followed by incubation at 25 ± 2 °C. After 3 days, the growth was observed. Positive controls with water and DR buffer was used and all preparations of enzyme, buffer and water were sterilized by filtration. Each assay was performed in triplicate.

2.6.3 Antibacterial activity

The same approach described above was performed. In the present assay 3 species of pathogenic bacterial strains were used: E. coli K12 and BL21 (DE3), Paracoccus denitrificans and Bacillus subtilis 168 wild type. Each bacterial strain was grown in 5 mL LB for 16 h at 37 °C with vigorous agitation. 0.1 mL of the cell cultures were spread onto LB agar plates and different amounts of chitinase protein (0.01 mg and 0.0025 mg) were applied directly in the plate or in filter paper followed by incubation at 37 °C; growth was observed after 24 h.

2.6.4 CgCHI3 effect on Frankia and rhizobium growth

100 μL of 0.1 M sodium acetate pH 5.4 and 100 μL of pure enzyme (0.1 mg/mL) were added to 800 μL of the supernatant cultures of the two Frankia strains ACN14a and CcI3. As a negative control we used 400 μL Bacterial Alkaline Phosphatase (BAP) buffer, 50 μL of 0.1 M sodium acetate pH 5.4 and 50 μL of pure enzyme; as a positive control we used the supernatant of the culture medium of each bacterium. Reactions were incubated at 37 °C for 1 h and 24 h, respectively. Enzyme was inactivated for 10 min at 70 °C, 1:10 dilutions were made in all assays at a final volume of 1 mL and plant roots were inoculated with 100 mL of the reaction. Observation of results was performed daily under the microscope in order to verify changes in roots morphology (Tisa et al. 2013).

3 Results and discussion

In this study, a Casuarina glauca gene (GenBank: EF134410) encoding chitinase (CgChi3) was overexpressed in E. coli. Recombinant CgCHI3 produced has a His-tagged protein with theoretical biochemical parameters, determined by ExpasyParamTool tool (http://web.expasy.org/protparam/), of 31.9 kDa of molecular mass and a pI of 6.8. Although slightly high for an acidic protein, the pI value is similar to the ones for proteins isolated from Cornus florida (Cardwell and McDaniel 1998) and green beans (Ye and Ng 2005). Proteins of higher plants and algae typically exhibit pI values between 3.0 and 10 (Jollès and Muzzarelli 1999).

Amino acid sequence analysis revealed that CgCHi3 is a class III chitinase belonging to family 18 (Figure S1 Supplementary material shows a comparative analysis of the primary structure of CHI3). In addition, and based on its amino acid sequence it was possible to classify CgCHI3 as a protein from the PR-8 family of the pathogenesis-related (PR) proteins group. Mauch and Staehelin proposed a model for the defense mechanism of plants that involves the synergistic action of β-1,3-glucanases (that are members of the PR-2 family) and chitinases, in which the first would act in an early stage of infection, releasing β-1,3-glucans from fungal hyphae which then activate the expression of defense gene, in particular those encoding chitinases that would completely degrade the cell walls of pathogens leading to lysis (Mauch and Staehelin 1989).

3.1 Cloning and overexpression

The production of recombinant CgCHI3 using the overexpression plasmid pET28b-CgCHI3-ORF in E. coli BL21 (DE3) cells was achieved at 15 °C in LB medium with kanamycin (30 μg/mL) after induction of gene expression with 0.1 mM IPTG for 3 h. Cellular fractionation showed that the protein was predominantly produced as inclusion bodies. Attempts to produce the protein in the soluble form was unsuccessful. Protein aggregates were denatured with 8 M urea and renaturated slowly removing the denaturing agent by dialysis. Purity of protein preparations obtained by solubilization and refolding of inclusion bodies was verified by SDS-PAGE (Fig. 1). Analysis of gels revealed a high intensity band around 32 kDa (32.5 ± 2.2 kDa), characteristic of chitinases. Proteins from higher plants and algae have molecular masses around 30 kDa, while in mollusks, vertebrates and some fungi and bacteria may vary between 40 and 120 kDa (Jollès and Muzzarelli 1999). Besides the major band at ∼32 kDa, SDS-PAGE gels of all protein preparations also showed the presence of minor bands with higher molecular masses that were attributed to stable oligomeric forms of the protein since purification of the refolded protein by affinity chromatography using a HisTrap FF column did produce protein preparations with the same degree of purity and identical electrophoretic pattern.

Fig. 1
figure 1

SDS-PAGE analysis of recombinant C. glauca chitinase obtained from solubilization of inclusion bodies. M – Low Molecular Weight Marker (LMW NZYTech, Portugal); 1 – Recombinant CgCHI3 containing solution obtained after renaturation of inclusion bodies. The box indicates the position of the band corresponding to chitinase

Full size image

3.2 Functional analysis of recombinant protein

In order to evaluate the role of CgCHI3 in the symbiotic process with Frankia different catalytic activities were tested.

3.2.1 Enzymatic activities assays

CgCHI3 showed chitinolytic activity for the substrate CM-Chitin-RBV at pH 5.4 and 37 ° C, with a specific activity of 23.5 ± 4.2 U/mg (Fig. 2a), a value of the same order of magnitude of those reported for chitinases from barley seeds, recombinant and native, which have a specific activity of 12 ± 0.7 U/mg for the same substrate (Andersen et al. 1997). Moreover, CgCHI3 has a kinetic profile similar to the one obtained by Saborowski et al. (1993) in the optimization of the activity assay used to assess chitinase activity. In fact, the change in absorbance at 550 nm as a function of reaction time is linear up to 0.5 absorbance units at a rate of 7.3 × 10−3 U compared with 4.8 × 10−3 U for CgCHI3. The activity of endochitinase was confirmed when testing the exochitinase activity of CgCHI3 since the values of specific activities obtained for the later were always less than 1 % of the value obtained for the positive control from the Sigma kit (Tronsmo and Harman 1993; Duo-Chuan et al. 2005).

Fig. 2
figure 2

Enzymatic activities assays of CgCHI3. a Chitinase activity using CM-Chitin-RVB as substrate at pH 5.4 and 37 °C; b Lysozyme activity using a Micrococcus lysodeikticus cell culture at pH 7.0, 25 °C; c β-1,3-glucanase activity using CM-curdlan-RBB as substrate at pH 5.4 and 37 °C; d β-1,4-glucanase activity (carboxymethyl cellulase) using carboxymethyl cellulose at pH 5.2, 30 °C. Each experimental point represents the mean of three replicates

Full size image

CgCHI3 also exhibited lysozyme activity with a specific activity equal to 115 ± 30 U/mg, which is a value similar to that described in the literature for homologous enzymes, in particular for latex wild-cotton chitinase (Ipomoea carnea) that has a specific activity between 69 and 80 U/mg (Patel et al. 2009; 2010). The dependence of the rate of lysis of Micrococcus lysodeikticus cells with CgCHI3 concentration is represented in Fig. 2b. Many endochitinases belonging to family 18, from plants and microorganisms such as Pseudomonas aeruginosa, Choanephora cucurbinatum and Phascolomyces articulosus, are described as bifunctional enzymes exhibiting lysozyme and chitinolytic activities (Wang et al. 2005; Jekbl et al. 1991; Bokma et al. 2002). Lysozymes and chitinases represent an important group of enzymes that hydrolyze polysaccharides. While chitinase acts on chitin, a linear polymer of N-acetylglucosamine linked by β-1,4 bonds present in the cell walls of insects, crustaceans, and fungi, lysozyme hydrolyzes the peptidoglycan of bacterial cell walls composed of alternating residues of N-acetylglucosamine and N-acetylmuramic acid linked by β-1,4 bonds. The chemical similarities between the two substrates explain the lysozyme activity of some chitinases. Despite this bifunctionality, the two proteins have amino acid sequences with low homology (Wohlkönig et al. 2010).

The ability of CgCHI3 to hydrolyze the substrate CM-curdlan-RBB and thus infer about its β-1,3-endoglucanase activity was evaluated from Fig. 2c resulting in the determination of a specific activity of 0.75 ± 0.2 U/mg. To our knowledge this is the first chitinase that shows this type of activity. β-1,3-glucanases are defense proteins from the PR-2 family, being the most abundant glucanases in plant cell walls. They hydrolyze β-1,3 glycosidic bonds of glucans present in the cell wall of most fungi, and are divided into three classes (I-III). Class I glucanases are basic proteins of approximately 33 kDa and are located in the vacuoles; classes II and III include acidic and extracellular proteins with molecular masses approximately equal to 36 kDa. Plant β-1,3-glucanases are induced in response to pathogenic infection and other stress factors such as salicylic acid, abscisic acid, wound or drought are also involved in different physiological processes, such as sporogenesis, fertilization, maturation or germination (Sinha et al. 2014). In addition to these functions, numerous studies have demonstrated in vitro antifungal capacity of glucanases belonging to classes I and II (Theis and Stahl 2004).

The activity of CgCHI3 towards the substrate carboxymethyl cellulose to evaluate β-1,4-endoglucanase (cellulase) activity was also tested. A specific activity of 73 ± 18 U/mg was determined (Fig. 2d). Cellulose is the main component of plant cell walls, constituting the most abundant polysaccharide on earth and a major source of carbon in the biosphere. It is a linear polymer of D-glucose residues linked by β-1,4 bonds. This polysaccharide can be degraded by the synergistic action of three classes of cellulases, including β-1,4-endoglucanases, cellobiohydrolases and β-glucosidase. Again, this is the first report of a chitinase with β-1,4-glucanase activity. The fact that an enzyme, like CgCHI3, presenting activity of chitinase, glucanase, and cellulase is unique and may correspond to a more effective defense against pathogens or in an optimized system involved in the symbiosis process. Enzymatic plasticity is often associated with promiscuity of enzymes, despite their specificity. The ability to recognize and metabolize various substrates may represent an evolution towards a better catalytic efficiency.

3.2.2 Antifungal activity

The importance of chitinases as components of a plant defense mechanism has been the subject of several studies (Graham and Sticklen 1994; Carstens et al. 2003). Chitin, the natural substrate of chitinase, was not found in plants, but is synthesized by organisms associated with plants, in particular fungi. As mentioned earlier, analysis of the amino acid sequence indicated that CgCHI3 belongs to family 18, class III of acidic endochitinases. In fact, as discussed above, the recombinant protein described in this work presents chitinolytic activity. Therefore, we have further evaluated its antifungal potential. No inhibition of hyphae growth was observed in any of the phytopathogenic fungi tested (data not shown). The lack of antifungal activity was also observed in the acidic chitinase class III from tamarind seeds (Rao and Gowda 2008), the acidic chitinase from grain-pea (Cicer arietinumm L.) (Vogelsang and Barz 1993) and in four enzymes isolated from Streptomyces coelicolor (Kawase et al. 2006). Although it would seem obvious to associate the antifungal activity of chitinases to chitin hydrolysis, which would lead to the weakening of cell walls and subsequent lysis of pathogen cells, the inhibition of fungal growth mechanism cannot be explained solely by the chitinolytic activity since, as mentioned above, there are various chitinases that hydrolyze chitin but have no activity against fungi. Furthermore, it must be considered that CgCHI3 is a multifunctional enzyme whose expression is closely associated with the symbiotic processes (Fortunato et al. 2007; Tromas et al. 2012). The results seem to confirm these observations.

3.2.3 Antibacterial activity

Some chitinases have higher activity for bacterial peptidoglycans than for chitin, and thus are also classified as lysozymes (Brunner et al. 1998). Lysozymes are defined as enzymes with specific hydrolytic activity directed against peptidoglycan, components from bacterial cell wall (murein) in both Gram-negative and Gram-positive bacteria. The in vitro bacteriolytic activity from different lysozymes in a wide variety of organisms is well known (During 1993). Furthermore, lysozymes have been detected in various plant species (Howard and Glazer 1967; Glazer et al. 1969; Bernasconi et al. 1987; Audy et al. 1988; Kombrink et al. 1988; Trudel et al. 1989; Stintzi et al. 1993). Thus, the antimicrobial activity of CgCHI3 was evaluated. Bacterial growth inhibition was observed, demonstrating that bacterial species are sensitive to this enzyme (Fig. 3 and Figure S2 of Supplementary material). These results are in line with the in-suspension lysozyme activity of CgCHI3 demonstrated above (Fig. 2b).

Fig. 3
figure 3

Antibacterial activity of recombinant CgCHI3. Plates containing LB agar inoculated with the bacterial species in the presence of CgCHI3 at 37 °C. A representative assay with E. coli K12 cells is presented. a – Pure enzyme; b – Diluted enzyme 1:4; c and d – Positive growth controls in which the enzyme solution was replaced by buffer and water, respectively

Full size image

3.2.4 CgCHI3 effect on Frankia and Rhizobium growth

In the legume-rhizobia symbiosis, chitinases are involved in the degradation of the chitin backbone of nodulation (Nod) factors (Goormachtig et al. 1998). Since CgCHI3 is an early noduline, specific from nodules (Fortunato et al. 2007), we tested the possibility of its involvement in the interaction with symbiotic bacteria Sinorhizobium medicae 55 Mp and Frankia ACN14a and CCI3. Contrary to legume chitinases, the presence of CgCHI3 did not affect the growth of symbiotic bacteria (data not shown). Likewise, the pre-treatment of Frankia Nod factors with CgCHI3 produced no changes in the early stages of infection, i.e., adhesion and curling of Alnus glutinosa root hairs. This observation suggests that CgCHI3 does not interact directly with the Frankia Nod factors. In fact, unlike rhizobia Nod factors, the presence of chitin backbones in Frankia factors has not been reported.

3.3 Discussion of the function of CgCHI3 in symbiosis

According to Fortunato et al. 2007, CgChi3 gene has specific transcriptional activity in nodules, mostly in the infection zone of the nodule. Based on these observations, the authors pointed out three possible roles for the product of this gene during the symbiotic process: i) recognition of the bacteria; ii) infection process; and/or iii) nodule formation. For the above mentioned reasons, the involvement of CgCHI3 in bacterial recognition process appears to be unlikely. In turn, the location of CgCHI3 in the apoplast in conjunction with the cellulase and glucanase activities, suggest that this enzyme could be involved in the intracellular penetration process of bacteria participating in structural changes, such as digestion of cell wall (cellulase) and/or formation of the infection thread involving the mycrosymbiont (glucanase). In fact, several authors have indicated the involvement of β-1,4-glucanases (cellulases) on the metabolism of the cell wall of higher plants, including cellulose biosynthesis and degradation and modification of other wall polysaccharides containing β-1,4 glucosyl residues (Buchanan et al. 2012). In the case of β-1,3-glucanase activity, it may be inferred that CgCHI3 may be involved in cell wall remodeling cleaving the β-1,3 glucan bonds of callose which is deposited in response to Frankia infection (Nowicki et al. 2012). Although the obtained results do not allow speculating on the involvement of CgCHI3 in nodule formation process, this hypothesis cannot be excluded.

Based on the obtained results, CgCHI3 proved to be a multifunctional enzyme, with chitinolytic, lysozyme, glucanase and cellulase activities. To our knowledge this is the first report of a chitinase with β-1,3 and β-1,4-glucanase activity. Besides its importance in the symbiotic process, this protein may also be appreciated in view of its potential biotechnological applications, for example in the paper, textile, beverages, feed or detergents industry. Additionally it might have interest for the ethanol production from plant waste.