Skip to main content
SpringerLink
Log in

Expression of Orexigenic and Anorexigenic Neuropeptides Before and During Hibernation in the Daurian Ground Squirrel (Spermophilus dauricus)

  • Chapter
  • First Online:
Living in a Seasonal World

Abstract

Hibernation is one of the most important energy-saving strategies used by some mammals during periods of relative food shortage. Fat-storing hibernators need to store enough body fat to survive the winter. To understand the roles leptin played before and during hibernation, we measured changes in body weight, food intake, serum leptin level, and the expression of genes related to food intake regulation in the neurons of the hypothalamic arcuate nucleus (ARC), in Daurian ground squirrels (Spermophilus dauricus). During the fattening period, the expression of neuropeptide Y (NPY) significantly decreased (P < 0.01, df = 8.348, t = −4.649), and the expression of cocaine- and amphetamine-regulated transcript (CART) peptide (P < 0.01, df = 12, t = 3.324) and serum leptin level (P < 0.05, df = 10, t = 3.070) significantly increased compared to the levels before fattening started. However, changes in neuropeptide expression did not inhibit food intake during the fattening period. The expression of pro-opiomelanocortin reached the peak value before hibernation that might be involved in reducing food intake in ground squirrels. There was no significant change in the expression of peptides during hibernation compared with the euthermic stage before fattening had started. These results suggest that leptin can regulate the expressions of Ob-Rb, CART, and NPY during the fattening period but food intake and body weight continued to rise despite the changes of serum leptin level and expressions of neuropeptides.

This is a preview of subscription content, log in via an institution to check access.

Access this chapter

Log in via an institution
Chapter
USD 29.95
Price excludes VAT (USA)
  • Available as PDF
  • Read on any device
  • Instant download
  • Own it forever
eBook
USD 169.00
Price excludes VAT (USA)
  • Available as EPUB and PDF
  • Read on any device
  • Instant download
  • Own it forever
Softcover Book
USD 219.99
Price excludes VAT (USA)
  • Compact, lightweight edition
  • Dispatched in 3 to 5 business days
  • Free shipping worldwide - see info
Hardcover Book
USD 219.99
Price excludes VAT (USA)
  • Durable hardcover edition
  • Dispatched in 3 to 5 business days
  • Free shipping worldwide - see info

Tax calculation will be finalised at checkout

Purchases are for personal use only

Institutional subscriptions

References

  • Andrews MT (2007) Advances in molecular biology of hibernation in mammals. BioEssays 29:431–440

    Article  PubMed  CAS  Google Scholar 

  • Banks WA, Kastin AB, Huang W, Jaspan JB, Maness LM (1996) Leptin enters the brain by a saturable system independent of insulin. Peptides 17(2):305–311

    Article  PubMed  CAS  Google Scholar 

  • Bjorbaek C, Elmquist J, Frantz D, Shoelson SE, Flier JS (1998) Identification of SOCS-3 as a potential mediator of central leptin resistance. Mol Cell 1:619–625

    Article  PubMed  CAS  Google Scholar 

  • Bjorbaek C, El-Haschim K, Frantz JD, Flier JS (1999) The role of SOCS-3 in leptin signaling and leptin resistance. J Biol Chem 274(42):30059–30065

    Article  PubMed  CAS  Google Scholar 

  • Boyer BB, Barnes BM (1999) Molecular and metabolic aspects of mammalian hibernation. Bioscience 49(9):713–723

    Article  Google Scholar 

  • Boyer BB, Ormseth OA, Buck L, Nicolson M, Pelleymounter MA, Barnes BM (1997) Leptin prevents post hibernation weight gain but dose not reduce energy expenditure in arctic ground squirrels. Comp Biochem Physiol 118(3):405–412

    CAS  Google Scholar 

  • Buck CL, Barnes BM (1999) Annual cycle of body composition and hibernation in free-living arctic ground squirrels. J Mammal 80:1264–1276

    Article  Google Scholar 

  • Bustin SA, Benes V, Garson JA et al (2009) The MIQE guildelines: minimun information for publication of quantitative real-time PCR experiments. Clin Chem 55(4):611–622

    Article  PubMed  CAS  Google Scholar 

  • Carey HV, Andrews MT, Martin SL (2003) Mammalian hibernation: cellular and molecular responses to depressed metabolism and low temperature. Physiol Rev 83:1153–1181

    PubMed  CAS  Google Scholar 

  • Chen JF, Yang M, Zhong WQ et al (2008) Seasonal changes in body mass, serum leptin concentration and UCP1 content in Daurian Ground Squirrels (Spermophilus dauricus). In: Lovegrove BG, McKechnie AE (eds) Hypometabolism in animals: torpor, hibernation and cryobiology. University of KwaZulu-Natal, Pietermaritzburg

    Google Scholar 

  • Concannon P, Levac K, Rawson R, Tennant B, Bensadoun A (2001) Seasonal changes in serum leptin, food intake, and body weight in photoentrained woodchucks. Am J Physiol Regulatory Integrative Comp Physiol 281:951–959

    Google Scholar 

  • Flier JS (2004) Obesity war: molecular progress confronts an expanding epidemic. Cell 116:337–350

    Article  PubMed  CAS  Google Scholar 

  • Florant GL, Porst H, Peiffer A, Hudachek SF, Pittman C, Summers SA, Rajala MW, Scherer PE (2004) Fat-cell mass, serum leptin and adiponectin changes during weight gain and loss in yellow-bellied marmots (Marmota flaviventris). J Comp Physiol B 174:633–639

    Article  PubMed  CAS  Google Scholar 

  • Gluck EF, Stephens N, Swoap SJ (2006) Peripheral ghrelin deepens torpor bouts in mice through the arcuate nucleus neuropeptide Y signaling pathway. Am J Physiol Regul Integr Comp Physiol 291:1303–1309

    Article  Google Scholar 

  • Healy JE, Ostrom CE, Wilkerson GK, Florant GL (2010) Plasma ghrelin concentrations change with physiological state in a sciurid hibernator (Spermophilus lateralis). Gen Comp Endocrinol 166(2):372–378

    Article  PubMed  CAS  Google Scholar 

  • Heldmaier G, Ortmann S, Elvert R (2004) Natural hypometabolism during hibernation and daily torpor in mammals. Respir Physiol Neurobiol 141:317–329

    Article  PubMed  Google Scholar 

  • Humphries MM, Thomas DW, Kramer DL (2003) The role of energy availability in mammalian hibernation: a cost-benefit approach. Physiol Biochem Zool 76(2):165–179

    Article  PubMed  Google Scholar 

  • Klingenspor M, Niggemann H, Heldmaier G (2000) Modulation of leptin sensitivity by short photoperiod acclimation in the Djungarian hamster, Phodopus sungorus. J Comp Physiol B 170:37–43

    Article  PubMed  CAS  Google Scholar 

  • Ladyman SR (2008) Leptin resistance during pregnancy in the rat. J Neuroendocrin 20:269–277

    Article  CAS  Google Scholar 

  • Martin SL (2008) Mammalian hibernation: a naturally reversible model for insulin resistance in man? Diab Vasc Dis Res 5(2):76–81

    Article  PubMed  Google Scholar 

  • Mercer JG, Moar KM, Ross AW, Morgan PJ (2000) Regulation of leptin receptor, POMC and AGRP gene expression by photoperiod and food deprivation in the hypothalamic arcuate nucleus of the male Siberian hamster (Phodopus sungorus). Appetite 34:109–111

    Article  PubMed  CAS  Google Scholar 

  • Michener GR (1992) Sexual differences in over-winter torpor patterns of Richardson’s ground squirrels in natural hibernation. Oecologia 89:397–406

    Google Scholar 

  • Morton GJ, Cummings DE, Baskin DG, Barsh GS, Schwartz MW (2006) Central nervous system control of food intake and body weight. Nature 443:289–295

    Article  PubMed  CAS  Google Scholar 

  • Münzberg H, Björnholm M, Bates SH, Myers MG Jr (2005) Leptin receptor action and mechanisms of leptin resistance. Cell Mol Life Sci 62:642–652

    Article  PubMed  Google Scholar 

  • Nolan T, Hands RE, Bustin SA (2006) Quantification of mRNA using real-time RT-PCR. Nat Protoc 1(3):1559–1582

    Article  PubMed  CAS  Google Scholar 

  • Ormseth OA, Nicolson M, Pelleymounter MA, Boyer BB (1996) Leptin inhibits prehibernation hyperphagia and reduces body weight in arctic ground squirrels. Am J Physiol Regul Integr Comp Physiol 271:1775–1779

    Google Scholar 

  • Peralta S, Carrascosa JM, Gallardo N, Ros M, Arribas C (2002) Ageing increases SOCS-3 expression in rat hypothalamus: effects of food restriction. Biochem Biophys Res Commun 296:425–428

    Article  PubMed  CAS  Google Scholar 

  • Schwartz MW, Woods SC, Porte D Jr, Seeley RJ, Baskin DG (2000) Central nervous system control of food intake. Nature 404:661–671

    PubMed  CAS  Google Scholar 

  • Small CJ, Liu YL, Stanley SA, Connoley IP, Kennedy A, Stock MJ, Bloom SR (2003) Chronic CNS administration of Agouti-related protein (Agrp) reduces energy expenditure. Int J Obes Relat Metab Disord 27:530–533

    Article  PubMed  CAS  Google Scholar 

  • Tang GB, Cui JG, Wang DH (2008) Hypothalamic suppressor-of-cytokine -signalling 3 mRNA is elevated and pro-opiomelanocortin mRNA is reduced during pregnancy in Brandt’s Voles (Lasiopodomys brandtii). J Neuroendocrinol 20:1038–1044

    Article  PubMed  CAS  Google Scholar 

  • Yuan LL (2008) A study on energy metabolism characteristics and hibernation patterns in Daurian ground squirrel (Spermophilus dauricus). Dissertation, Shenyang Normal University, Shenyang (Liaoning)

    Google Scholar 

  • Zhang Y, Proenca R, Maffei M et al (1994) Positional cloning of the mouse obese gene and it’s human homologue. Nature 372:425–432

    Article  PubMed  CAS  Google Scholar 

Download references

Acknowledgments

Thanks to Professor Dehua Wang and Dr. Gangbin Tang, Institute of Zoology of the Chinese Academy of Sciences, for their helpful suggestions. This study was supported by grants from the National Natural Science Foundation of China (No.30770337), (No.31170380).

Author information

Authors and Affiliations

  1. College of Chemistry and Life Science, Shenyang Normal University, 110034, Shenyang, China

    Xin Xing, Ming-Yue Sun, Shi-Yi Song & Ming Yang

  2. Liaoning Key Laboratory of Biological Evolution and Agricultural Ecology, 110034, Shenyang, China

    Xia Peng & Shi-Yi Song

Authors
  1. Xin Xing
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Ming-Yue Sun
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Xia Peng
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Shi-Yi Song
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Ming Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Ming Yang .

Editor information

Editors and Affiliations

  1. Forschungsinst. Wildtierkunde und, Ökologie, Veterinärmedizinische Universität Wien, Veterinärplatz 1, Wien, 1210, Austria

    Thomas Ruf

  2. Research Institute of Wildlife Ecology, Savoyenstr. 1, Vienna, 1160, Austria

    Claudia Bieber

  3. Research Institute of Wildlife Ecology, Savoyenstr. 1, Vienna, 1160, Austria

    Walter Arnold

  4. , Dept. of Behavioural Biology, University of Vienna, Althanstr. 14, Vienna, 1160, Austria

    Eva Millesi

Appendix

Appendix

The qRT-PCR transcripts of neuropeptides in hypothalamus of Daurian ground squirrel

1: Ob-Rb

AAACGTTACAGCTGAGATCTTGAGCAGGATTCTGCCTGTATTAGTGACCAGGGCAACAGCCCTCACATCTCTGAGGCTGGGAGCATCCCGGCTGTCTGTGAGGACGAAAGCCAGAGACAACCCTCAGTTAAATACGCCACACTGGTCAGTAATTCCAAGTCAAGCGAAACGGATGACC

2: AgRP

TACTCGTCCTAATGTGCGCCTCTTCTGAGCGATCTACAGGCCCTTCTTTAGCAGAGCTTGCAGGACTAATCCTGGGGCAGACATGTGAGGACAGGACCCCCATGCACAATCCCAGGGCTGGGATTGGGAAGGGGGAACGGAGGGATTATGCCAGA

3: NPY

CCGAAGCATACGAGCTACTCTCCAGCCGGACACCCGGGAGAGGACGCTCCAGCGGAGGACATGGCCAGATACTACTCGGCGCTGCGACACTACATCAACCTCATCACCAGGCAGAGATACGGCAAGAGAA

4: POMC

CCAAGCGTTACGTGTAGACTCACCACGGAAGCACCTGCTGGTATGTGGGCCTTGGGTGCCACCTCTGGGCATCAGATGGGA

5: CART

CAGTCGCGGGCTGGCAGGACAGTCCTATAATCTGTGTCGGAGGAGTATTAACTGAAGATGAATTCTTCACCTAGAGAAGAATTCCCTGAGTTGGAAGAGACCTTGAATCTCGA

6: SOCS-3

TGCACCTTCTCTACGTGGCCACCCTTCAGCATCTCTGTCGGAGACGGTCAATGGACACCTGGACA

7: β -actin

AGTGTCAGTAGGCGTGATAGTGAGGCCAGGATGGAGCCACCGATCCACACAGAGTACTTGCGCTCAGGGGGAGCGATAATCTTGATCTTCATGGTGCTGGGTGCCAGGGCTGTGATCTCCTTCTGCATCCTGTCAGCGATGCCTGGGTACATGGTGGTGCCGCCCGACAGCACGGTGTTGGATAGAGGTCTTAGA

Rights and permissions

Reprints and permissions

Copyright information

© 2012 Springer-Verlag Berlin Heidelberg

About this chapter

Cite this chapter

Xing, X., Sun, MY., Peng, X., Song, SY., Yang, M. (2012). Expression of Orexigenic and Anorexigenic Neuropeptides Before and During Hibernation in the Daurian Ground Squirrel (Spermophilus dauricus). In: Ruf, T., Bieber, C., Arnold, W., Millesi, E. (eds) Living in a Seasonal World. Springer, Berlin, Heidelberg. https://doi.org/10.1007/978-3-642-28678-0_47

Download citation

Publish with us

Policies and ethics

Search

Navigation